Hvmyb68 protein and its application in improving yield and grain quality of barley

Abstract

HvMYB68 protein and application thereof in improving yield and grain quality of barley. The present application relates to the technical field of genetic engineering, and provides HvMYB68 protein and application thereof in improving yield and grain quality of barley, wherein the HvMYB68 protein comprises any one of the following amino acid sequences: (1) an amino acid sequence as shown in SEQ ID NO: 6; (2) an amino acid sequence of a protein with the same function obtained by substitution, insertion or deletion of one or more amino acids from the amino acid sequence as shown in SEQ ID NO: 6. The present application clones and identifies a transcription factor HvMYB68 from highland barley, and the heterologous expression of the transcription factor HvMYB68 in barley can simultaneously improve yield traits and quality traits, not only increases the total starch content of grains, but also makes the grains fuller, realizes vigorous growth of plants and greatly improves yield, and the present application provides a practical and usable excellent gene resource for high-yield and high-quality molecular breeding of barley, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the HvMYB68 protein and its application in improving barley yield and grain quality. Background Technology

[0002] Starch constitutes a significant portion of the dry weight of barley grains, and its synthesis and accumulation directly impact yield and grain quality. Starch biosynthesis is catalyzed by a series of key enzymes, including ADP-glucose pyrophosphorylase, granule-bound starch synthase, soluble starch synthase, starch branching enzyme, and starch debranching enzyme, and is finely regulated by transcription factors. Significant progress has been made in barley gene editing breeding; those skilled in the art have successfully created new germplasm that are lodging-resistant, high-sugar, and low-starch using genetic engineering technologies such as CRISPR / Cas9.

[0003] As a variety of barley, the yield and starch content of barley grains are key factors determining its economic and nutritional value. However, current research on functional genes in barley mainly focuses on stress resistance traits, while genes regulating yield and starch content have been less developed. Furthermore, there are few reports on directly discovering new genes regulating yield and starch content from barley and then exploring their functions in barley. Summary of the Invention

[0004] To address the aforementioned problems in the prior art, this invention provides HvMYB68 protein and its application in improving barley yield and grain quality.

[0005] In a first aspect, the present invention provides an HvMYB68 protein comprising any one of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO:6; (2) an amino acid sequence of a protein having the same function obtained by replacing, inserting or deleting one or more amino acids from the amino acid sequence shown in SEQ ID NO:6.

[0006] Secondly, the present invention provides a nucleic acid molecule encoding the HvMYB68 protein.

[0007] According to the present invention, a nucleic acid molecule preferably includes any one of the following nucleotide sequences: (1) a nucleotide sequence as shown in SEQ ID NO:3; (2) a completely complementary sequence of a nucleotide sequence as shown in (1); (3) a nucleotide sequence of a nucleotide sequence as shown in (1) obtained by substituting, deleting or inserting one or more nucleotides to encode a protein having the same function.

[0008] Thirdly, the present invention provides a biomaterial comprising the aforementioned nucleic acid molecule; the biomaterial is recombinant DNA, expression cassette, transposon, vector, cell, or microorganism.

[0009] Fourthly, the present invention provides the application of the HvMYB68 protein, or the nucleic acid molecule, or the biological material in any of the following: (1) promoting barley growth; (2) increasing barley yield; (3) improving barley grain quality.

[0010] In accordance with the application of the HvMYB68 protein, the nucleic acid molecule, or the biological material provided by the present invention, preferably, the yield includes thousand-grain weight, plot yield, and / or single-plant yield.

[0011] According to the application of the HvMYB68 protein, the nucleic acid molecule, or the biomaterial provided by the present invention, preferably, improving the quality of barley grains includes: increasing the total starch content of the grains, increasing the length of the grains, and increasing the width of the grains, or any one or more of these.

[0012] Fifthly, the present invention provides the application of the HvMYB68 protein, the nucleic acid molecule, or the biological material in the improvement of barley varieties or germplasm resources.

[0013] In a sixth aspect, the present invention provides a method for promoting barley growth, increasing barley yield, and / or improving barley grain quality, comprising: promoting the expression or activity of HvMYB68 protein in target barley, and / or increasing the expression level of the HvMYB68 gene in target barley; wherein the HvMYB68 protein comprises any one of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO:6; (2) the amino acid sequence of a protein having the same function obtained by substituting, inserting, or deleting one or more amino acids from the amino acid sequence shown in SEQ ID NO:6.

