Sirs related to pyroptosis cell lysis gene and application thereof

Abstract

The application belongs to the field of biological medicine, and particularly relates to pyroptosis cell lysis related gene siRNA and application thereof. The application provides a series of small interfering RNA molecules targeting GSDMD, GSDME, ASIC1 and TOM20 genes, and the sequences are shown as SEQ ID NO: 1-38. The application also provides a recombinant vector, a host cell and a pharmaceutical composition containing the siRNA, and application of the siRNA in preparation of a medicine for inhibiting expression of pyroptosis cell lysis related genes or treating pyroptosis related diseases (such as inflammatory diseases, tumors and neurodegenerative diseases). The siRNA can efficiently and specifically silence expression of target genes, significantly inhibit cell pyroptosis, and has excellent prospects for drug development.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to siRNAs targeting pyroptosis-related genes and their applications. Specifically, it relates to a small interfering RNA (siRNA) molecule targeting pyroptosis-related genes, its composition, and its application in the preparation of drugs for treating pyroptosis-related diseases. In particular, this invention provides specific siRNA sequences targeting genes such as GSDMD, GSDME, ASIC1, and TOM20, which can efficiently inhibit the expression of these genes, thereby regulating the pyroptosis process and possessing significant clinical application value. Background Technology

[0002] Pyroptosis is a programmed cell death mechanism that has been extensively studied in recent years. It depends on the cleavage and activation of Gasdermin (GSDM) family members by caspase family proteins. Activated GSDM proteins form pores in the cell membrane, leading to increased cell membrane permeability, cell swelling, membrane rupture, and ultimately the release of cell contents, accompanied by a strong inflammatory response. Pyroptosis plays a crucial role in the body's fight against infection, immune surveillance, tumor development and progression, and neurodegenerative diseases.

[0003] GSDMD is a core protein in the pyroptosis process. It can be cleaved by Caspase-1 / 4 / 5 / 11, and its N-terminal domain oligomerizes on the cell membrane to form pores, leading to cell lysis (Ding et al., Nature, 2016; Shi et al., Nature, 2015). GSDME is mainly cleaved by Caspase-3 and mediates chemotherapy-induced pyroptosis (Rogers et al., Science, 2017). In addition, ASIC1 (acid-sensitive ion channel 1) promotes cell swelling during pyroptosis by regulating intracellular ion homeostasis (Yang et al., Cell Death Dis, 2021); TOM20 (mitochondrial outer membrane translocase 20) participates in mitochondrial damage, assists in the release of damage-associated molecular patterns (DAMPs), and promotes pyroptotic cell lysis (Wang et al., Cell, 2025). These genes together constitute a key regulatory network for pyroptotic cell lysis.

[0004] Although the role of pyroptosis in various diseases is widely recognized, targeted therapies against the aforementioned pyroptosis cleavage-related genes are currently lacking. Small interfering RNA (siRNA), as an RNA interference technology, can achieve efficient and specific gene silencing by specifically degrading target gene mRNA, and has been widely used in gene function research and drug development. However, highly efficient siRNA sequences targeting key pyroptosis cleavage genes and their application in disease treatment have not yet been reported.

[0005] Therefore, developing an siRNA molecule that can efficiently silence pyroptosis cleavage-related genes such as GSDMD, GSDME, ASIC1, and TOM20, and exploring its application in the treatment of pyroptosis-related diseases, has significant scientific and clinical translational value. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the purpose of this invention is to provide siRNAs targeting pyroptosis-related genes and their applications. This invention aims to solve the technical problem of the lack of highly effective targeted therapeutic drugs for pyroptosis-related genes in existing technologies. Specifically, this invention provides a series of siRNA molecules that specifically target the GSDMD, GSDME, ASIC1, and TOM20 genes, effectively inhibiting the expression of these genes and providing new drug options for the treatment of pyroptosis-related diseases.

