A pu.1 inhibitor and preparation method and application thereof

Abstract

The application discloses a PU.1 inhibitor and a preparation method and application thereof, and belongs to the technical field of biological medicines. The PU.1 inhibitor provided by the application inhibits the combination of a PU.1 transcription factor and DNA through a amidine-benzimidazole-benzene structure, has high affinity, simultaneously induces the crosslinking of DNA double strands, induces genetic material damage, and further achieves the purpose of treating osteoarthritis.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a PU.1 inhibitor, its preparation method, and its application. Background Technology

[0002] PU.1, as a key transcription factor in the hematopoietic system, mainly regulates the differentiation and functional maintenance of myeloid cells (macrophages, granulocytes, dendritic cells) and B lymphocytes. By specifically binding to the GGAA / TTCC core motif on DNA, it regulates the expression of hundreds of downstream target genes, determining the fate of hematopoietic lineages and cell homeostasis.

[0003] Existing PU.1 inhibitors have several key shortcomings that severely restrict clinical translation: Poor selectivity: Most inhibitors are not selective for other transcription factors in the ETS family (such as ELF1 and GABPα), which can easily lead to off-target toxicity.

[0004] Poor drug properties: DB1976 has poor water solubility and a short half-life in vivo; DB2115 and DB2313 have excessively flexible intramolecular linker arms, resulting in low oral bioavailability and poor metabolic stability.

[0005] Single mechanism of action: It only targets the PU.1-DNA binding interface, which is insufficient to address the multi-target regulation of PU.1 and the heterogeneity of diseases.

[0006] Limited efficacy in vivo: While existing inhibitors can alleviate symptoms in animal models, they are difficult to cure the disease, and the safety of long-term use is unclear. Summary of the Invention

[0007] (a) Technical problems to be solved Therefore, one of the main objectives of this invention is to provide a PU.1 inhibitor, its preparation method, and its application. The PU.1 inhibitor provided by this invention inhibits the binding of the PU.1 transcription factor to DNA through an amidoside-benzimidazole-benzene structure, while simultaneously inducing cross-linking of the DNA double strand, thereby inducing damage to genetic material and achieving the therapeutic effect on osteoarthritis.

[0008] (II) Technical Solution To achieve the above objectives, the present invention provides a PU.1 inhibitor having the structure shown in formula (I); Formula (I); Where m is a natural number from 0 to 3; n is a natural number from 1 to 4.

[0009] In one embodiment, the PU.1 inhibitor further includes pharmaceutically acceptable salts, esters, hydrates, solvates, metabolites, prodrugs, stereoisomers, tautomers, polymorphs, and / or isotope derivatives thereof.

[0010] In one embodiment, the structural formula of the PU.1 inhibitor is: 2PD, 3PD and / or 4PD.

[0011] In one embodiment, n is 4.

[0012] In another aspect, the present invention provides a method for preparing the above-mentioned PU.1 inhibitor, comprising: S1: The intermediate is obtained by reacting a haloalkane with p-hydroxybenzaldehyde; S2: The intermediate is reacted with 4-amidinyl-1,2-phenylenediamine hydrochloride and 1,4-benzoquinone to obtain the PU.1 inhibitor.

[0013] In one embodiment, the halogenated hydrocarbon includes 1,3-dibromopropane, 1,3-dibromo-2-(bromomethyl)propane, and / or tetrabromoneopentane.

[0014] In one embodiment, the halogenated hydrocarbon in S1 includes 1,3-dibromopropane, 1,3-dibromo-2-(bromomethyl)propane, or tetrabromoneopentane.

[0015] In one embodiment, the molar ratio of p-hydroxybenzaldehyde to haloalkanes in S1 is 2:1 to 4:1.

[0016] In one embodiment, S1 further includes potassium carbonate.

[0017] In one embodiment, the potassium carbonate comprises anhydrous potassium carbonate.

[0018] In one embodiment, the molar ratio of anhydrous potassium carbonate to p-hydroxybenzaldehyde is 1:2 to 2:1.

[0019] In one embodiment, the molar ratio of anhydrous potassium carbonate to p-hydroxybenzaldehyde is 1:1.