[0014] According to the present invention, a method for promoting barley growth, increasing barley yield and / or improving barley grain quality is provided. Preferably, the HvMYB68 gene includes any one of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO:3; (2) the completely complementary sequence of the nucleotide sequence shown in (1); (3) the nucleotide sequence of the nucleotide sequence shown in (1) obtained by substitution, deletion or insertion of one or more nucleotides, which can encode a protein with the same function.

[0015] According to the present invention, a method for promoting barley growth, increasing barley yield, and / or improving barley grain quality is provided, wherein the yield preferably includes thousand-grain weight, plot yield, and / or single-plant yield.

[0016] According to the present invention, a method for promoting barley growth, increasing barley yield, and / or improving barley grain quality is provided. Preferably, improving barley grain quality includes any one or more of the following: increasing the total starch content of the grain, increasing the length of the grain, and increasing the width of the grain.

[0017] More preferably, improving barley grain quality also includes any one or more of the following: reducing the proportion of amylose in the total starch, increasing the proportion of type B starch granules in the total starch granules, increasing the proportion of DP 6-12 short-chain starch and / or DP 13-24 long-chain starch in the amylopectin, and increasing the branching degree of the amylopectin in the grain.

[0018] The present invention has the following beneficial effects: This invention cloned and identified the transcription factor HvMYB68 from barley. Heterologous expression of HvMYB68 in barley can simultaneously improve yield and quality traits, not only increasing the total starch content of the grains but also making the grains fuller, resulting in vigorous plant growth and a significant increase in yield. This invention provides a practical and excellent gene resource for high-yield and high-quality molecular breeding of barley and has broad application prospects. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0020] Figure 1 This is provided in Embodiment 1 of the present invention. HvMYB68 Gene expression profiling analysis; A represents... HvMYB68 qRT-PCR results of gene expression levels in different tissues of highland barley; B represents barley-based gene expression. Morex The spatiotemporal transcriptome data of the variety's grains were obtained HvMYB68 Expressing heatmaps.

[0021] Figure 2 This is provided in Embodiment 1 of the present invention. HvMYB68 Subcellular localization of genes; A is a tobacco leaf, scale bar is 50 μm; B is a barley protoplast, scale bar is 10 μm.

[0022] Figure 3This is the identification of the transcriptional activation domain of the HvMYB68 protein provided in Example 1 of the present invention; A is the domain analysis result of the HvMYB68 protein, and the numbers represent the amino acid positions; B is a schematic diagram of the structure of each vector of the dual-luciferase reporter system; C is the experimental result of dual-luciferase; different lowercase letters indicate significant differences, p<0.05.

[0023] Figure 4 The barley provided in Embodiment 2 of the present invention HvMYB68 Expression identification results of overexpression lines and gene-edited lines; A represents 12 barley plants. HvMYB68 Overexpression lines HvMYB68 Gene expression levels; B is a schematic diagram of sgRNA design and three barley gene-edited lines. Hvmyb68 Gene sequence alignment results: ko-1 to ko-3 correspond to koHvmyb68-L1, koHvmyb68-L2 and koHvmyb68-L3 respectively.

[0024] Figure 5 The wild-type barley provided in Embodiment 3 of this invention, HvMYB68 Appearance of overexpression lines and gene-edited lines; A shows the overall growth of each plant; B shows the appearance of the grains of each plant.

[0025] Figure 6 The wild-type barley provided in Embodiment 3 of this invention, HvMYB68 Seed characteristics and yield traits of overexpression lines and gene-edited lines; A shows the statistical results of seed length for each plant; B shows the statistical results of seed width for each plant; C shows the statistical results of thousand-grain weight for each plant; D shows the statistical results of plot yield for each plant; different lowercase letters indicate significant differences, p<0.05.

[0026] Figure 7 The wild-type barley provided in Embodiment 3 of this invention, HvMYB68 Starch content and composition of overexpression lines and gene-edited lines; A shows the total starch content of seeds of each plant; B shows the proportion of amylose in seeds of each plant; different lowercase letters indicate significant differences, p<0.05.

