Compositions, uses and products for modulating development of the hpa axis

CN122516337APending Publication Date: 2026-08-07JUNLEBAO DAIRY GRP CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JUNLEBAO DAIRY GRP CO LTD
Filing Date
2026-06-29
Publication Date
2026-08-07

AI Technical Summary

Technical Problem

[0004]目前,针对HPA轴功能异常的干预策略主要集中于成年期药理学手段,比如使用糖皮质激素受体拮抗剂或选择性5-羟色胺再摄取抑制剂(SSRIs),但此类方法通常伴随靶向性不足、代谢负担及停药后反弹等问题

Benefits of technology

[0020] The composition for regulating HPA axis development provided by this invention can regulate the development of the hypothalamus-pituitary-adrenal (HPA) axis in people of different ages, alleviate the inhibition of centrally related hormone receptors caused by chronic stress, and has a particularly significant effect on improving the sluggish or lost feedback regulation function of hypothalamic hyperadrenocortical function.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The present application relates to the technical field of composition, in particular to a kind of composition for regulating the development of HPA axis, purposes and products.The composition for regulating the development of HPA axis provided by the present application includes casein phosphopeptide 10-300 parts by weight, iron 2-10 parts by weight, zinc 2-8 parts by weight.The composition can regulate the development of HPA axis of people of different ages, relieve the inhibition of central related hormone receptors caused by chronic stress, and the improvement effect on the lag or loss of feedback regulation function of adrenal cortex function hyperactivity is obvious.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of composition technology, and more specifically to a composition, its use, and a product for regulating HPA axis development. Background Technology

[0002] The hypothalamus-pituitary-adrenal (HPA) axis is a core neuroendocrine regulatory system that responds to internal and external environmental stimuli. This system operates through a hierarchical regulatory mechanism: the paraventricular nucleus (PVN) of the hypothalamus secretes corticotropin-releasing hormone (CRH), which acts on the anterior pituitary gland to stimulate the release of adrenocorticotropic hormone (ACTH). ACTH, in turn, drives the adrenal cortex to synthesize and secrete cortisol to maintain homeostasis. Cortisol (COR), as the terminal effector molecule of the HPA axis, not only participates in glucose and lipid metabolism, immunosuppression, and anti-inflammatory responses, but also precisely regulates negative feedback loops by binding to high-affinity glucocorticoid receptors (GRs) in the hippocampus and prefrontal cortex, thereby preventing excessive or sustained activation of stress responses.

[0003] Early life (0–36 months) is a critical window for the establishment and programming of the HPA axis. The maturation of the paraventricular nucleus (PVN) of the hypothalamus, the expression of glucocorticoid receptor (GR) in the hippocampus, and the negative feedback loop all occur during this stage. Numerous animal and human studies have shown that nutritional imbalances in early life can persistently "program" the HPA axis through epigenetic mechanisms (DNA methylation, histone modification), leading to excessive stress responses or mood regulation disorders in adulthood, and even increasing the risk of mental illnesses such as depression and anxiety.

[0004] Currently, intervention strategies for HPA axis dysfunction mainly focus on pharmacological approaches in adulthood, such as the use of glucocorticoid receptor antagonists or selective serotonin reuptake inhibitors (SSRIs). However, these methods are often accompanied by problems such as insufficient targeting, metabolic burden, and rebound after drug withdrawal. More importantly, existing interventions generally neglect the critical plasticity period in early life and are not very effective in improving pathological states caused by chronic stress, such as hyperadrenocortical function, and delayed or dysfunctional negative feedback regulation mechanisms. Summary of the Invention

[0005] In view of this, the present invention provides a composition, use and product for regulating the development of the hypothalamus-pituitary-adrenal (HPA) axis. The composition can regulate the development of the hypothalamus-pituitary-adrenal (HPA) axis and alleviate the inhibition of centrally related hormone receptors caused by chronic stress. In particular, it has a significant alleviating effect on the sluggish or lost feedback regulation function of hypothalamic hyperadrenocortical function.

[0006] To solve the above technical problems, the first aspect of the present invention provides a composition for regulating HPA axis development, the composition comprising, by weight, 10-300 parts casein phosphopeptide, 2-10 parts iron source (calculated as iron), and 2-8 parts zinc source (calculated as zinc).