[0007] The above-mentioned objective of this invention is achieved through the following technical solutions: This invention provides a nucleic acid molecule, which is a double-stranded RNA molecule comprising a sense strand and an antisense strand selected from any of the following sets of sequences: (1) The sense chain shown in SEQ ID NO:1 and the antisense chain shown in SEQ ID NO:2; (2) The positive chain shown in SEQ ID NO:3 and the negative chain shown in SEQ ID NO:4; (3) The positive chain shown in SEQ ID NO:5 and the negative chain shown in SEQ ID NO:6; (4) The positive chain shown in SEQ ID NO:7 and the negative chain shown in SEQ ID NO:8; (5) The sense chain shown in SEQ ID NO:9 and the antisense chain shown in SEQ ID NO:10; (6) The sense chain shown in SEQ ID NO:11 and the antisense chain shown in SEQ ID NO:12; (7) The positive chain shown in SEQ ID NO:13 and the negative chain shown in SEQ ID NO:14; (8) The positive chain shown in SEQ ID NO:15 and the negative chain shown in SEQ ID NO:16; (9) The sense chain shown in SEQ ID NO:17 and the antisense chain shown in SEQ ID NO:18; (10) The sense chain shown in SEQ ID NO:19 and the antisense chain shown in SEQ ID NO:20; (11) The sense chain shown in SEQ ID NO:21 and the antisense chain shown in SEQ ID NO:22; (12) The positive chain shown in SEQ ID NO:23 and the negative chain shown in SEQ ID NO:24; (13) The sense chain shown in SEQ ID NO:25 and the antisense chain shown in SEQ ID NO:26; (14) The positive chain shown in SEQ ID NO:27 and the negative chain shown in SEQ ID NO:28; (15) The sense chain shown in SEQ ID NO:29 and the antisense chain shown in SEQ ID NO:30; (16) The positive chain shown in SEQ ID NO:31 and the negative chain shown in SEQ ID NO:32; (17) The positive chain shown in SEQ ID NO:33 and the negative chain shown in SEQ ID NO:34; (18) The positive chain shown in SEQ ID NO:35 and the negative chain shown in SEQ ID NO:36; (19) The positive chain shown in SEQ ID NO:37 and the negative chain shown in SEQ ID NO:38.

[0008] According to one embodiment of the present invention, the lengths of the sense and antisense strands of the double-stranded RNA molecule are 19-25 nt, and at least one end of the double-stranded RNA molecule has a protruding end.

[0009] According to one embodiment of the present invention, the nucleic acid molecule target is selected from GSDMD, GSDME, ASIC1, TOM20. The present invention also provides one or more genes.

[0010] The present invention also provides a recombinant vector comprising a nucleic acid molecule described in the above embodiments.

[0011] The present invention also provides a host cell comprising a nucleic acid molecule of the above embodiments or a recombinant vector of the above embodiments.

[0012] The present invention also provides a pharmaceutical composition comprising the above-described embodiments. The present invention further provides a nucleic acid molecule, a recombinant vector of the above-described embodiments, or a host cell of the above-described embodiments, and a pharmaceutically acceptable carrier or excipient.

[0013] The present invention also provides the use of a nucleic acid molecule, the recombinant vector of the above embodiments, the host cell of the above embodiments, or the pharmaceutical composition of the above embodiments in the preparation of a drug for inhibiting the expression of genes related to pyroptosis cell lysis.

[0014] According to one embodiment of the present invention, the pyroptosis-related gene is GSDMD, GSDME, ASIC1, or TOM20.

[0015] The present invention also provides the use of a nucleic acid molecule, the recombinant vector of the above embodiments, the host cell of the above embodiments, or the pharmaceutical composition of the above embodiments in the preparation of a medicament for treating pyroptosis-related diseases.

[0016] According to one embodiment of the present invention, the pyroptosis-related diseases include inflammatory diseases, tumors, and neurodegenerative diseases, and the present invention also provides one or more of these.

[0017] In summary, compared with the prior art, the present invention has at least one of the following beneficial technical effects: This invention is the first to design and screen highly efficient siRNA sequences targeting key genes GSDMD, GSDME, ASIC1, and TOM20 that lyse pyroptosis cells, filling a technological gap in this field.

[0018] The siRNA molecules provided by this invention can significantly inhibit the mRNA expression levels of target genes in vitro, exhibiting high silencing efficiency and specificity, and demonstrating significant RNA interference effects. The siRNA oligonucleotide combination can effectively inhibit the expression of pyroptosis-related genes, including Gsdmd, Gsdme, Asic1, and Tom20, thereby suppressing their biological functions.

[0019] This invention provides novel drug candidate molecules for the treatment of pyroptosis-related diseases, with broad clinical application prospects, especially suitable for the intervention and treatment of inflammatory diseases, tumors and neurodegenerative diseases.

[0020] The siRNA molecules described in this invention can be delivered in vivo through various delivery systems such as liposomes and nanoparticles, exhibiting good drug-like properties and development potential. Attached Figure Description

[0021] Figure 1The graph shows the inhibitory effects of different siRNAs on the mRNA expression level of the GSDMD gene in CAL27 cells. The results show that GSDMD-Homo-904, GSDMD-Homo-810, GSDMD-Homo-1241, GSDMD-Homo-462, and GSDMD-Homo-269 can all significantly inhibit the expression of GSDMD.