[0027] Figure 8 The wild-type barley provided in Embodiment 3 of this invention, HvMYB68 Scanning electron microscopy (SEM) observations of starch granules in seeds of overexpression lines and gene-edited lines; A is a scanning electron microscope image of starch granules in seeds of each plant, scale bar: 10 μm; B is a volume distribution curve of starch granules in seeds of each plant.

[0028] Figure 9 The wild-type barley provided in Embodiment 3 of this invention, HvMYB68Fine starch structure of grains from overexpression lines and gene-edited lines; A shows the normalized distribution of amylopectin at different degrees of polymerization in grains of each plant; B shows... HvMYB68 Differences in amylopectin content in seeds of overexpression lines and gene-edited lines; C represents the branching degree of amylopectin in seeds of each plant; D represents the X-ray diffraction pattern of starch in seeds of each plant. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0030] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0031] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0032] The barley germplasm resources involved in the following examples were collected from barley plants grown in different ecological zones of the Qinghai-Tibet Plateau and are now preserved at Sichuan Agricultural University. The public can obtain this biological material from the applicant.

[0033] Example 1 HvMYB68 Gene expression profiling, subcellular localization, and identification of transcription activation domains 1. HvMYB68 Gene expression profiling analysis (1) qRT-PCR detection RNA was extracted from barley seedling root samples (SR), seedling stem samples (SN), seedling leaf samples (SL), heading stage root samples (HR), heading stage stem samples (HN), heading stage leaf samples (HL), and grain samples from barley at 4 days, 8 days, 16 days, 24 days, and 32 days post-pollination (32 DAP) to obtain cDNA, which was used as a template. qRT-PCR was performed using quantitative primers F (5'-CCCCAAGACCCATAACCTCCTC-3' (SEQ ID NO:1)) and R (5'-GGATGTACGGGTAGCCCTGC-3' (SEQ ID NO:2)).

[0034] The qRT-PCR reaction system consisted of: 1 μl cDNA; 1 μl Primer ScriptRT EnzymeMixI; 0.5 μl quantitative primer F (SEQ ID NO:1); 0.5 μl quantitative primer R (SEQ ID NO:2); and 7 μl ddH2O.

[0035] The qRT-PCR reaction program was as follows: 95℃ for 30 s; 95℃ for 10 s, 60℃ for 30 s, 95℃ for 15 s, for a total of 40 cycles; 60℃ for 60 s.

[0036] (2) Expression heat map drawing Using barley published at https: / / bar.utoronto.ca / eplant_barley / Morex Spatiotemporal transcriptome data of variety grains, based on HvMYB68 The genome sequence of the gene (SEQ ID NO:3) was obtained, and its expression levels in seed samples at 4 days post-pollination (4 DAP), 8 days post-pollination (8 DAP), 16 days post-pollination (16 DAP), 24 days post-pollination (24 DAP), and 32 days post-pollination (32 DAP) were analyzed to construct a gene expression level analysis. HvMYB68 Gene expression heatmap.

[0037] (3) Analysis results like Figure 1 As shown in A and B, HvMYB68 The gene is specifically highly expressed in the endosperm of barley and barley grains. 2. HvMYB68 Subcellular localization of genes (1) Construction of subcellular localization vector Using genomic DNA from barley grains as a template, PCR amplification was performed using the upstream primer (5'-ATGGGGCACCACTGCTGCAG-3' (SEQ ID NO:4)) and the downstream primer (5'-TTAGCAATCCCACTGGAGCTGCTC-3' (SEQ ID NO:5)). The amplification products were collected and sequenced. The amplification products with correct sequencing results were retained to obtain the desired product. HvMYB68 Gene fragment (SEQ ID NO:3).

[0038] (2) Agrobacterium-mediated transient expression system in tobacco Will HvMYB68 The gene fragment (SEQ ID NO:3) is inserted into the SpeI site of the pCAMBIA-1302 vector to obtain... HvMYB68The subcellular localization vector for the gene is denoted as pCAMBIA-HvMYB68.

[0039] The HvMYB68::GFP strain, verified by sequencing, was transformed into Agrobacterium GV3101 via electroporation. Positive clones were screened on LB plates containing Kan (50 μg / ml) and Rif (50 μg / ml), and the transformation efficiency was confirmed by PCR. The resulting Agrobacterium GV3101 strain was designated GV3101-HvMYB68.

