Mycoplasmaviperae adhesion protein MAG1430 and use thereof

Abstract

The application belongs to the technical field of biology and particularly relates to a Mycoplasma synoviae adhesion protein MAG1430 and application thereof. The applicant identifies a new Mycoplasma synoviae adhesion protein MAG1430, which can promote the combination of Mycoplasma synoviae and host cells. Further research finds that MAG1430 realizes its adhesion function by combining with fibronectin (FN). The polyclonal antibody against the MAG1430 protein can significantly inhibit the adhesion of Mycoplasma synoviae and host cells, and the adhesion function is closely related to the virulence of the bacteria. The finding provides an important target for developing a new vaccine, a diagnostic tool and a therapeutic preparation, and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an adhesion protein MAG1430 of Mycoplasma synoviae in birds and its applications. Background Technology

[0002] Mycoplasma synoviae is an important pathogenic microorganism that can infect poultry such as chickens, turkeys, and pigeons, causing various clinical symptoms including arthritis, synovitis, and respiratory and reproductive tract diseases. This pathogen often causes co-infections with pathogens such as infectious bronchitis virus and Escherichia coli, and is also one of the main pathogens of chronic respiratory syndrome in chickens. Given its serious harm to the poultry industry, Mycoplasma synoviae has received increasing attention. However, our understanding of its virulence factors and pathogenic mechanisms remains very limited.

[0003] Adhesion to host cells is the primary step for pathogens to colonize and infect, and mycoplasma is no exception. This process typically involves multiple adhesion proteins or mechanisms, and even exhibits adhesin redundancy. The diversity of receptor targeting mechanisms is crucial for successful adhesion and subsequent pathogenicity; many bacteria can also achieve immune evasion through phase transition mutations in surface proteins. Through continuous research, various mycoplasma synoviae adhesins have been identified, such as EF-G, ENO, PdhD, and E2, which have clearly defined host binding targets, as well as adhesion factors with unclear host target proteins, such as the VlhA family variable lipoprotein hemagglutinin and LP78 lipoprotein. However, none of the existing adhesins can completely block the adhesion of mycoplasma synoviae to host cells, suggesting that this process may be the result of the synergistic action of multiple adhesins.

[0004] The binding targets of pathogenic adhesins are mostly key components on the surface of host cells, including fibronectin, plasminogen, collagen, elastin, laminin, and heparin (Li et al., Vet Microbiol 265:109310, 2022). Currently, three classes of adhesin-binding components have been identified in Mycoplasma synoviae: plasminogen (Plg), vimentin, and fibronectin (FN) (Xu et al., Vet Microbiol 298:110275, 2024). Among them, FN is a glycoprotein mainly located in the extracellular matrix (ECM) and can bind to integrin receptors on the cell membrane, regulating cell adhesion, migration, and proliferation. Summary of the Invention

[0005] The purpose of this invention is to provide an avian mycoplasma synoviae adhesion protein MAG1430, the amino acid sequence of which is shown in SEQ ID NO.2.

[0006] Another object of the present invention is to provide the application of the mycoplasma synoviae adhesion protein MAG1430.

[0007] To achieve the above objectives, the present invention adopts the following technical measures:

[0008] This invention identifies a novel avian mycoplasma synoviae adhesion protein, MAG1430, using biological and immunological methods. This protein promotes the binding of the pathogen to host cells. Further research indicates that its adhesion function is achieved through binding to fungi (FN). This protein provides a potential molecular target for the development of novel vaccines, diagnostic reagents, and therapeutic agents.

[0009] The scope of protection of this invention includes:

[0010] The use of the protein shown in SEQ ID NO.2 or the fusion protein obtained by fusing the protein shown in SEQ ID NO.2 with a protein purification tag in the preparation of drugs for the treatment or prevention of diseases caused by Mycoplasma synoviae.

[0011] Application of the protein shown in SEQ ID NO.2 or the fusion protein obtained by fusing the protein shown in SEQ ID NO.2 with a protein purification tag in the preparation of avian mycoplasma synoviae vaccine.

[0012] Application of antibodies against the protein shown in SEQ ID NO.2 or the fusion protein obtained by fusing the protein shown in SEQ ID NO.2 with a protein purification tag in the preparation of avian synoviocyte mycoplasma detection reagent.