[0022] Figure 2 The graph shows the inhibitory effects of different siRNAs on the mRNA expression level of the GSDME gene in A549 cells. The results show that GSDME-Homo-1681, GSDME-Homo-470, GSDME-Homo-1081, and GSDME-Homo-649 can all significantly inhibit GSDME expression.

[0023] Figure 3 The graph shows the inhibitory effects of different siRNAs on the mRNA expression level of the ASIC1 gene in 293T cells. The results show that Asic1-Homo / Mus-1, Asic1-Homo / Mus-3, and Asic1-Homo-618 can all significantly inhibit the expression of ASIC1.

[0024] Figure 4 The graph shows the inhibitory effects of different siRNAs on the mRNA expression level of the TOM20 gene in 293T cells. The results show that TOM20-Homo / Mus-1, TOM20-Homo-230, TOM20-Homo-484, TOM20-Homo-123, and TOM20-Homo-170 can all significantly inhibit the expression of TOM20. Detailed Implementation

[0025] The technical solutions in the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are within the scope of protection of this application.

[0026] TOM20 TOM20-Homo / Mus-1 AUUGUAAGUGCUCAGAGCUTT (SEQ ID NO:1) AGCUCUGAGCACUUACAAUTT (SEQ ID NO:2) TOM20 TOM20-Homo-230 GGCUUCGAGAACGAAGAAATT (SEQ ID NO:3) UUUCUUCGUUCUCGAAGCCTT (SEQ ID NO:4) TOM20 TOM20-Homo-484 CUUCUGACUAAGCUCCCAATT (SEQ ID NO:5) UUGGGAGCUUAGUCAGAAGTT (SEQ ID NO:6) TOM20 TOM20-Homo-123 AUGGUGGGUCGGAACAGCGTT (SEQ ID NO:7) CGCUGUUCCGACCCACCAUTT (SEQ ID NO:8) TOM20 TOM20-Homo-170 UUUCAUUGGGUACUGCAUCTT (SEQ ID NO:9) GAUGCAGUACCCAAUGAAATT (SEQ ID NO:10) TOM20 TOM20-Homo-UTR-1623 CCUGCUUCAACUUGAUUAUTT (SEQ ID NO:11) AUAAUCAAGUUGAAGCAGGTT (SEQ ID NO:12) GSDME GSDME-Homo-1681 CCCACUGCUUCUUUGUAUATT (SEQ ID NO:13) UAUACAAAGAAGCAGUGGGTT (SEQ ID NO:14) GSDME GSDME-Homo-470 GAGUCGGACUUUGUGAAAUTT (SEQ ID NO:15) AUUUCACAAAGUCCGACUCTT (SEQ ID NO:16) GSDME GSDME-Homo-1081 CCAGGAUGGACCAUUAAGUTT (SEQ ID NO:17) ACUUAAUGGUCCAUCCUGGTT (SEQ ID NO:18) GSDME GSDME-Homo-649 GCCGAGAGAACAAUAAAUCTT (SEQ ID NO:19) GAUUUAUUGUUCUCUCGGCTT (SEQ ID NO:20) ASIC1 Asic1-Homo / Mus-1 GCAUCAAAGUGCAGAUCCA (SEQ ID NO:21) UGGAUCUGCACUUUGAUGCCU (SEQ ID NO:22) ASIC1 Asic1-Homo / Mus-3 CCAGGGGAUGCCCCAUACU (SEQ ID NO:23) AGUAUGGGGCAUCCCCUGGCA (SEQ ID NO:24) ASIC1 Asic1-Homo-618 CUCAACGAGUUCCGCUUUA (SEQ ID NO:25) UAAAGCGGAACUCGUUGAGGU (SEQ ID NO:26) GSDMD GSDMD-Homo-904 AUGAGGUGCCUCCACAACU (SEQ ID NO:27) AGUUGUGGAGGCACCUCAUCA (SEQ ID NO:28) GSDMD GSDMD-Homo-810 UAAGAAGCAGAGGACCUUC (SEQ ID NO:29) GAAGGUCCUCUGCUUCUUAUC (SEQ ID NO:30) GSDMD GSDMD-Homo-1241 UGACCAUGCUGAGUGAAAC (SEQ ID NO:31) GUUUCACUCAGCAUGGUCAGU (SEQ ID NO:32) GSDMD GSDMD-Homo-462 GAAUGUGUACUCGCUGAGU (SEQ ID NO:33) ACUCAGCGAGUACACAUUCAU (SEQ ID NO:34) GSDMD GSDMD-Homo-269 AUAAGUGUGUCAACCUGUC (SEQ ID NO:35) GACAGGUUGACACACUUAUAA (SEQ ID NO:36) Preferably, the lengths of the sense and antisense strands of the double-stranded RNA molecule are 19-25 nt, and at least one end of the double-stranded RNA molecule has a protruding end, such as a dTdT protruding end.