[0040] The pCAMBIA-1302 vector was transformed into GV3101 Agrobacterium (denoted as GV3101-vector) using the same method, and the pBI221-mCherry-NLS vector for expressing nuclear localization signals was transformed into GV3101 Agrobacterium (denoted as GV3101-mCherry).

[0041] The selected positive clones were amplified and cultured in LB liquid medium to the logarithmic growth phase (OD600≈0.8). The cells were collected by centrifugation and then resuspended in tobacco conversion buffer (10 mM MgCl2, 10 mM MES pH5.7, 1 mMAS) to obtain the bacterial suspension of each Agrobacterium. The suspension was induced at room temperature for 2 hours.

[0042] Healthy tobacco plants aged 4–6 weeks were selected. The induced bacterial suspensions of GV3101-HvMYB68 and GV3101-mCherry were infiltrated into the 2nd–4th true leaves using the leaf disc injection method (this group was denoted as HvMYB68::GFP). Separately, bacterial suspensions of GV3101-vector and GV3101-mCherry were infiltrated into the 2nd–4th true leaves (this group was denoted as 35S::GFP). After 8 hours of dark incubation, the plants were transferred to a 25°C light incubator, and fluorescence detection was then performed.

[0043] (3) Barley protoplast transformation system Will HvMYB68 The gene fragment (SEQ ID NO:3) is inserted into the pJIT163-GFP vector (i.e., between the HindIII and BamHI sites), thus obtaining... HvMYB68 The subcellular localization vector for the gene is designated pJIT163-HvMYB68.

[0044] Barley seeds were sown in an artificial climate chamber (constant temperature of 20℃, light intensity of 1000 Lx, photoperiod of 14-16 h / d) and cultured for 7-14 days to obtain young plants for subsequent experiments.

[0045] Select tissue from the middle part of young leaves, cut it into 0.5-1 mm strips with a sterile blade, and pre-soak it in 0.6 M mannitol solution for 10 minutes.

[0046] The infiltrated middle part of the young leaf tissue was transferred to 50 ml of mixed enzyme solution (containing 1.5% cellulase R10, 0.3% dissociative enzyme R10 and 0.6 M mannitol), and after vacuum infiltration for 30 minutes, it was placed in a shaker at 10 rpm for 4-5 hours for enzymatic hydrolysis.

[0047] The enzymatic digest was filtered through a 75 μm filter membrane and diluted with W5 buffer to a final volume of 60 ml. The product was then centrifuged at 100 × g for 3 min (both ascending and descending rates were 3 × g / min) to collect the precipitate. The precipitate was placed in 10 ml of W5 buffer and incubated on ice for 30 min. The supernatant was then removed, and the protoplast concentration was adjusted to 1 × 10⁻⁶ using MMG buffer. 6 The cells / ml were used to obtain a protoplast suspension for later use.

[0048] Take 200 μl of protoplast suspension and gently mix with 10 μg pJIT163-HvMYB68 and 10 μg pBI221-mCherry-NLS (this group is denoted as HvMYB68::GFP). Separately, take 200 μl of protoplast suspension and gently mix with 10 μg pJIT163-GFP and 10 μg pBI221-mCherry-NLS (this group is denoted as 35S::GFP), and incubate at room temperature for 5 min. Add 250 μl of 40% PEG4000 (containing 0.2 M mannitol) and gently tumble to mix. Incubate in the dark for 30 min. Add 900 µl of W5 buffer, gently invert to mix at room temperature, centrifuge at 80 × g for 3 minutes (both ascending and descending speeds are 3 × g / min), and discard the supernatant.

[0049] Each protoplast was transferred into a six-well plate containing 1 ml of W5 buffer and incubated in the dark at 23°C for 16–18 hours before fluorescence detection.

[0050] (3) Location results Observe under a fluorescence microscope HvMYB68 Subcellular localization of genes, such as Figure 2 As shown in A and B, HvMYB68 The gene was located in the cell nucleus in both tobacco leaf and barley seed protoplasts.

[0051] 3. Identification of the transcriptional activation domain of the HvMYB68 protein (1) Domain analysis of HvMYB68 protein Based on the amino acid sequence of the HvMYB68 protein (SEQ ID NO:6), the composition of its domains was analyzed using the online website SMART: Main page.