[0013] The application of antibodies against the protein shown in SEQ ID NO.2 or the fusion protein obtained by fusing the protein shown in SEQ ID NO.2 with a protein purification tag in the preparation of drugs for preventing avian mycoplasma synoviae infection.

[0014] A vaccine against Mycoplasma synoviae, the vaccine containing Mycoplasma synoviae adhesion protein MAG1430 and an adjuvant, wherein the Mycoplasma synoviae adhesion protein MAG1430 is shown in SEQ ID NO.2, or is a fusion protein obtained by fusing the protein shown in SEQ ID NO.2 with a protein purification tag.

[0015] The application described above uses a gene that encodes the protein shown in SEQ ID NO.2, which is shown in SEQ ID NO.1.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0017] 1. The MAG1430 protein in this invention is encoded by the Mycoplasma synoviae gene VY93_RS03535, confirming its good immunogenicity and reactivity, and can be used for the detection of Mycoplasma synoviae antibodies. Furthermore, by preparing polyclonal or monoclonal antibodies against the MAG1430 protein, it can also be used to detect Mycoplasma synoviae antigens.

[0018] 2. The MAG1430 protein can bind to chicken embryo fibroblasts (DF-1) and primary synovial cells (SSCs), suggesting that it may play an important role in the colonization of pathogens in different host cells.

[0019] 3. Experiments have shown that naturally infected chicken serum can significantly block the binding of MAG1430 protein to FN, indicating that this protein has the potential to be used as a subunit vaccine component.

[0020] 4. The MAG1430 protein of the present invention can be directly used as a subunit vaccine to immunize chickens, and its protective effect is better than that of inactivated vaccines, which confirms that the MAG1430 subunit vaccine has a significant protective effect against clinical MS infection. Attached Figure Description

[0021] Figure 1 For the expression, purification and identification of MAG1430 protein;

[0022] Wherein: A: MAG1430 protein expression was identified by SDS-PAGE; B: purified MAG1430 protein expression was identified by Western blot. The star icon indicates the location of the MAG1430 protein, and M is the protein molecular weight standard, the same below.

[0023] Figure 2 A schematic diagram illustrating the identification of the immunogenicity of MAG1430 protein;

[0024] Wherein: A: Schematic diagram of the reaction between MAG1430 protein and avian synovipositor positive serum; B: Schematic diagram of the no reaction between MAG1430 protein and chicken negative serum.

[0025] Figure 3 Subcellular localization of MAG1430 protein;

[0026] Wherein: A: Subcellular localization of MAG1430 protein, W for whole protein, C for cytoplasmic protein, and M for membrane protein; B: Schematic diagram of the reaction between Mycoplasma synoviae and mouse anti-MAG1430 polyclonal antibody; C: Schematic diagram of the reaction between Mycoplasma synoviae and mouse negative serum. The star icon indicates the location of the MAG1430 protein.

[0027] Figure 4 This is a schematic diagram illustrating the ability of MAG1430 protein to adhere to DF-1.

[0028] Figure 5 This is a schematic diagram illustrating the ability of MAG1430 protein to adhere to SSCs.

[0029] Figure 6 This is a schematic diagram illustrating the identification of the interaction between MAG1430 protein at different concentrations and DF-1 surface protein.

[0030] Figure 7 This diagram illustrates the identification of the interaction between MAG1430 protein at different concentrations and surface proteins of SSCs.

[0031] Figure 8 The effects of avian mycoplasma synoviae positive and negative sera on the interaction between MAG1430 protein and DF-1 cell surface protein.

[0032] Figure 9 The effect of avian mycoplasma synoviae positive and negative sera on the interaction between MAG1430 protein and SSC surface proteins.

[0033] Figure 10 To analyze the direct interaction between different concentrations of MAG1430 protein and FN using Far-Western blot analysis;

[0034] The star icon indicates the location of the MAG1430 protein. In the figure, 2.5 μg and 1.25 μg refer to different concentrations of MAG1430 protein.

[0035] Figure 11 To analyze the interaction between different concentrations of MAG1430 protein and FN using ELISA.