[0027] Preferably, the nucleic acid molecule targets one or more genes selected from GSDMD, GSDME, ASIC1, and TOM20.

[0028] Secondly, the present invention provides a recombinant vector comprising the above-mentioned nucleic acid molecules.

[0029] Thirdly, the present invention provides a host cell comprising the aforementioned nucleic acid molecules or recombinant vectors.

[0030] Fourthly, the present invention provides a pharmaceutical composition comprising the above-mentioned nucleic acid molecule, recombinant vector or host cell, and pharmaceutically acceptable carrier or excipient.

[0031] Preferably, the pharmaceutically acceptable carrier includes, but is not limited to, liposomes, nanoparticles, polymers, peptides, sugars, surfactants, etc.

[0032] Fifthly, the present invention provides the use of the above-mentioned nucleic acid molecules, recombinant vectors, host cells or pharmaceutical compositions in the preparation of medicaments for inhibiting the expression of genes related to pyroptosis cell lysis.

[0033] Preferably, the pyroptosis-related gene is GSDMD, GSDME, ASIC1, or TOM20.

[0034] In a sixth aspect, the present invention provides the use of the above-mentioned nucleic acid molecules, recombinant vectors, host cells or pharmaceutical compositions in the preparation of medicaments for treating pyroptosis-related diseases.

[0035] Preferably, the pyroptosis-related diseases include one or more of inflammatory diseases, tumors, and neurodegenerative diseases.

[0036] Example 1: Design and Synthesis of siRNA Multiple siRNA sequences were designed and synthesized targeting the mRNA sequences of human GSDMD (Gene ID: 79792), GSDME (Gene ID: 1687), ASIC1 (Gene ID: 41), and TOM20 (Gene ID: 9804) genes. All siRNAs were synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd. using standard chemical synthesis methods, achieving HPLC-grade purity. Their sequences are shown in the table above. Some siRNAs had a dTdT overhang added to the 3' end to enhance stability.

[0037] Effects of siRNA on RNA expression levels of Gsdmd, Gsdme, Asic1, and Tom20 genes: 1. Design at least 3 siRNAs for each gene and transfect CAL27, A549, and 239T cells. Collect cell samples 48 hours after transfection for qPCR detection. Set up 3 replicates for each siRNA.

[0038] 2. Culture cells in DMEM medium containing 10% fetal bovine serum in a 10cm diameter cell culture dish until 80-90% confluence, discard the culture supernatant, and wash the cells with PBS buffer.

[0039] 3. Add 1 ml of Trypsin-EDTA solution to the cell culture dish, mix well, carefully aspirate the supernatant, and incubate at 37°C for 1 minute to digest the cells.

[0040] 4. Add 2 ml of complete culture medium to the cell culture dish and gently pipette the cells to obtain a single-cell suspension.

[0041] 5. Take the cell suspension obtained in step 3 and seed it into a 12-well plate (1×10⁵ cells per well) and incubate at 37°C for 12 hours.

[0042] 6. Dissolve the siRNA to be tested in DEPC-H2O to obtain a siRNA stock solution with a concentration of 20 μM.

[0043] 7. Add the siRNA solution and DMEM culture medium obtained in step 5 to a 1.5 ml EP tube, mix well, and obtain 200 μl of mixture A; add 196 μl of DMEM culture medium and 4 μl of transfection reagent lipo2000 to another EP tube, mix well and let stand for 5 min, and obtain 200 μl of mixture B; mix the two mixtures to obtain 400 μl of mixture, let stand at room temperature for 20 min, and this is the transfection mixture.

[0044] 8. Take the 12-well plate after completing step 4, aspirate the supernatant, add 600 μl of DMEM culture medium to each well, let it stand for 20 min, then add 400 μl of the transfection mixture prepared in step 6 to each well. The concentration of siRNA in 1 ml of each well is 10 nM. After incubating at 37℃ for 6 hours, change the medium, add complete culture medium and continue incubating for 48 hours.

[0045] 9. Take the 12-well plate after completing step 7, aspirate the supernatant, wash with PBS buffer, then add DMEM culture medium and incubate at 37°C for 24 hours.

[0046] 10. Total RNA extraction: (1) Take the 12-well plate after completing step 8, collect the cells, add 1 ml of Ezol lysis buffer to the collected cell sample, and vortex to mix. Let stand at room temperature for 5 minutes.

[0047] (2) Add 0.2 ml of chloroform, shake vigorously for 10 seconds, and let stand at room temperature for 5 minutes.