[0052] like Figure 3As shown in A, the HvMYB68 protein contains two SANT domains and belongs to the R2R3 type MYB transcription factor.

[0053] (2) Dual-luciferase experiment This invention identifies based on the GAL4 / UAS dual-luciferase transcriptional activation verification system. HvMYB68 The structures of gene transcription activation domains, reporter vectors, and effector vectors are as follows: Figure 3 As shown in B, the specific information of the five effector vectors is as follows: Negative control: GAL4BD; Strong positive control: GAL4BD-VP16, which is to link the coding sequence of VP16 (SEQ ID NO:7) to GAL4BD; Full-length group: GAL4BD-HvMYB68, coming soon HvMYB68 The gene fragment (SEQ ID NO:3) is ligated to GAL4BD; Truncated group 1: GAL4BD-N / R1R2, which is to connect the coding sequence of the N-terminus (SEQ ID NO:8) and the coding sequence of the R2R3 domain (SEQ ID NO:9) of the HvMYB68 protein to GAL4BD in sequence; Truncation group 2: GAL4BD-C-Domain, which is to link the coding sequence of the C-terminal domain (SEQ ID NO:10) of the HvMYB68 protein to GAL4BD.

[0054] like Figure 3 As shown in C, the HvMYB68 protein has transcriptional activation activity and is a positive regulator. The core region of transcriptional activation activity is located at its C-terminus (191 aa to 313 aa).

[0055] Example 2 Barley HvMYB68 Creation of overexpression lines and gene-edited lines 1. Barley HvMYB68 Creation of overexpression lines (1) Construction of overexpression vector The method obtained according to Example 1 HvMYB68 The gene fragment (SEQ ID NO:3) was ligated between the EcoRI and SpeI sites of the pCAMBIA-1302 vector to obtain... HvMYB68 The gene overexpression vector is denoted as OEHvMYB68 vector.

[0056] (2) Agrobacterium transformation The OEHvMYB68 vector was transformed into the immature embryos of barley (Golden Promise variety) using Agrobacterium-mediated transformation, yielding T1 generation seeds. After cultivation to the T3 generation, plants stably inheriting the OEHvMYB68 vector were obtained, resulting in a total of 12 barley plants. HvMYB68 Overexpression lines are designated as OEL1 to OEL12.

[0057] (3) Expression identification of strains The qRT-PCR detection method in Example 1 was used to identify various barley species. HvMYB68 Overexpression lines HvMYB68 Gene expression was compared with wild-type barley (denoted as GP) as a control.

[0058] like Figure 4 As shown in Figure A, compared to wild-type barley, 12 barley plants HvMYB68 Overexpression lines HvMYB68 All genes were significantly upregulated, indicating that they have been successfully and stably overexpressed in these plants. HvMYB68 Genes. Preservation HvMYB68 The three strains with the highest gene expression levels (OEL1 to OEL3) are designated as OEHvMYB68-L1, OEHvMYB68-L2, and OEHvMYB68-L3, respectively.

[0059] 2. Creation of gene-edited barley lines (1) Construction of knockout vector because Hvmyb68 The gene sequences are identical in barley and highland barley, based on Hvmyb68 The genome sequence of the gene (SEQ ID NO:3) was used to design sgRNA (TCCTCGACGTCCACCGCATC (SEQ ID NO:11)), which was then inserted into the BsaI site of the pYLCRISPR / Cas9 vector to obtain... Hvmyb68 The gene knockout vector is denoted as koHvmyb68.

[0060] (2) Agrobacterium transformation The OEHvMYB68 vector was transformed into immature embryos of barley (Golden Promise variety) using Agrobacterium-mediated transformation, and T1 generation seeds were collected. Plants that stably inherited the koHvmyb68 vector were retained, thus obtaining barley gene-edited lines. Three lines were randomly selected from these lines and designated koHvmyb68-L1, koHvmyb68-L2, and koHvmyb68-L3, respectively.

[0061] (3) Expression identification of strains Genomic DNA was extracted from barley gene-edited lines and sequenced to analyze its composition. HvMYB68 The gene deletion was compared with wild-type barley (denoted as WT) as a control.