[0020] In one embodiment, in step S1, p-hydroxybenzaldehyde is prepared as a p-hydroxybenzaldehyde solution for reaction.

[0021] In one embodiment, the solvent for the hydroxybenzaldehyde solution includes an organic solvent.

[0022] In one embodiment, the organic solvent comprises DMF.

[0023] In one embodiment, the DMF comprises anhydrous DMF.

[0024] In one embodiment, the concentration of the hydroxybenzaldehyde solution is 0.2~0.4 mmol / mL.

[0025] In one embodiment, the haloalkane in S1 is prepared as a haloalkane solution for reaction.

[0026] In one embodiment, the solvent for the halocarbon solution includes an organic solvent.

[0027] In one embodiment, the organic solvent comprises DMF.

[0028] In one embodiment, the DMF comprises anhydrous DMF. In one embodiment, the concentration of the hydroxybenzaldehyde solution is 0.3–0.4 mmol / mL.

[0029] In one embodiment, the reaction conditions in S1 are: 60~100℃, 10~14h.

[0030] In one embodiment, the reaction conditions in S1 are: 70~90℃, 11~13h.

[0031] In one embodiment, the reaction conditions in S1 are: 80°C, 12h.

[0032] In one embodiment, the molar ratio of the intermediate in S2 to 4-amidinyl-1,2-phenylenediamine hydrochloride and 1,4-benzoquinone is 1:(2~4):(2~4).

[0033] In one embodiment, the S2 reaction takes place in a solvent.

[0034] In one embodiment, the solvent comprises an organic solvent.

[0035] In one embodiment, the organic solvent includes ethanol.

[0036] In one embodiment, the ethanol comprises anhydrous ethanol.

[0037] In one embodiment, the reaction conditions in S2 are: 60~100℃, 6~10h.

[0038] In one embodiment, the reaction conditions in S2 are: 70~90℃, 7~9h.

[0039] In one embodiment, the reaction conditions in S2 are: 80°C, 8h.

[0040] In another aspect, the present invention also provides a PU.1 inhibitor, which is obtained by the above preparation method.

[0041] In another aspect, the present invention provides a pharmaceutical composition comprising: (1) A therapeutically effective amount of the above-mentioned PU.1 inhibitors; (2) Pharmaceutically or immunologically acceptable carriers or excipients.

[0042] In another aspect, the present invention provides a pharmaceutical preparation comprising the above-described pharmaceutical composition.

[0043] In another aspect, the present invention also provides a pharmaceutical product comprising the above-described pharmaceutical preparation.

[0044] In one embodiment, the pharmaceutical product includes a vial or box.

[0045] In another aspect, the present invention also provides the use of the above-mentioned PU.1 inhibitors, pharmaceutical compositions, pharmaceutical preparations and / or pharmaceutical products in the preparation of medicaments for the prevention and / or treatment of arthritis.

[0046] In one embodiment, the subject includes a mammal.

[0047] In one embodiment, the mammals include humans, non-human primates such as chimpanzees and other apes and monkeys; farm animals such as cattle, horses, sheep, goats, and pigs; domesticated animals such as rabbits, dogs, and cats; and laboratory animals, including rodents such as rats, mice, and guinea pigs.

[0048] In another aspect, the present invention also provides the application of the above-mentioned PU.1 inhibitor in the preparation of PU.1 detection products.

[0049] In one embodiment, the detection product is a detection reagent.

[0050] In one embodiment, the detection product is a detection kit.

[0051] This invention relates only to detection for non-diagnostic purposes.

[0052] (III) Beneficial Effects This invention provides a PU.1 inhibitor, its preparation method, and its application. Compared with the prior art, it has the following advantages: 1. The drug has a more significant effect at the cellular level, with a stronger inhibitory effect on RAW264.7 and FLS cells.

[0053] 2. It alleviated the inflammation and swelling in rats with arthritis.

[0054] 3. It has a certain alleviating and therapeutic effect on bone erosion and bone destruction in arthritic rats.

[0055] 4. It shows good performance in regulating the immune system in rats with arthritis.

[0056] 5. It offers good security.