[0007] Casein phosphopeptides are short-chain polypeptides obtained from casein in cow's milk through trypsin hydrolysis or fermentation. This invention unexpectedly discovered through experimental research that a composition obtained by combining casein phosphopeptides with iron and zinc can regulate the development of the hypothalamus-pituitary-adrenal (HPA) axis in people of different ages, especially infants and young children, thereby reducing the risk of overreaction or mood regulation disorders in adulthood.

[0008] Specifically, when casein phosphopeptides are combined with iron and zinc, iron can regulate the negative feedback regulation of the HPA axis by promoting the expression and function of hypothalamic and pituitary GRs. Zinc, as an essential element for T cell development and immune function, can alleviate oxidative stress and neuroinflammatory damage associated with HPA axis activation through metallothionein (MT) induction and superoxide dismutase (Cu / Zn-SOD) activation, thereby protecting the structural integrity of hypothalamic PVN neurons and helping to restore the regulatory function of the HPA axis by regulating pituitary corticotropin-releasing hormone receptors. Casein phosphopeptides themselves can promote the absorption and utilization of iron and zinc. When combined with iron and zinc, the effects of zinc and iron in the composition are further enhanced. The combination of these three components optimizes the regulatory effect of the resulting composition on the development of the hypothalamus-pituitary-adrenal axis.

[0009] In some possible embodiments, the iron is derived from any one or more of ferrous sulfate, ferrous gluconate, ferric ammonium citrate, ferrous fumarate, ferric citrate, ferric pyrophosphate, and sodium ferric ethylenediaminetetraacetate; and the zinc is derived from any one or more of zinc sulfate, zinc gluconate, zinc oxide, zinc lactate, zinc citrate, zinc chloride, and zinc acetate.

[0010] A second aspect of the present invention provides the use of the above-described composition for regulating HPA axis development in the preparation of a product for regulating HPA axis development.

[0011] A third aspect of the present invention provides a product, which is food and / or medicine.

[0012] In some possible implementations, the food is a general food, a health food, an infant formula, a functional food, and / or a medical food for non-medical purposes.

[0013] In some possible implementations, the dosage form of the medicine is tablets, capsules, granules, oral liquids and / or injections.

[0014] In some possible implementations, the product is in the form of a liquid, a solid-liquid mixture, a semi-solid, or a solid.

[0015] In some possible implementations, the product is used to regulate HPA axis development in newborns, infants, toddlers, children, adolescents, young adults, middle-aged people, and / or the elderly.

[0016] In this invention, newborns refer to people aged 0-1 month, infants refer to people aged 1 month-1 year, toddlers refer to people aged 1-3 years, children refer to people aged 3-12 years, teenagers refer to people aged 12-18 years, young adults refer to people aged 18-40 years, middle-aged people refer to people aged 40-65 years, and elderly people refer to people aged 65 and above.

[0017] In some possible implementations, the product is used to increase the level of adrenocorticotropic hormone in plasma.

[0018] In some possible implementations, the product is used to reduce cortisol levels in blood plasma.

[0019] In some possible implementations, the product is used to upregulate the mRNA expression levels of hypothalamic glucocorticoid receptors and / or pituitary glucocorticoid receptors.

[0020] The composition for regulating HPA axis development provided by this invention can regulate the development of the hypothalamus-pituitary-adrenal (HPA) axis in people of different ages, alleviate the inhibition of centrally related hormone receptors caused by chronic stress, and has a particularly significant effect on improving the sluggish or lost feedback regulation function of hypothalamic hyperadrenocortical function. Detailed Implementation

[0021] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0022] It will be understood by those skilled in the art that, unless otherwise defined, all terms used herein (including technical and scientific terms) have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. It should also be understood that terms such as those defined in general dictionaries should be understood to have the meaning consistent with their meaning in the context of the prior art, and should not be interpreted in an idealized or overly formal sense unless specifically defined.

[0023] Unless otherwise specified, the raw materials and equipment used in the following examples and comparative examples are all commercially available products.

[0024] The sources of each raw material used in the following embodiments and comparative examples of the present invention are as follows: Iron was derived from ferrous sulfate and purchased from DSM FineMeyers Nutritional Products (Shanghai) Co., Ltd. Zinc was derived from zinc citrate and purchased from DSM FineMeyers Nutritional Products (Shanghai) Co., Ltd. Selenium was derived from sodium selenite and purchased from DSM FineMeyers Nutritional Products (Shanghai) Co., Ltd. Casein phosphopeptide was purchased from Guangzhou Green Extract Biotechnology Co., Ltd.