[0062] like Figure 4 As shown in Figure B, compared with wild-type barley, koHvmyb68-L1 and koHvmyb68-L2 both exhibit frameshift mutations, while koHvmyb68-L3 shows a large deletion. This indicates that the Hvmyb68 protein has been successfully inactivated in all three plants.

[0063] Example 3 HvMYB68 Effects of genes on barley traits 1. Test Methods Wild-type barley (i.e., GP and NE) and the T3 generation barley created in Example 2 were used. HvMYB68 Overexpression lines (OEHvMYB68-L1, OEHvMYB68-L2, and OEHvMYB68-L3) and barley gene-edited lines (koHvmyb68-L1, koHvmyb68-L2, and koHvmyb68-L3) were cultured to maturity. The growth of each plant and the appearance of the grains were observed. The length and width of the grains of each plant were measured, and the thousand-grain weight was calculated.

[0064] The plants were then planted in field plots and cultivated until maturity. The yield of each plant in its corresponding plot was then tallied.

[0065] The total starch content of the seeds from each plant was determined using the Megazyme Total Starch Assay Kit, with three replicates for each sample. The specific procedures are as follows: Grind the seeds until all pass through a 0.5 mm sieve and dry to constant weight. Weigh approximately 100 mg of the ground sample and add it to a test tube, ensuring the entire sample is at the bottom. Add 0.2 mL of ethanol solution (80% v / v), vortex to mix, and immediately add 3 mL of heat-resistant α-amylase (diluted with 100 mM sodium acetate). Incubate in a boiling water bath for 6 minutes, shaking the test tube every 2 minutes to ensure complete mixing of the slurry. Place the test tube in a 50°C water bath, add 0.1 mL of amylase, mix thoroughly, and incubate at 50°C for 30 minutes. After incubation, transfer the entire solution to a 100 mL volumetric flask. Rinse the test tube with a wash bottle and pour the rinse water into the volumetric flask. Dilute to 100 mL with distilled water and mix thoroughly. Centrifuge 1 mL of the mixture at 3,000 g for 10 minutes. Take 0.1 ml of supernatant into a new test tube, add 3 ml of GOPOD solution and mix well to obtain the total starch sample solution; mix 0.1 ml of glucose standard solution (1 mg / mL) and 3 ml of GOPOD solution to obtain the glucose control; mix 0.1 ml of distilled water and 3 ml of GOPOD to obtain the total starch blank control; incubate the sample solution, glucose control and blank control at 50℃ for 20 min, and then measure the absorbance at 510 nm.

[0066] The total starch content (Starch, %) of the sample was calculated using the following formula (1): Formula (1): Starch= A×F / W×FV×0.9×100%; Where ΔA is the difference in absorbance between the total starch sample solution and the total starch blank control; F is the absorbance of the 100 / glucose control; W is the weight of the ground sample; and FV is the total volume of the mixed solution, 100 ml.

[0067] The amylose and amylopectin contents of the seeds of each plant were determined using the Megazyme amylose assay kit, with three replicates for each sample. The specific procedures are as follows: Grind the seeds into flour. Accurately weigh 20-25 mg of flour sample into a 10 ml sample tube. Add 1 ml of dimethyl sulfoxide (DMSO) to the tube. Mix slowly in a vortex mixer, then heat in a boiling water bath for about 1 minute until dispersed, ensuring the starch does not clump. Seal the tube and mix at high speed. Continue heating in a boiling water bath for 15 minutes, then mix intermittently at high speed. After standing at room temperature for about 5 minutes, add 2 ml of 95% ethanol, mix well, then add another 4 ml of ethanol, invert and mix to form a starch precipitate. Let the tube stand overnight. Centrifuge the pretreated sample tube at 2000×g for 5 minutes, discard the supernatant, invert on a paper towel for 10 minutes to ensure all ethanol evaporates, and collect the precipitate.

[0068] Add 2 ml of DMSO to the starch precipitate, and heat the test tube in a boiling water bath for 15 minutes, stirring occasionally to ensure no lumps form. Remove the test tube from the boiling water bath and immediately add 4 ml of ConA solution. Transfer the solution to a 25 ml volumetric flask. Dilute to 25 ml with ConA solution. This diluted solution is designated as Solution A.