[0057] 6. High affinity with PU.1. Attached Figure Description

[0058] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0059] Figure 1 This is a schematic diagram of the synthetic route for PU.1 inhibitors; Figure 2 This is the 1H NMR spectrum of the PU.1 inhibitor 2PD; Figure 3 This is the carbon NMR spectrum of the PU.1 inhibitor 2PD; Figure 4 This is a high-resolution mass spectrum of the PU.1 inhibitor 2PD; Figure 5 This is the 1H NMR spectrum of the PU.1 inhibitor 3PD; Figure 6 This is a high-resolution mass spectrum of the PU.1 inhibitor 3PD; Figure 7 This is the 1H NMR spectrum of the PU.1 inhibitor 4PD; Figure 8 This is the carbon NMR spectrum of the PU.1 inhibitor 4PD; Figure 9 This is a high-resolution mass spectrum of the PU.1 inhibitor 4PD; Figure 10 This is a graph showing the cytotoxicity test results of PU.1 inhibitor on RAW 264.7 cells; Figure 11 This is a graph showing the cytotoxicity test results of PU.1 inhibitors on FLS cells; Figure 12 This is a Transwell assay result of the effect of PU.1 inhibitors on RA-FLS migration ability; Figure 13 This is a Transwell assay result of the effect of PU.1 inhibitors on the invasive ability of RA-FLS; Figure 14 This is a representative image of a secondary lateral paw in an AIA rat; Figure 15This is an overall evaluation chart of AIA rats; Figure 16 This is a footprint-pressure thermography image of an AIA rat; Figure 17 This is a two-dimensional imaging image of plantar pressure in AIA rats; Figure 18 This is a three-dimensional imaging image of plantar pressure in AIA rats; Figure 19 These are HE images of the heart, liver, spleen, lungs, and kidneys of a rat. Figure 20 This is a graph showing the safety evaluation indicators for rats; Figure 21 These are CD3 and CD4 analysis charts; Figure 22 This is a CD25 and Foxp3 analysis chart; Figure 23 These are CD11b and CD86 analysis charts; Figure 24 These are CD11b and CD163 analysis charts; Figure 25 These are CT images of the secondary lateral paw and knee joint of an AIA rat; Figure 26 This is a graph showing the MST detection results of PU.1 inhibitor 2PD and PU.1 DNA; Figure 27 This is a graph showing the MST detection results of PU.1 inhibitor 3PD and PU.1 DNA; Figure 28 This is a graph showing the MST detection results of PU.1 inhibitor 4PD and PU.1 DNA. Detailed Implementation

[0060] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0061] Terms and Definitions As used herein, the terms "inhibitor" or "PU.1 inhibitor" are used interchangeably. The inhibitors disclosed in this invention inhibit the binding of the PU.1 transcription factor to DNA, thereby enabling further use in the prevention or treatment of diseases and / or related symptoms associated with osteoarthritis.

[0062] As used herein, the term "pharmaceutical composition" refers to a composition comprising a PU.1 inhibitor formulated with one or more pharmaceutically acceptable carriers.

[0063] The formulation of a pharmaceutical composition can be tailored to the application. In particular, pharmaceutical compositions can be formulated using methods known in the art to provide rapid, continuous, or delayed release of the active ingredient upon administration to mammals. For example, the formulation can be selected from any of the following: plasters, granules, lotions, liniments, powders, syrups, liquids and solutions, aerosols, sprays, extracts, elixirs, ointments, fluid extracts, emulsions, suspensions, decoctions, infusions, tablets, suppositories, injections, alcoholic preparations, capsules, creams, lozenges, tinctures, pastes, pills, and soft or hard gelatin capsules.

[0064] As used herein, the term "pharmaceuticalally acceptable" refers to a substance that is suitable for use in humans and / or animals without excessive adverse effects (such as toxicity, irritation, and allergic reactions), i.e., a reasonable benefit / risk ratio.

[0065] As used herein, the term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" refers to a carrier used for the administration of therapeutic agents, encompassing a variety of excipients and diluents. This term refers to pharmaceutical carriers that are not essential active ingredients themselves and do not cause excessive toxicity upon administration. Suitable carriers are well known to those skilled in the art, and a thorough discussion of pharmaceutically acceptable excipients can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991).