[0036] Figure 12 To analyze the effect of naturally infected chicken serum and mouse serum containing anti-MAG1430 protein on the binding reaction of different concentrations of MAG1430 protein with FN by Western blot;

[0037] In the figure, 0.5 μg and 0.25 μg refer to different concentrations of MAG1430 protein.

[0038] Figure 13 To analyze the effects of mouse anti-MAG1430 protein serum and negative serum on the adhesion of Mycoplasma synoviae to host cells in an adhesion inhibition assay.

[0039] Figure 14 This is a schematic diagram of the subunit vaccine immunization procedure of the present invention.

[0040] Figure 15 To determine the level of specific antibody production in chick serum.

[0041] Figure 16 Images showing the clinical symptoms after challenge with the subunit vaccine of this invention. Detailed Implementation

[0042] The present invention will be further described below with reference to embodiments. It should be noted that the described embodiments are only for the purpose of helping to understand the present invention and do not constitute a limitation on the scope of protection of the present invention. Furthermore, the technical features involved in the following embodiments can be combined if they do not conflict with each other.

[0043] Unless otherwise stated, the experimental methods used in the following examples are conventional methods in the art, and the experimental materials and reagents involved can be obtained through commercial channels.

[0044] Some of the basic operations of this invention are as follows:

[0045] The strain of Mycoplasma synoviae was cultured in mycoplasma broth (formula: 12 g PPLO broth powder, 2.5 g yeast extract, 2.5 g tryptone, 5 g glucose, and ultrapure water to a final volume of 400 mL, sterilized at 115℃ for 20 min; after cooling, 50 mL porcine serum, 1.5 mL 1% phenol red solution, and 4 mL 1% NAD solution were added sequentially) until the logarithmic growth phase.

[0046] Escherichia coli strains DH5α and BL21(DE3) carrying the pET_28c(+) expression vector were cultured in LB liquid medium at 37°C. Transformants were screened on LB agar plates containing 50 μg / mL kanamycin.

[0047] Chicken embryo fibroblasts (DF-1) and primary synovial cells (SSCs) were cultured in DMEM medium containing 10% inactivated fetal bovine serum (with an additional 100 U / mL penicillin and 0.1 mg / mL streptomycin).

[0048] Example 1:

[0049] VY93_RS03535 gene cloning and protein expression

[0050] Genomic DNA was extracted from Mycoplasma synoviae in avian synoviae using a cell genomic DNA extraction kit. Primers were designed targeting the VY93_RS03535 gene (nucleotide sequence shown in SEQ ID NO.1, amino acid sequence shown in SEQ ID NO.2) of strain WVU1853 (GenBank: NZ_CP011096.1): CTTTAAGAAGGAGATATACCATG GTAAATAGAATTTATTATCAAGAA CAAAATA (SEQ ID NO.3) and AGTGGTGGTGGTGGTGGTGGTG GTTTTGTTGTGGTTCTGAGGC(SEQ ID NO. 4) The amplified product was cloned into the pET_28c(+) vector, transformed into E. coli DH5α, and protein expression was induced by IPTG. The expression product was purified by Ni column chromatography, the protein concentration was determined by BCA method, and SDS-PAGE and Western blot analysis were performed to obtain purified MAG1430 protein, which contains the amino acid sequence shown in SEQ ID NO. 2.

[0051] SDS-PAGE results showed that the recombinant MAG1430 protein encoded by the VY93_RS03535 gene exhibited a clear band in the 35-40 kDa range, and the target protein was mainly present in a soluble form, with only a small amount present in the precipitate. High-purity target protein was obtained after purification, indicating that the protein could be efficiently expressed and purified in a soluble manner under the above conditions. Figure 1 (A). Western blot identification was performed using an anti-His-tagged monoclonal antibody, and clear monoclonal antibodies were visible at 35-40 kDa. Figure 1 (B)

[0052] Example 2:

[0053] MAG1430 protein antigenicity identification

[0054] To identify the immunogenicity of MAG1430 protein, Western blot analysis was performed using positive serum from chickens infected with Mycoplasma synoviae. The purified protein was separated by SDS-PAGE and transferred to a PVDF membrane, blocked overnight with 5% skim milk. It was then incubated successively with positive serum from Mycoplasma synoviae (1:2000) and HRP-labeled rabbit anti-chicken IgG (1:3000), followed by ECL colorimetric assay.