[0069] Transfer 1 ml of solution A to a 2 ml test tube, add 0.5 ml of ConA solution containing solution I from kit I, cap the tube, and mix thoroughly by inverting repeatedly. Incubate at room temperature for 1 hour, then centrifuge at 14000×g for 10 minutes. Transfer 1 ml of the supernatant to a 15 ml centrifuge tube, add 3 ml of sodium acetate buffer (100 mM, pH 4.5), and mix. Place the centrifuge tube in a boiling water bath for 5 minutes to denature the ConA. Equilibrate the tube in a 40°C water bath for 5 minutes, add 0.1 ml of a mixture of starch-transferase and α-amylase, incubate at 40°C for 30 minutes, and then centrifuge at 2000×g for 5 minutes. Take 1 ml of the supernatant, add 4 ml of GOPOD reagent, and mix well to obtain the amylose sample solution.

[0070] A blank control of amylose was obtained by mixing 1 ml of sodium acetate buffer (100 mM, pH 4.5) and 4 ml of GOPOD reagent.

[0071] The D-Glucose control was prepared by mixing 0.1 ml of D-Glucose standard solution, 0.9 ml of sodium acetate buffer (100 mM, pH 4.5), and 4 ml of GOPOD reagent.

[0072] Mix 0.5 ml of solution A and 4 ml of sodium acetate solution (100 mM, pH 4.5), then add 0.1 ml of a mixture of starch-transferase and α-amylase, and react at 40 °C for 10 min. Accurately measure 1 ml of the supernatant, add 4 ml of GOPOD reagent, and mix well to obtain the total starch sample.

[0073] Amylose sample solution, amylose blank control, D-Glucose control and total starch sample were reacted simultaneously at 40℃ for 20 min, and then the absorbance was measured at 510 nm.

[0074] Calculate the amylose content (%) of the sample using the following formula (2): Formula (2): Amylose = Absorbance of amylose sample solution / Absorbance of total starch sample × 66.8 × 100%.

[0075] Given that changes in starch content and composition are often accompanied by changes in starch structure, we further observed the morphology of starch granules in the seeds of each plant and counted the number of starch granules using scanning electron microscopy, analyzed the distribution of amylopectin chain length in the seeds of each plant using ion chromatography, and analyzed the starch crystal structure in the seeds of each plant using X-ray diffraction (XRD).

[0076] 2. Test Results (1) Appearance like Figure 5 As shown in A and B, compared with wild-type barley, OEHvMYB68-L1, OEHvMYB68-L2, and OEHvMYB68-L3 showed significantly more vigorous growth and fuller grains, while koHvmyb68-L1, koHvmyb68-L2, and koHvmyb68-L3 showed weaker overall growth and shriveled grains.

[0077] (2) Grain characteristics like Figure 6 As shown in A and B, compared with wild-type barley, OEHvMYB68-L1, OEHvMYB68-L2, and OEHvMYB68-L3 all showed significantly increased grain length and width, while koHvmyb68-L1, koHvmyb68-L2, and koHvmyb68-L3 all showed significantly decreased grain length and width.

[0078] (3) Yield traits like Figure 6 As shown in C, compared with the thousand-grain weight of wild barley (35.48±0.24g), the thousand-grain weight of OEHvMYB68-L1, OEHvMYB68-L2, and OEHvMYB68-L3 (41.77±0.23g) increased significantly, with an increase of 17.76%, while the thousand-grain weight of koHvmyb68-L1, koHvmyb68-L2, and koHvmyb68-L3 (27.17±0.43g) decreased significantly, with a decrease of 23.42%.

[0079] like Figure 6 As shown in D, compared with the wild-type barley plots, the plot yields of OEHvMYB68-L1, OEHvMYB68-L2, and OEHvMYB68-L3 were significantly increased by 2.5%, while the plot yields of koHvmyb68-L1, koHvmyb68-L2, and koHvmyb68-L3 were significantly decreased by 1.9%.

[0080] (4) Starch content and composition like Figure 7As shown in A and B, compared with the yield of wild-type barley, the total starch content of OEHvMYB68-L1, OEHvMYB68-L2, and OEHvMYB68-L3 was significantly increased by 4.01%–6.07%, while the proportion of amylose was significantly decreased by 3.65%–4.02%. Conversely, the total starch content of koHvmyb68-L1, koHvmyb68-L2, and koHvmyb68-L3 was significantly decreased by 6.85%–8.70%, while the proportion of amylose was significantly increased by 4.29%–5.17%.