[0066] Pharmaceutically acceptable carriers in a composition include any and all solvents, dispersion media, preservatives, antioxidants, coatings, isotonic and absorption-delaying agents, surfactants, fillers, disintegrants, binders, diluents, lubricants, flow aids, pH adjusters, buffers, enhancers, wetting agents, solubilizers, surfactants, antioxidants, etc., compatible with drug administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may contain other active compounds that provide complementary, additional, or enhanced therapeutic functions. Solid carriers or excipients, such as lactose, starch, or talc, or liquid carriers, such as water, fatty oils, or liquid paraffin, are possible. Other examples of carriers include culture media, such as DMEM or RPMI; and cryogenic storage media containing components that scavenge free radicals, provide pH buffering, osmotic / osmotic support, energy substrates, and ion concentrations to balance intracellular states at low temperatures; and mixtures of organic solvents with water.

[0067] As used herein, the term “therapeutic effective dose” refers to a dose sufficient to treat a disease with a reasonable benefit / risk ratio suitable for medical treatment, and the effective dose level includes subject type and severity, age, sex, drug activity, drug sensitivity, time of administration, route of administration and excretion rate, duration of treatment, factors including concomitant drugs, and other factors known in the medical field.

[0068] As used herein, the term “treatment” for a symptom or patient refers to steps taken to achieve a beneficial or desired outcome, including clinical outcomes. Beneficial or desired clinical outcomes include, but are not limited to, eliminating, substantially inhibiting, slowing, or reversing the progression of a disease, symptom, or condition; substantially improving or alleviating the clinical or aesthetic symptoms of a symptom; substantially preventing the clinical or aesthetic symptoms of a disease, symptom, or condition; and avoiding harmful or unpleasant symptoms. Treatment also refers to achieving one or more of the following: (a) reducing the severity of the symptom; (b) limiting the development of characteristic symptoms of the symptom being treated; (c) limiting the exacerbation of characteristic symptoms of the symptom being treated; (d) limiting the recurrence of the symptom in patients who previously had the symptom; and / or (e) limiting the recurrence of symptoms in patients who previously did not have symptoms of the symptom.

[0069] As used in this article, the term "prevention" refers to reducing the likelihood of the onset (or recurrence) of a disease, disorder, condition, or associated symptoms.

[0070] As used in this article, “containing,” “having,” or “including” includes “containing,” “mainly composed of,” “substantially composed of,” and “composed of”; “mainly composed of,” “substantially composed of,” and “composed of” are subordinate concepts of “containing,” “having,” or “including.”

[0071] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the reagents, methods and equipment used are conventional reagents, methods and equipment in this technical field.

[0072] Example 1: Preparation of intermediate compounds: like Figure 1As shown, 4, 6, and 8 mmol of p-hydroxybenzaldehyde and 4, 6, and 8 mmol of anhydrous potassium carbonate were weighed and placed in a 100 mL round-bottom flask. 20 mL of anhydrous DMF was added as a solvent. The reaction mixture was stirred at 30 °C under nitrogen for 1 h. Then, 2 mmol of each of the haloalkanes (1,3-dibromopropane, 1,3-dibromo-2-(bromomethyl)propane, and tetrabromoneopentane) were dissolved in 6 mL of anhydrous DMF and added dropwise to the reaction mixture. The reaction was carried out at 80 °C under nitrogen for 12 h. After the reaction was complete, the mixture was cooled to room temperature, poured into cold water (50 mL), and allowed to precipitate. The precipitate was filtered through a Buchner funnel and recrystallized from ethanol to give intermediate compounds 2BQ, 3BQ, and 4BQ, respectively.

[0073] Example 2: Preparation of PU.1 inhibitors: The intermediate compounds 2BQ, 3BQ, and 4BQ (0.6 mmol), 4-amidinyl-1,2-phenylenediamine hydrochloride (1.2, 1.8, 2.4 mmol), and 1,4-benzoquinone (1.2, 1.8, 2.4 mmol) prepared in Example 1 were weighed and added to a 100 mL round-bottom flask. 40 mL of anhydrous ethanol was added, and the mixture was heated under reflux at 80°C for 8 h under nitrogen atmosphere. The reaction was then stopped, the reaction mixture was cooled to room temperature, and the dark solid was collected by filtration. The solid was washed with dry acetone, cold anhydrous ethanol, and cold diethyl ether, and dried to obtain the dihydrochloride.