[0055] The results showed that avian synoviae-positive serum could specifically react with MAG1430 protein. Figure 2 (A) serum, while negative serum showed no reaction ( Figure 2 The result (B) indicates that chickens infected with Mycoplasma synoviae can produce antibodies against this protein, suggesting that the MAG1430 protein is one of the antigenic components of Mycoplasma synoviae.

[0056] Example 3:

[0057] Subcellular localization of MAG1430 protein

[0058] Subcellular localization of proteins was studied according to methods reported in the literature. Mycoplasma cultures in logarithmic growth phase were centrifuged at 12,000 g for 15 min to collect the precipitate, which was then washed three times with PBS. Total protein was obtained by sonication. Membrane and cytoplasmic proteins were obtained using the ProteoExtract® Transmembrane Protein Extraction Kit (Millipore), following the manufacturer's instructions. Total protein, membrane proteins, and cytoplasmic proteins were separated by 12% SDS-PAGE and transferred to an intracellular (NC) membrane. The membrane was blocked overnight with 5% skim milk, and then incubated for 2 hours with mouse anti-MAG1430 polyclonal antibody (1:2000). It was then co-incubated with HRP-labeled goat anti-mouse IgG (H+L) antibody (1:3000). Finally, the membrane was developed using an ECL kit.

[0059] Western blot results showed that MAG1430 protein was detected in total protein and membrane protein, but not in cytoplasm, suggesting that it is distributed on the cell membrane surface of Mycoplasma synoviae. Figure 3 (A)

[0060] Immunofluorescence analysis was used. Intact bacterial cells were successively incubated with mouse anti-MAG1430 serum and FITC-labeled goat anti-mouse IgG, and observed under a fluorescence microscope. Results showed that clear green fluorescence was observed in the anti-MAG1430 serum group (…). Figure 3 (B), while the pre-immune serum group showed no fluorescent signal (B). Figure 3 (C) confirmed that the MAG1430 protein is located on the surface of Mycoplasma synoviae.

[0061] Example 4:

[0062] Identification of MAG1430 protein adhesion to DF-1 and SSCs cells

[0063] Immunofluorescence assay was used to detect the direct adhesion of MAG1430 protein to host cells.

[0064] DF-1 or SSCs cells were fixed and blocked, then incubated with 100 μg / mL MAG1430 protein. A PBS group without the protein and a pre-immunization serum group were set as controls. The binding protein was detected sequentially using mouse anti-MAG1430 polyclonal antibody and FITC-labeled goat anti-mouse IgG. Cell nuclei and cell membranes were stained with DAPI and Did, respectively, and observed under a confocal microscope.

[0065] Preparation of polyclonal antibody against MAG1430 in mice:

[0066] Polyclonal antibodies against MAG1430 protein were prepared using BALB / c mice. For the initial immunization, 100 μg of recombinant MAG1430 protein was emulsified with Freund's complete adjuvant. A booster immunization was performed 14 days later using 100 μg of recombinant MAG1430 protein emulsified with Freund's incomplete adjuvant. Subsequently, blood samples were collected every 14 days to monitor antibody titers, and booster immunizations were administered as needed until the serum antibody titer reached 1:5000 or higher. Serum was collected, aliquoted, and stored at -20°C.

[0067] The results showed that DF-1 ( ) incubated with MAG1430 protein Figure 4 ) and SSCs ( Figure 5 The cells in both groups showed obvious green fluorescence, while the control group did not, indicating that the MAG1430 protein can adhere to both types of cells.

[0068] Example 5:

[0069] Analysis of the binding of MAG1430 protein to host cell membrane components

[0070] Membrane proteins were extracted from DF-1 and SSCs cells, and their concentrations were determined using the BCA method. To further verify the adhesion characteristics of the recombinant proteins to host cells, membrane proteins were extracted from DF-1 and SSCs cells using a membrane protein extraction kit, and the concentrations of the extracted membrane proteins were determined using a BCA protein quantification kit.