[0048] (3) Centrifuge at 4℃, 12,000 x g for 15 min.

[0049] (4) Transfer the supernatant to another new RNase-free centrifuge tube and add an equal volume of 100% ethanol.

[0050] (5) Add the sample containing ethanol to a mini-spin centrifuge column with a 2ml collection tube in two portions. Centrifuge at 8,000xg at room temperature for 15s and discard the flow-through liquid.

[0051] (6) Add 700 μl WB to the centrifuge column, lightly cover the cap, centrifuge at 8,000 x g at room temperature for 15 s, and discard the flow-through liquid.

[0052] (7) Repeat step 6 and wash the centrifuge column twice with 500 μl WB.

[0053] (8) Transfer the centrifuge column to a new RNase-free 1.5ml centrifuge tube, add 40μl of DEPC water to the center of the silica membrane, and centrifuge at 10,000xg for 3 min at 4℃ to elute RNA.

[0054] 11. Random reverse transcription: (1) Take a centrifuge tube containing N6 primer powder, centrifuge at 13000 rpm for 5 minutes on a benchtop high-speed centrifuge, add RNase Free H2O to dilute, the amount of RNase Free H2O added is 10 times the number of nmol of primer powder, and the primer concentration obtained after dilution is 100 μM.

[0055] N6 (100 μM) 5 μl RNA Sample as required 2 μg 5×RT Buffer 1× 4 μl dNTP(10 mM) 0.4 mM 0.8 μl MMLV Reverse Transcriptase(200 U / μl) 2 U / μl 0.2 μl RNase Free H2O To 20 μl (3) After mixing, place it in a PCR instrument at 25℃ for 30 min, 42℃ for 45 min, 85℃ for 5 min, and 25℃ for 30 s.

[0056] 12. Real-time quantitative PCR was used to detect the relative expression levels of each gene: (1) Take a centrifuge tube containing F / R primer dry powder, centrifuge at 13000 rpm for 5 minutes on a benchtop high-speed centrifuge, add RNase Free H2O to dilute, the amount of RNase Free H2O added is 50 times the number of nmol of primer dry powder, and the primer concentration obtained after dilution is 20 μM.

[0057] 2× Real-time PCR Master Mix 1× ​ ​ ​ ​ ​ ​ ​ ​ — ​ ​ ​ ​ ​ 1× ​ ​ ​ (3) Cyclic settings: 95℃, 3min pre-denaturation; 95℃, 12s, 62℃, 30s, 40 cycles, fluorescence signal acquisition.

[0058] (4) Melting curve: 95 ℃, 1 min, 62 ℃ 30 s, 95 ℃ 30 s.

[0059] 13. Data Processing: (1) Perform real-time PCR to obtain the Ct values ​​of the target gene and internal reference gene for each reaction.

[0060] (2) Calculate the average value of the three replicates of the sample and the calibration sample.

[0061] (3) Subtract the average Ct value of the internal reference gene from the average Ct value of the target gene to calculate the ΔCt value of each sample.

[0062] (4) The ΔCT value of each sample is calculated by subtracting the ΔCT value of the calibration sample from the ΔCt value of the test sample.

[0063] (5)Use 2 –ΔΔCt Calculate the relative gene expression ratio.

[0064] 14. Results are shown below. ​ : (1) siRNAs GSDMD-Homo-904, GSDMD-Homo-810, GSDMD-Homo-1241, GSDMD-Homo-462, and GSDMD-Homo-269 significantly inhibited the expression of the endogenous Gsdmd gene in CAL27 cells.

[0065] (2) siRNAs GSDME-Homo-1681, GSDME-Homo-470, GSDME-Homo-1081, and GSDME-Homo-649 significantly inhibited the expression of endogenous Gsdme gene in A549 cells.

[0066] (3) siRNA Asic1-Homo / Mus-1, Asic1-Homo / Mus-3, and Asic1-Homo-618 significantly inhibited the expression of endogenous Asic1 gene in 293T cells.

[0067] siRNAs TOM20-Homo / Mus-1, TOM20-Homo-230, TOM20-Homo-484, TOM20-Homo-123, and TOM20-Homo-170 significantly inhibited the expression of the endogenous Tom20 gene in 293T cells.

[0068] Example 2 Cell Culture and Transfection Cell culture: Human tongue squamous cell carcinoma CAL27, human lung adenocarcinoma A549, and human embryonic kidney cells 293T were purchased from the American Type Culture Collection (ATCC). All cells were cultured in DMEM high-glucose medium (HyClone) containing 10% fetal bovine serum (FBS, Gibco) at 37°C in a 5% CO2 incubator. Cells were passaged every 2-3 days, and cells in the logarithmic growth phase were used for experiments.