[0074] The solid was slowly dissolved in hot anhydrous ethanol (300 mL) and filtered while hot. The filtrate was concentrated to 70 mL, acidified with saturated hydrochloric acid in ethanol solution and stirred overnight, evaporated to dryness, diluted with anhydrous diethyl ether, filtered and collected, washed with anhydrous diethyl ether, and dried under vacuum to give the final products 2PD, 3PD and 4PD. Their structures were confirmed by 1H NMR, 13C NMR and HRMS (results are shown in Figure 1). Figures 2-9 (As shown).

[0075] Example 3 In vitro cytotoxicity experiment: RAW 264.7 cells were fed at a concentration of 1.5 × 10⁻⁶. 4 Cells were seeded into 96-well plates at 100 mg / mL each and cultured for 24 h. The old culture medium was then discarded, and different concentrations of 2PD, 3PD, and 4PD containing LPS (100 ng / mL) were added to the plates. After co-incubation for 24 h, the drug-containing medium was discarded, and serum-free medium containing 10% CCK8 was added. Cells were incubated at 37°C for 2 h, and cell viability was measured at 450 nm.

[0076] FLS is set at 1.5 × 10 4Cells were seeded into 96-well plates at 1000 μL per well and cultured for 24 h. The old culture medium was then discarded, and different concentrations of 2PD, 3PD, and 4PD were added to the plates. After co-incubation for 24 h, the drug-containing medium was discarded, and serum-free medium containing 10% CCK8 was added. Cells were incubated at 37°C for 2 h, and cell viability was measured at 450 nm.

[0077] The results are as follows Figure 10 and Figure 11 As shown: with the increase of 2PD, 3PD and 4PD concentrations, Figure 10 RAW 264.7 and Figure 11 The survival rate of RA-FLS cells was significantly reduced. The 4PD solution was more cytotoxic to RAW 264.7 and RA-FLS cells than the 3PD solution, which was more cytotoxic than the 2PD solution. The IC50 value of 4PD was lower than that of 3PD and 2PD.

[0078] Example 4: Effect of PU.1 inhibitor on the migration and invasion ability of RAW 264.7 cells: 1. Cell preparation and drug treatment: RA-FLS cells in logarithmic growth phase were digested, counted, resuspended in serum-free medium, and adjusted to a density of 1×10⁶. 6 The cell suspension was divided into a control group (0.1% DMSO), a 2PD group, a 3PD group, and a 4PD group. After pre-incubation at 37°C for 1 h, the cells were used for subsequent experiments.

[0079] 2. Transwell cell preparation: Migration experiment: 100 μL of the above cell suspension was directly seeded into the upper chamber of Transwell.

[0080] Invasion assay: Matrigel was diluted 1:8 with pre-cooled serum-free medium on ice. 60 μL was evenly spread on the upper surface of a Transwell membrane and incubated at 37°C for 4 h to allow it to polymerize into a gel. Excess liquid was aspirated, and 100 μL of cell suspension was inoculated.

[0081] 3. Cultivation and Induction of Transfer: Add 600 μL of complete culture medium containing 20% ​​fetal bovine serum to the lower culture dish (24-well plate) as the inoculum. Carefully place the upper culture dish containing the inoculated cells, taking care to avoid air bubbles. Incubate at 37°C, 5% CO2 for 24 h (for migration assays) or 48 h (for invasion assays).

[0082] 4. Fixation, staining, and counting; 5. Microscopic observation: After culture, gently wipe away any cells that have not penetrated the membrane from the inner surface of the upper chamber with a cotton swab. Fix the chamber in 4% paraformaldehyde for 30 min, rinse with PBS, stain with 0.1% crystal violet solution for 20 min, and gently rinse with double-distilled water until the background is clean. After air drying, randomly select 5 non-overlapping fields of view (20×) under an inverted microscope, photograph them, and record the number of cells that have penetrated the membrane.