[0071] The membrane protein (10 μg / mL) was coated onto an ELISA plate and incubated overnight at 4°C. After blocking with 5% skim milk, the plate was incubated with different concentrations (10–0.15625 μg / mL) of MAG1430 protein for 2 h. Mouse anti-MAG1430 polyclonal antibody (1:5000) and HRP-labeled goat anti-mouse IgG (1:4000) were added sequentially, and TMB was developed for 10 min. OD was then measured. 450 nm. The experiment was repeated three times independently.

[0072] The results are as follows Figure 6 (DF-1) and Figure 7 As shown in the SSCs, the binding of MAG1430 protein tends to saturate at 1.25 μg / mL and approaches the background value below 0.15625 μg / mL, indicating that its binding to the two cell membrane components is dose-dependent.

[0073] Example 6:

[0074] Inhibitory effect of Mycoplasma synoviae positive serum on the binding of MAG1430 protein to membrane protein

[0075] The inhibitory effect of avian Mycoplasma synoviae positive serum on the binding of MAG1430 protein to membrane proteins was evaluated using ELISA. After coating DF-1 or SSCs membrane proteins, 50-fold diluted avian Mycoplasma synoviae positive serum was pre-incubated with 1.25 μg / mL MAG1430 protein for 1 h, followed by incubation in ELISA plates for 2 h. Negative serum served as a control. After washing three times with PBST, mouse anti-His antibody (1:2000) and HRP-labeled goat anti-mouse IgG (1:4000) were added sequentially. OD was measured after TMB color development for 10 min. 450 The absorbance was measured in nm. Results were analyzed using an unpaired t-test with GraphPad Prism software. The experiment was independently repeated three times.

[0076] Compared with negative serum, positive serum significantly inhibited the interaction of MAG1430 protein and DF-1 (…). Figure 8 ) and SSCs ( Figure 9 () Binding of membrane proteins.

[0077] Example 7:

[0078] Assay of MAG1430 protein binding to FN

[0079] Far-Western blot analysis: 2.5 μg and 1.25 μg of MAG1430 protein were transferred to membranes, respectively, and then incubated sequentially with biotinylated fibronectin (FN) and HRP-labeled goat anti-biotin antibody, followed by ECL staining. Results are shown below. Figure 10 As shown, a clear band is visible at the expected location, suggesting that the MAG1430 protein can bind to FN.

[0080] ELISA analysis: MAG1430 protein (5 μg / mL) was coated onto an ELISA plate and incubated overnight at 4°C. After blocking, the protein was compared with serial concentrations (1.5 × 10⁻⁶). 2 , 1.5×10 1 , 1.5×10 0 , 1.5×10 -1 , 1.5×10 -2 , 1.5×10 -3 , 1.5×10 -4 Incubate with biotinylated FN (μg / mL) for 1.5 h. Then add HRP-labeled anti-biotin antibody.

[0081] TMB was developed for 10 min, and OD was measured. 450 nm, indicating that the combination of the two is dose-dependent ( Figure 11 ).

[0082] Example 8:

[0083] Inhibitory effects of different serum levels on MAG1430 protein binding to FN

[0084] Western blot analysis of the inhibitory effect of different serums on the binding of MAG1430 protein to FN:

[0085] After transferring 0.5 μg and 0.25 μg of MAG1430 protein to a membrane, respectively, the membrane was incubated with avian mycoplasma synoviae positive and chicken negative serum (1:100) for 2 h, and then reacted with biotinylated FN (50 μg / mL) and HRP-labeled antibiotin antibody, and ECL color development was performed.

[0086] The results showed that positive serum could almost completely block the binding of MAG1430 protein to FN. Figure 12 ).

[0087] The inhibitory effect of mouse anti-MAG1430 immune serum was detected using the same method, with pre-immunization serum serving as a control. Results showed that this immune serum also exhibited inhibitory activity, but it was weaker than naturally infected positive serum. Figure 12 ).

[0088] Example 9:

[0089] Adhesion inhibition test of Mycoplasma synoviae in avian synovial membrane

[0090] DF-1 cells were seeded in 12-well plates (2 × 10⁻⁶ cells per well). 5 / well), growing to a monolayer. Avian Mycoplasma synoviae were pre-incubated for 1 h with a 20-fold dilution of mouse anti-MAG1430 serum (or mouse negative serum) prepared in Example 4, followed by cell infection. Cells were collected after 5 washes with PBST and colony counting was performed on modified Frey agar plates. Data were analyzed using unpaired t-tests with GraphPad Prism software, and the experiments were independently repeated three times.