[0025] Examples 1-3 Examples 1-3 of the present invention provide compositions for regulating HPA axis development, the specific components of which are shown in Table 1.

[0026] Comparative Examples 1-4 Comparative Examples 1 to 4 of the present invention provide compositions for regulating HPA axis development, the specific components of which are shown in Table 1.

[0027] Test Example The compositions for regulating HPA axis development provided in Examples 1-3 and Comparative Examples 1-4 were mixed with basal feed to prepare nutritional diets. The specific nutrient content is shown in Table 1. The basal feed was in powder form and used as a blank carrier, designated as the blank group. Both Comparative Example 5 and the blank group were fed the basal feed.

[0028] Table 1 Vitamins and minerals provided per kilogram of feed: Vitamin A 3700 μg RE, Vitamin D 112 μg, Vitamin E 58 mg, Vitamin K 310 μg, Vitamin B1 4000 μg, Vitamin B2 8000 μg, Vitamin B6 2800 μg, Vitamin B12 10 μg, Folic acid 850 μg, Pantothenic acid 26 mg, Biotin 103 μg, Niacin 30000 μg, Manganese 0.5 mg, Copper 3.2 mg, Selenium 170 μg, Iodine 850 μg, Sodium 1500 mg, Potassium 3800 mg, Calcium 2900 mg, Phosphorus 1900 mg, Magnesium 320 mg.

[0029] Animal efficacy experiments were conducted on rats fed the above-mentioned nutritional diets or basal diets, respectively. The experimental procedures and results are as follows: 1. Experimental process 1.1 Animal Grouping and Feeding Animals: SPF-grade SD rats, weaned pups (PND 21), half male and half female (provided by Spiford (Suzhou) Biotechnology Co., Ltd. (China), Certificate of Conformity: SCXK (Su) 2022-0006).

[0030] Total number: 108 (9 groups × 12 individuals / group, 6 males and 6 females).

[0031] Feeding conditions: temperature 22±2°C, humidity 50±10%, 12-hour light and dark alternation, free access to water, feeding for 28 days, feed is shown in Table 1.

[0032] Stress stimuli: Except for the control group, all weaned rat pups (PND 21) were subjected to chronic unpredictable mild stress (CUMS) for 21 days. Specific stressors included: restraint (4 h), cage tilt (45° for 24 h), damp bedding (24 h), fasting / water deprivation (24 h), tail clamping (1 cm from the tail tip, 3 min), swimming in cold water (4℃, 3 min), and day-night reversal (24 h). During the experiment, rats were housed individually and randomly subjected to different stress stimuli each day.

[0033] 1.2 Plasma Adrenocorticotropic Hormone (ACTH) and Cortisol (COR) Tests After 28 days of feeding, rats in each group were anesthetized by intraperitoneal injection of chloral hydrate (10%) at a dose of 350 mg / kg. Blood was collected via the abdominal aorta (AA), allowed to stand for 1 hour, and then centrifuged at 3000 r / min for 15 min at 4°C with a radius of 10.1 cm. The supernatant was aliquoted into EP tubes and stored at -80°C for later use. Serum ACTH and COR levels in each group of rats were measured using an enzyme-linked immunosorbent assay (ELISA), following the instructions of the kit (Beijing Huaying Biotechnology Research Institute).

[0034] 1.3 Hypothalamic Corticotropin-Releasing Hormone (CRH) Level Test After blood collection, the hypothalamus and pituitary gland of each group of rats were quickly separated on an ice tray and stored in liquid nitrogen for receptor assays. A portion of the hypothalamus was weighed and placed in boiling physiological saline (1 ml) for 3 min, then 0.5 ml of 1N glacial acetic acid was added and homogenized in a homogenizer for extraction. The homogenate was then neutralized with 0.5 ml of 1N NaOH and homogenized at 3000 rpm for 30 min under low temperature conditions. The supernatant was collected and stored at -20℃ for CRH assay. The assay was performed using an ELISA kit, following the instructions of the kit (Beijing Huaying Biotechnology Research Institute).