[0083] The experiment was independently repeated three times. The number of transmembrane cells in each field of view was counted using ImageJ software, and the results are expressed as mean ± standard deviation. Statistical analysis was performed using GraphPad Prism 9.0 software. One-way ANOVA was used for comparisons among multiple groups, and Tukey's test was used for pairwise comparisons between groups. P < 0.05 indicates that the difference is statistically significant.

[0084] The results are as follows Figure 12 and Figure 13 As shown, the Transwell assay further evaluated the effects of PU.1 inhibitors on the migration and invasion of rheumatoid arthritis fibroblasts (RA-FLS). The control group showed extensive cell penetration of the culture chamber, confirming the strong migration and invasion potential of RA-FLS. Compared to the control group, all treatment groups significantly reduced the number of migrating and invading cells, with 4PD again showing the best effect. In summary, these results indicate that 4PD can effectively inhibit the proliferation, migration, and invasion of RA-FLS.

[0085] Example 5: Evaluation of the efficacy and safety of anti-arthritis therapy in vivo: Wistar rats were housed in an SPF environment (25°C, 12h / 12h light / dark cycle, 40-50% humidity) with free access to food and water. BCG vaccine treated at 80°C for 1h was thoroughly ground and mixed with sterile liquid paraffin in a laminar flow hood to prepare a 10 mg / mL complete Freund's adjuvant. After a week of acclimatization, an AIA model was established by subcutaneous injection of 0.1 mL of complete Freund's adjuvant into the right hind paw of the rats at days 15-18. The control group received saline injections using the same method.

[0086] Ten to twelve days after the model was established, the rats were randomly divided into a model group and different drug administration experimental groups (MTX, 2PD, 3PD and 4PD), with five rats in each group, and the scores of each group were kept relatively uniform.

[0087] The model group was injected with physiological saline, while the treatment group was administered the drug according to the rat's body weight. The dosage was 3 mg / kg, administered once every two days for a total of seven times. The weight changes of the rats were monitored during the administration period.

[0088] After treatment, the rats were photographed and their paws on the secondary side were recorded before euthanasia, and serum samples were collected.

[0089] After euthanasia, rats were dissected, and major internal organs and secondary paw tissue were separated for subsequent analysis. Spleen was harvested, ground, stained, and analyzed for in vivo immunological parameters using flow cytometry.

[0090] The results are as follows Figures 14-25 As shown: Figure 14 The morphological differences in secondary paw swelling were visually demonstrated in each group, with the 4PD treatment group showing the best efficacy and its paw swelling degree being closest to that of the normal control group.

[0091] like Figure 15 As shown, compared with the model group, the arthritis index, secondary paw thickness, and number of swollen joints in all groups decreased after drug treatment. During the experimental period, the body weight of rats in each treatment group remained within the normal physiological range, indicating that the drug has good biocompatibility.

[0092] Figures 16-18 Fluorescent images of rat paws contacting the glass surface are shown. Compared with normal rats, the static parameters (including mean paw pressure and mean paw area) of AIA rats were decreased. However, 4PD significantly restored paw pressure and paw area. Compared with the model group rats, the 4PD group rats had significantly increased plantar pressure and longer dwell time, approaching the level of the control group rats.

[0093] Figure 19 H&E staining histopathological analysis confirmed that no pathological changes were observed in the major organs (heart, liver, spleen, lungs, and kidneys) of the 2PD, 3PD, and 4PD groups.

[0094] Figure 20 Liver and kidney function indicators in the solution treatment groups (2PD, 3PD, and 4PD) were all within the normal range, indicating safety.

[0095] Figure 21 CD4 in rat spleen + / CD3 + Flow cytometry analysis and quantitative analysis of T cell proportions. The figure shows the CD4 count in each treatment group. + All cell types showed a decreasing trend, with the most significant reduction observed in 4PD, indicating that the treatment effectively suppressed excessive T cell activation. Regulatory T cells (Tregs) play a crucial role in inducing immune tolerance.

[0096] Figure 22Flow cytometry analysis and quantitative analysis of the Foxp3 / CD25 ratio of regulatory T cells. Flow cytometry analysis showed that, compared with the model group, the treatment group mice had a higher proportion of Tregs, with the highest proportion of 4PD, indicating that inflammation was effectively controlled and immune balance was restored.