[0081] (5) Starch fine structure like Figure 8 As shown in A and B, compared with the yield of wild-type barley, the proportion of type B starch granules in the starch of OEHvMYB68-L1, OEHvMYB68-L2, and OEHvMYB68-L3 grains increased significantly by 15.67%; while the proportion of type B starch granules in koHvmyb68-L1, koHvmyb68-L2, and koHvmyb68-L3 decreased significantly by 25.55%.

[0082] like Figure 9 As shown in A to C, compared with the yield of wild-type barley, the proportion of short-chain starch and medium- and long-chain starch in grains with DP 6 to 12 of OEHvMYB68-L1, OEHvMYB68-L2, and OEHvMYB68-L3 increased, while the proportion of long-chain starch with DP ≥ 25 decreased, and the branching degree of amylopectin was significantly increased. In contrast, the amylopectin chain length distribution in grains of koHvmyb68-L1, koHvmyb68-L2, and koHvmyb68-L3 showed the opposite trend.

[0083] like Figure 9 As shown in D, the grain starch of wild-type barley, OEHvMYB68-L1, OEHvMYB68-L2, and OEHvMYB68-L3, as well as koHvmyb68-L1, koHvmyb68-L2, and koHvmyb68-L3, all possess complete type A starch crystal structures, indicating that... HvMYB68 Genes do not affect starch crystal type.

[0084] The above results indicate that HvMYB68 This gene is a key transcription factor that positively regulates barley yield and starch quality. Overexpression of this gene increases the total starch content of barley grains while reducing the proportion of amylose. The increased starch accumulation and optimized grain morphology ultimately synergistically drive significant increases in grain length, width, and thousand-grain weight, resulting in vigorous plant growth, fuller grains, and a substantial increase in plot yield. In summary, HvMYB68 achieves simultaneous improvement in barley yield and quality by regulating starch structure and accumulation.

[0085] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. HvMYB68 protein, characterized in that, The HvMYB68 protein includes any of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO:6; (2) the amino acid sequence of a protein with the same function obtained by replacing, inserting or deleting one or more amino acids of the amino acid sequence shown in SEQ ID NO:

6.

2. A nucleic acid molecule, characterized in that, Encoding the HvMYB68 protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that, The nucleic acid molecule includes any of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO:3; (2) the complete complementary sequence of the nucleotide sequence shown in (1); (3) the nucleotide sequence shown in (1) obtained by substituting, deleting or inserting one or more nucleotides to encode a protein with the same function.

4. A biomaterial, characterized in that, It comprises the nucleic acid molecule as described in claim 2 or 3; the biological material is recombinant DNA, expression cassette, transposon, vector, cell or microorganism.

5. The use of the HvMYB68 protein of claim 1, or the nucleic acid molecule of claim 2 or 3, or the biomaterial of claim 4, in any of the following: (1) Promotes barley growth; (2) Increase barley yield; (3) Improve the quality of barley grains.

6. The application according to claim 5, characterized in that, The yield includes thousand-grain weight, plot yield, and / or single-plant yield.

7. The application of the HvMYB68 protein of claim 1, or the nucleic acid molecule of claim 2 or 3, or the biomaterial of claim 4 in the improvement of barley varieties or germplasm resources.

8. A method for promoting barley growth, increasing barley yield, and / or improving barley grain quality, characterized in that, include: Promotes the expression or activity of HvMYB68 protein in target barley, and / or Increase the expression level of the HvMYB68 gene in the target barley; The HvMYB68 protein includes any of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO:6; (2) the amino acid sequence of a protein with the same function obtained by replacing, inserting or deleting one or more amino acids of the amino acid sequence shown in SEQ ID NO:

6.

9. The method according to claim 8, characterized in that, The HvMYB68 gene includes any of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO:3; (2) the complete complementary sequence of the nucleotide sequence shown in (1); (3) a nucleotide sequence of the nucleotide sequence shown in (1) obtained by substituting, deleting or inserting one or more nucleotides to encode a protein with the same function.

10. The method according to claim 8 or 9, characterized in that, The yield includes thousand-grain weight, plot yield, and / or single-plant yield.

Images