[0069] Cell seeding: Collect cells in logarithmic growth phase, digest with 0.25% trypsin-EDTA to prepare a single-cell suspension, count the cells, and seed them into 12-well plates at a density of 1 × 10⁶ cells per well. 5 Cells were cultured overnight at 37°C in a 5% CO2 incubator, and transfection was performed when the cell confluence reached 70%-80%.

[0070] siRNA transfection: Dissolve siRNA in DEPC-treated water to prepare a 20 μM stock solution. Prepare transfection mixtures A and B separately using 1.5 ml EP tubes. Tube A: Dilute an appropriate amount of siRNA stock solution with DMEM medium to a total volume of 200 μl. Tube B: Mix 4 μl of Lipofectamine 2000 (Invitrogen) with 196 μl of DMEM medium and incubate at room temperature for 5 minutes. Mix tubes A and B and incubate at room temperature for 20 minutes to form the siRNA-liposome complex. Discard the cell supernatant from the 12-well plate, add 600 μl of fresh DMEM medium to each well, then add 400 μl of the transfection mixture dropwise to a final volume of 1 ml per well, resulting in a final siRNA concentration of 10 nM. After 6 hours of transfection, replace with complete medium and continue culturing for 48 hours.

[0071] Example 3: Real-time quantitative PCR detection of target gene mRNA expression levels Total RNA extraction: 48 hours after transfection, the cell supernatant was discarded, and the cells were washed once with PBS buffer. 1 ml of Ezol lysis buffer (Nanjing Novizan Biotechnology Co., Ltd.) was added to each well, and the cells were lysed at room temperature for 5 minutes. After mixing, the cells were transferred to RNase-free 1.5 ml centrifuge tubes. 0.2 ml of chloroform was added, and the mixture was vigorously vortexed for 10 seconds and incubated at room temperature for 5 minutes. The cells were centrifuged at 12,000 × g for 15 minutes at 4°C. The upper aqueous phase was transferred to a new tube, and an equal volume of 100% ethanol was added. After mixing, the mixture was transferred to a mini-spin column and centrifuged at 8,000 × g for 15 seconds, discarding the flow-through. 700 μl and 500 μl of Western blotting buffer were added sequentially, and the cells were centrifuged at 8,000 × g for 15 seconds, discarding the flow-through. Finally, the centrifuge column was transferred to a new tube, 40 μl of DEPC water was added, and the cells were centrifuged at 10,000 × g for 3 minutes to elute the RNA. RNA concentration and purity were determined using a NanoDrop 2000 (Thermo Fisher).

[0072] Reverse transcription: Take 1 μg of total RNA and perform reverse transcription using N6 random primers (100 μM). The reaction system is as follows: 4 μl of 5×RT Buffer, 0.8 μl of dNTPs (10 mM), 0.2 μl of MMLV reverse transcriptase (200 U / μl), 5 μl of N6 primers, 1 μg of RNA, and add RNase-free H2O to a total volume of 20 μl. Reaction program: 25℃ for 30 minutes, 42℃ for 45 minutes, 85℃ for 5 minutes, and store at 4℃.

[0073] Real-time quantitative PCR: qPCR detection was performed using the SYBR Green method. The reaction system was as follows: 10 μl of 2×Real-time PCR Master Mix (containing Taq enzyme and SYBR Green), 0.1 μl of upstream primer (20 μM), 0.1 μl of downstream primer (20 μM), 2 μl of cDNA, 0.4 μl of ROX reference dye (50×), and RNase-free H2O to a final volume of 20 μl. The reaction program was: 95℃ for 3 minutes pre-denaturation; 95℃ for 12 seconds, 62℃ for 30 seconds, for a total of 40 cycles; followed by melting curve analysis: 95℃ for 1 minute, 62℃ for 30 seconds, 95℃ for 30 seconds. The primer sequences are as follows: GSDMD: F: 5'-CAGGTGTCCAGGAAGATCCG-3', R: 5'-GTCCTGGGATGAGTGAGGAG-3' GSDME: F: 5'-CTGGACTTCGCCATCAACAG-3', R: 5'-GATGGTGTCGGTGGTGTTCT-3' ASIC1: F: 5'-TGGTGGACAACGGCTTCATC-3', R: 5'-GGCCATCTGGTGGTAGTTCC-3' TOM20: F: 5'-GCCGAGAGAACAATAAATCC-3', R: 5'-GGTGTAGCTGCGGTTGATGT-3' GAPDH (internal reference): F: 5'-GGAGCGAGATCCCTCCAAAAT-3', R: 5'-GGCTGTTGTCATACTTCTCATGG-3' Data processing: using 2 ⁻ΔΔCt The relative expression levels of target genes were calculated using a method with three replicates per sample. Data are presented as mean ± standard deviation (SD). Statistical analysis was performed using GraphPad Prism 9.0 software. Comparisons between groups were conducted using t-tests or one-way ANOVA. A p-value < 0.05 was considered statistically significant.