[0097] Figure 23 and 24 Flow cytometry and quantitative analysis of M1 (CD86) and M2 (CD206) macrophages in rat spleen revealed a shift in macrophage polarization from M1 to M2, with 4PD being closest to normal levels, indicating inflammation relief and the reconstruction of immune tolerance in conjunction with Tregs.

[0098] Figure 25 Micro-CT three-dimensional reconstruction imaging analysis showed that the secondary lateral paw and knee joints of the model group rats exhibited typical RA pathological features: significant pathological swelling of the periarticular soft tissues, narrowing of the joint space, roughening of the articular surface, and a large area of ​​bone erosion. After different drug interventions, the degree of bone and joint destruction in each treatment group showed a gradient improvement, with the 4PD group showing the most significant efficacy. Based on various bone data, including bone mineral density, bone volume fraction, bone surface area to bone volume ratio, trabecular thickness, trabecular number, and trabecular separation, this result indicates that 2PD, 3PD, and 4PD play a certain role in alleviating RA bone and joint problems, with 4PD showing the most significant efficacy.

[0099] Example 6 Affinity Verification: To confirm whether compound 4PD can directly bind to the specific DNA sequence of PU.1 protein and to determine its dissociation constant (Kd), the specific DNA sequence of mouse PU.1 protein, CCAAATAAAAGGAAGTGAAACCAAGCTCTCTTGGTTTCACTTCCTTTTATTTGG, was fluorescently labeled with Cy5. 2PD and 4PD were dissolved in PBS + 0.05% Tween 20 buffer, diluted, and then mixed with an equal volume of fluorescently labeled DNA at a fixed concentration. The mixture was incubated and detected using a microthermophoresis apparatus (MST).

[0100] MST analysis showed that the Kd value of 2PD binding to PU.1 DNA was 20.4 μmol / L, that of 3PD was 3.2 μmol / L, and that of 4PD was 0.75 nmol / L, indicating that compounds 2PD, 3PD, and 4PD are all inhibitors of PU.1 DNA, with 4PD exhibiting stronger binding affinity and potential biological activity. Figures 26-28 ).

[0101] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0102] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A PU.1 inhibitor, characterized in that, It has the structure shown in equation (I); Formula (I); Where m is a natural number from 0 to 3; n is a natural number from 1 to 4.

2. The PU.1 inhibitor according to claim 1, characterized in that, The PU.1 inhibitors also include pharmaceutically acceptable salts, esters, hydrates, solvates, metabolites, prodrugs, stereoisomers, tautomers, polymorphs, and / or isotope derivatives.

3. A method for preparing the PU.1 inhibitor as described in claim 1 or 2, characterized in that, include: S1: The intermediate is obtained by reacting a haloalkane with p-hydroxybenzaldehyde; S2: The intermediate is reacted with 4-amidinyl-1,2-phenylenediamine hydrochloride and 1,4-benzoquinone to obtain the PU.1 inhibitor.

4. The preparation method according to claim 3, characterized in that, The halogenated hydrocarbons include 1,3-dibromopropane, 1,3-dibromo-2-(bromomethyl)propane and / or tetrabromoneopentane.

5. A PU.1 inhibitor, characterized in that, Obtained by the preparation method described in claim 3 or 4.

6. A pharmaceutical composition, characterized in that, include: (1) A therapeutically effective amount of the PU.1 inhibitor as described in claim 1, 2, or 5; (2) Pharmaceutically or immunologically acceptable carriers or excipients.

7. A pharmaceutical preparation, characterized in that, Includes the pharmaceutical composition of claim 6.

8. A pharmaceutical product, characterized in that, Includes the pharmaceutical preparation described in claim 7.

9. The use of the PU.1 inhibitor of claim 1, 2, or 5, the pharmaceutical composition of claim 6, the pharmaceutical formulation of claim 7, and / or the pharmaceutical product of claim 8 as a preparation of a medicament for the prevention and / or treatment of arthritis.

10. The use of the PU.1 inhibitor according to claim 1, 2 or 5 in the preparation of PU.1 detection products.

Images