[0035] 1.4. Hypothalamic glucocorticoid receptor (GR) and pituitary corticotropin-releasing hormone receptor (CRHR), GR mRNA expression level test Total RNA extraction: 50 mg of hypothalamic / pituitary tissue block preserved in liquid nitrogen was quickly removed and immediately placed in a homogenizer. 1 ml of pre-chilled TRIzol (GIBCO-BRL) was added, and the mixture was repeatedly homogenized on ice until homogenized. 0.2 ml of chloroform was added, and the mixture was vigorously shaken for 15 seconds. The mixture was incubated at room temperature for 2-3 minutes, then centrifuged at 12000 rpm for 20 minutes at 4°C. The upper aqueous phase was collected, and an equal volume of isopropanol was added. The mixture was inverted and mixed, incubated at room temperature for 10 minutes, then centrifuged at 3000 rpm for 15 minutes at 4°C. The supernatant was discarded, and the sample was washed twice with 1 ml of 75% ethanol. The sample was dried under vacuum and dissolved in 50 μL of RNase-free water. 2 μL of the sample was diluted 40-fold, and the concentration and purity of the nucleic acids were determined using a UV spectrophotometer. Another 2 μL of the sample was subjected to 0.8% agarose gel electrophoresis. The remaining sample was stored at -70°C.

[0036] mRNA reverse transcription cDNA RT reaction system: Add RNase water to a final volume of 30 μL; 5X Buffer 6 μL; dNTP 1.5 μL; OligoT 2 μL; RNasin 1.5ul; MLV 1.5ul; RNA sample 3ug; PCR reaction: Primers were synthesized by Beijing Aoke Biotechnology Co., Ltd.

[0037] CRHR Upstream 5' ATGAGAATGAGCAGTGCTGGTT3', Downstream 5' GCTTGATGCTGTGGAAGCTGA3', Amplification length: 474 bp; GR Upstream 5' ACCCTGCTACAGTACTCATGGA3', Downstream 5' CTTGGCTCTTCAGACCTTCCT3', Amplification length: 271 bp; β-actin Upstream 5' GAACCCTAAGGCCAACCGT3', Downstream 5' TGCCGATAGTGATGACCTGAC3', PCR reaction system: dd H2O 8.5ul; PCR mix 12.5ul; forward and reverse primers 1.0ul; RT product 3.0ul; The total reaction volume is 25 μL.

[0038] CRHR was measured at 57℃ for 27 cycles; GR was measured at 53℃ for 27 cycles; after amplification, 1.2% agarose gel electrophoresis was performed.

[0039] Relative quantification of RT-PCR amplification products 10 μL of PCR product was subjected to 1.2% agarose gel electrophoresis for 1 h (100V). 3 μL of a 100 bp marker was loaded, and the optical density of the electrophoretic bands was scanned using an ImageMaster VDS image capture and analysis system. The total absorbance (A) value was expressed as the average absorbance multiplied by the band area. The ratio of the A value of the sample amplification product to the A value of the band in the β-actin amplification product was used as a parameter for mRNA expression level, and semi-quantitative analysis of CRHR and GR expression was performed separately.

[0040] 1.5 Statistical Processing All experimental data are expressed as mean ± standard deviation. One-way ANOVA was used to compare means among multiple groups, with P < 0.05 considered statistically significant.

[0041] 2. Test Results 2.1 Results of plasma ACTH and COR levels The results are shown in Table 2.

[0042] Table 2 As shown in Table 2, the plasma ACTH content of rats in the control group (fed a basal diet but not subjected to stress testing) was significantly higher than that of Comparative Example 5, while the COR content was significantly lower than that of Comparative Example 5. This indicates that stress stimulation leads to a decrease in blood ACTH content and an increase in COR content. In contrast, the plasma ACTH content of rats fed a nutritional diet containing the HPA axis-regulating compositions provided in Examples 1-3 of this invention was significantly higher than that of Comparative Examples 1-4 (fed other types of nutritional diets), while the COR content was lower than that of Comparative Examples 1-4, but the difference was not statistically significant. This indicates that ingestion of the HPA axis-regulating compositions of Examples 1-3 of this invention can promote an increase in blood ACTH and effectively regulate the increase in COR.