[0091] The results showed that the number of bacterial colonies in the anti-MAG1430 serum treatment group was significantly reduced compared with the pre-immunization serum. Figure 13 This indicates that the antibody can partially inhibit the adhesion of Mycoplasma synoviae to host cells.

[0092] Example 10:

[0093] Application of MAG1430 protein in the preparation of avian mycoplasma synoviae vaccine

[0094] 1) Animal immunization

[0095] One-day-old chicks were randomly divided into four groups (10 chicks per group): a MAG1430 subunit vaccine immunization group, an inactivated vaccine immunization control group, an adjuvant immunization control group, and a PBS control group. The subunit vaccine was prepared by uniformly mixing purified MAG1430 protein solution with an equal volume of adjuvant ISA 78VG. The immunization schedule was as follows: Figure 14 As shown, the specific immunization ages were 7 days and 14 days, the immunization method was intramuscular injection in the leg, the immunization dose of the subunit vaccine was 100μg MAG1430 protein / animal, and the inactivated vaccine immunization control group was immunized according to the instructions.

[0096] 2) Collection of polyclonal antibodies

[0097] Vulvar blood was collected every week after immunization, serum was separated and stored at -20℃.

[0098] 3) Antibody titer determination

[0099] The level of polyclonal antibodies produced in chicks stimulated by the MAG1430 subunit vaccine was evaluated using ELISA. The detection method was the same as shown in Example 7. HRP-labeled enzyme-labeled secondary antibody, goat anti-chicken IgY, was used.

[0100] The results showed that the antibody titer gradually increased from 7 to 28 days after immunization, reaching 1:51200 two weeks after the second immunization. Figure 15 ).

[0101] 4) Evaluation of the protective effect of MAG1430 subunit vaccine against viral challenge

[0102] Fourteen days after the second immunization, the experimental group received intratracheal and footpad injections of approximately 2 × 10⁻⁶ live bacteria. 8 Mycoplasma synoviae in avian synoviae were observed for 14 days and their clinical manifestations were recorded. The clinical symptoms and incidence after challenge are as follows: Figure 16 As shown in the table below, the MAG1430 subunit vaccine group and the commercially available inactivated vaccine group showed significantly reduced symptoms compared to the challenge group. The adjuvant-immunized control group had a morbidity rate of 100% in the first week after challenge, and experienced severe footpad redness and swelling during the observation period. No clinical symptoms were observed in the PBS control group. The evaluation of the protective effect against challenge showed that, compared to the adjuvant-immunized control group, the vaccine group showed significantly reduced clinical symptoms, and the MAG1430 subunit vaccine group showed better protection than the inactivated vaccine in the second week after challenge, confirming that the MAG1430 subunit vaccine has a significant protective effect against clinical MS infection.

[0103] .

[0104] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. The application of the protein shown in SEQ ID NO.2 or the fusion protein obtained by fusing the protein shown in SEQ ID NO.2 with a protein purification tag in the preparation of avian mycoplasma synoviae vaccine.

2. The application of a polyclonal antibody against the mycoplasma synoviae adhesion protein MAG1430 in the preparation of a drug for preventing mycoplasma synoviae infection in birds, wherein MAG1430 is the protein shown in SEQ ID NO.2 or a fusion protein obtained by fusing the protein shown in SEQ ID NO.2 with a protein purification tag, and the polyclonal antibody is obtained by immunization with MAG1430 as an antigen.

3. A Mycoplasma synoviae vaccine, the vaccine containing Mycoplasma synoviae adhesion protein MAG1430 and an adjuvant, wherein the Mycoplasma synoviae adhesion protein MAG1430 is shown in SEQ ID NO.2, or is a fusion protein obtained by fusing the protein shown in SEQ ID NO.2 with a protein purification tag.

4. The application according to any one of claims 1-2, characterized in that: One of the genes encoding the protein shown in SEQ ID NO.2 is shown in SEQ ID NO.

1.

5. The vaccine according to claim 3, characterized in that: One of the genes encoding the protein shown in SEQ ID NO.2 is shown in SEQ ID NO.1.

Images