[0074] Example 4 Experimental Results The inhibitory effect of siRNA on the GSDMD gene: such as ​ As shown, compared with the negative control group (NC), GSDMD-Homo-904, GSDMD-Homo-810, GSDMD-Homo-1241, GSDMD-Homo-462, and GSDMD-Homo-269 significantly reduced the expression level of GSDMD mRNA in CAL27 cells, with inhibition rates of 78.3%, 71.5%, 68.9%, 65.2%, and 62.1%, respectively (P<0.01), indicating that the above siRNAs have a highly efficient silencing effect on GSDMD.

[0075] The inhibitory effect of siRNA on the GSDME gene: such as Figure 2 As shown, GSDME-Homo-1681, GSDME-Homo-470, GSDME-Homo-1081, and GSDME-Homo-649 inhibited GSDME mRNA in A549 cells by 82.4%, 75.6%, 69.3%, and 70.1%, respectively (P<0.01), demonstrating excellent gene silencing activity.

[0076] The inhibitory effect of siRNA on the ASIC1 gene: such as Figure 3As shown, the inhibition rates of ASIC1 mRNA by Asic1-Homo / Mus-1, Asic1-Homo / Mus-3, and Asic1-Homo-618 in 293T cells were 85.1%, 80.3%, and 76.2%, respectively (P<0.01), indicating that these siRNAs can efficiently silence ASIC1 expression.

[0077] The inhibitory effect of siRNA on the TOM20 gene: such as Figure 4 As shown, TOM20-Homo / Mus-1, TOM20-Homo-230, TOM20-Homo-484, TOM20-Homo-123, and TOM20-Homo-170 inhibited TOM20 mRNA at rates of 79.5%, 74.8%, 68.9%, 72.3%, and 70.6% in 293T cells, respectively (P<0.01), demonstrating good gene silencing efficiency.

[0078] Example 5: Functional validation of siRNA in a pyroptosis model To further verify the functional effects of the aforementioned siRNAs in the pyroptosis process, a macrophage pyroptosis model was induced using LPS combined with nigericin. GSDMD-siRNA (GSDMD-Homo-904) and negative control siRNA were transfected into macrophages. Cell membrane integrity was assessed by LDH release, IL-1β release levels were detected by ELISA, and cell morphological changes were observed by transmission electron microscopy.

[0079] The results showed that, compared with the control group, the GSDMD-siRNA transfection group exhibited significantly reduced LDH release (P<0.01), a decrease in IL-1β secretion level of approximately 65%, and reduced pyroptosis-characteristic membrane pore formation and cell swelling under electron microscopy. These results indicate that the siRNA provided by this invention can effectively inhibit the pyroptosis process and protect cells from pyroptotic lysis.

[0080] Example 6 Preparation of Pharmaceutical Composition The siRNA described in this invention (such as GSDMD-Homo-904) was mixed with cationic liposomes (DOTAP:DOPE = 1:1) at a mass ratio of 1:5, and liposome-encapsulated siRNA nanoparticles were prepared by thin-film hydration. The particle size was approximately 120 nm, the zeta potential was +25 mV, and the encapsulation efficiency was >85%. This nanoformulation can be stored at 4°C for at least 6 months and exhibits low cytotoxicity, making it suitable for in vivo delivery.

[0081] Example 7: In vivo efficacy evaluation An acute peritonitis model was induced in C57BL / 6 mice by intraperitoneal injection of LPS (10 mg / kg) combined with ATP (5 mM). GSDMD-siRNA (1 mg / kg) encapsulated in liposomes was then injected via the tail vein, once every two days for a total of three times. The levels of IL-1β and IL-18 in the peritoneal lavage fluid, as well as the proportion of peritoneal macrophages undergoing pyroptosis, were measured.

[0082] The results showed that the levels of IL-1β and IL-18 in the peritoneal lavage fluid of mice in the treatment group decreased by approximately 70% and 65%, respectively, and the pyroptosis rate of peritoneal macrophages decreased from 32% in the control group to 12% (P<0.01), indicating that the siRNA of the present invention also has a significant inhibitory effect on pyroptosis in vivo and has a good therapeutic effect.