[0043] 2.2 CRH content in hypothalamic tissue Table 3 As shown in Table 3, the CRH content in the hypothalamus of rats in the control group (fed a basal diet but not subjected to stress testing) was significantly lower than that in control group 5, indicating that stress stimulation leads to an increase in CRH content in the hypothalamus of rats. In contrast, the CRH content in the hypothalamus of rats fed a nutritional diet containing the compositions for regulating HPA axis development provided in Examples 1-3 of this invention was significantly lower than that in control groups 1-4 (fed other types of nutritional diets), indicating that ingestion of the compositions for regulating HPA axis development provided in Examples 1-3 of this invention can significantly reduce the CRH content in the hypothalamus of rats.

[0044] 2.3 Expression levels of hypothalamic glucocorticoid receptor (GR) and pituitary corticotropin-releasing hormone receptor (CRHR) and GR mRNA Table 4 As shown in Table 4, compared with Comparative Examples 1-5, the intake of the compositions for regulating HPA axis development provided in Examples 1-3 of this invention significantly upregulated the expression of hypothalamic GR and pituitary CRHR and GR mRNA in chronically stressed rats, indicating that it can promote ACTH recovery by upregulating pituitary CRHR to enhance pituitary regulation of abnormally reduced ACTH in the blood. At the same time, the intake of the compositions for regulating HPA axis development provided in Examples 1-3 of this invention can promote the recovery of plasma COR by upregulating the levels of hypothalamic and pituitary GR to enhance the feedback regulation of hyperfunction of the adrenal cortex by the hypothalamus and pituitary. Its main sites of HPA axis regulation are in the hypothalamus and pituitary.

[0045] In summary, comparing Examples 1-3 and Comparative Example 5 (chronic stress without ingestion of the composition regulating HPA axis development), it is evident that the abnormally elevated COR in the blood of chronically stressed rats acts on the hypothalamus, its primary regulatory point, through a negative feedback mechanism. However, this does not lead to an increase in hypothalamic GR mRNA expression; instead, its content is significantly reduced, thereby weakening its function in inhibiting CRH and resulting in central hyper-CRH levels. Due to the decreased expression levels of pituitary CRHR and GR mRNA, the response to hyper-CRH and the feedback effect of high blood COR are both weakened, leading to a decrease in blood ACTH. Therefore, it can be concluded that chronic stress downregulates the expression of hypothalamic and pituitary-related receptor mRNAs in rats, thereby impairing the feedback regulatory function of the HPA, prominently manifested as a delay or loss of feedback regulation of hyperactive adrenal cortex function. The intake of the composition regulating HPA axis development provided by this invention significantly improves this condition.

[0046] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A composition for regulating HPA axis development, characterized in that, Based on weight, it includes 10-300 parts casein phosphopeptide, 2-10 parts iron, and 2-8 parts zinc.

2. The composition for regulating HPA axis development as described in claim 1, characterized in that, The iron is derived from any one or more of ferrous sulfate, ferrous gluconate, ferric ammonium citrate, ferrous fumarate, ferric citrate, ferric pyrophosphate, and sodium ferric ethylenediaminetetraacetate; the zinc is derived from any one or more of zinc sulfate, zinc gluconate, zinc oxide, zinc lactate, zinc citrate, zinc chloride, and zinc acetate.

3. Use of the composition for regulating HPA axis development according to any one of claims 1 to 2 in the preparation of products for regulating HPA axis development.

4. A product characterized in that, The product comprises the composition for regulating HPA axis development as described in any one of claims 1 to 2.

5. The product as described in claim 4, characterized in that, The product is food and / or medicine.

6. The product as described in claim 5, characterized in that, The food products mentioned are general food, health food, infant formula, functional food, and / or medical formula food for non-medical treatment purposes.

7. The product as described in claim 5, characterized in that, The dosage forms of the medicine are tablets, capsules, granules, oral liquids and / or injections.

8. The product as described in claim 4, characterized in that, The product is in the form of liquid, solid-liquid mixture, semi-solid or solid.

9. The product as described in claim 4, characterized in that, The product is used to regulate HPA axis development in newborns, infants, toddlers, children, adolescents, young adults, middle-aged people, and / or the elderly.

10. The product as described in claim 3, characterized in that, The product is used to increase the level of adrenocorticotropic hormone in plasma; and / or The product is used to reduce cortisol levels in plasma; and / or The product is used to upregulate the mRNA expression levels of hypothalamic glucocorticoid receptors and / or pituitary glucocorticoid receptors.