[0083] In summary, the siRNA molecule targeting pyroptosis-related genes provided by this invention can efficiently inhibit the expression of target genes in vitro and in vivo, significantly suppressing the pyroptosis process, and has important clinical application value.

[0084] The implementation principle of this invention is as follows: This invention belongs to the field of biomedicine, specifically involving siRNAs of pyroptosis-related genes and their applications. This invention provides a series of small interfering RNA molecules targeting the GSDMD, GSDME, ASIC1, and TOM20 genes, with sequences shown in SEQ ID NO:1-38. This invention also provides recombinant vectors containing the siRNAs, host cells, pharmaceutical compositions, and their application in the preparation of drugs for inhibiting the expression of pyroptosis-related genes or treating pyroptosis-related diseases (such as inflammatory diseases, tumors, and neurodegenerative diseases). The siRNAs of this invention can efficiently and specifically silence target gene expression, significantly inhibiting pyroptosis, and have excellent prospects for drug development.

[0085] The embodiments described herein are preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Therefore, all equivalent changes made in accordance with the structure, shape, and principle of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A nucleic acid molecule, characterized in that, The nucleic acid molecule is a double-stranded RNA molecule, which contains a sense strand and an antisense strand selected from any of the following sets of sequences: (1) The sense chain shown in SEQ ID NO:1 and the antisense chain shown in SEQ ID NO:2; (2) The positive chain shown in SEQ ID NO:3 and the negative chain shown in SEQ ID NO:4; (3) The positive chain shown in SEQ ID NO:5 and the negative chain shown in SEQ ID NO:6; (4) The positive chain shown in SEQ ID NO:7 and the negative chain shown in SEQ ID NO:8; (5) The sense chain shown in SEQ ID NO:9 and the antisense chain shown in SEQ ID NO:10; (6) The sense chain shown in SEQ ID NO:11 and the antisense chain shown in SEQ ID NO:12; (7) The positive chain shown in SEQ ID NO:13 and the negative chain shown in SEQ ID NO:14; (8) The positive chain shown in SEQ ID NO:15 and the negative chain shown in SEQ ID NO:16; (9) The sense chain shown in SEQ ID NO:17 and the antisense chain shown in SEQ ID NO:18; (10) The sense chain shown in SEQ ID NO:19 and the antisense chain shown in SEQ ID NO:20; (11) The sense chain shown in SEQ ID NO:21 and the antisense chain shown in SEQ ID NO:22; (12) The positive chain shown in SEQ ID NO:23 and the negative chain shown in SEQ ID NO:24; (13) The sense chain shown in SEQ ID NO:25 and the antisense chain shown in SEQ ID NO:26; (14) The positive chain shown in SEQ ID NO:27 and the negative chain shown in SEQ ID NO:28; (15) The sense chain shown in SEQ ID NO:29 and the antisense chain shown in SEQ ID NO:30; (16) The positive chain shown in SEQ ID NO:31 and the negative chain shown in SEQ ID NO:32; (17) The positive chain shown in SEQ ID NO:33 and the negative chain shown in SEQ ID NO:34; (18) The positive chain shown in SEQ ID NO:35 and the negative chain shown in SEQ ID NO:36; (19) The positive chain shown in SEQ ID NO:37 and the negative chain shown in SEQ ID NO:

38.

2. The nucleic acid molecule of claim 1, wherein The lengths of the sense and antisense strands of the double-stranded RNA molecule are 19-25 nt, and at least one end of the double-stranded RNA molecule has a protruding end.

3. A nucleic acid molecule according to claim 1, characterized in that, The nucleic acid molecules are targeted by one or more genes selected from GSDMD, GSDME, ASIC1, and TOM20.

4. A recombinant vector, characterized in that, The recombinant vector comprises a nucleic acid molecule as described in any one of claims 1-3.

5. A host cell, characterized in that, The host cell comprises a nucleic acid molecule as described in any one of claims 1-3 or a recombinant vector as described in claim 4.

6. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises a nucleic acid molecule as described in any one of claims 1-3, a recombinant vector as described in claim 4 or a host cell as described in claim 5, and a pharmaceutically acceptable carrier or excipient.

7. The use of a nucleic acid molecule according to any one of claims 1-3, a recombinant vector according to claim 4, a host cell according to claim 5, or a pharmaceutical composition according to claim 6 in the preparation of a medicament for inhibiting the expression of genes related to pyroptosis cell lysis.

8. The application according to claim 7, characterized in that, The pyroptosis-related genes are GSDMD, GSDME, ASIC1, or TOM20.

9. The use of a nucleic acid molecule according to any one of claims 1-3, a recombinant vector according to claim 4, a host cell according to claim 5, or a pharmaceutical composition according to claim 6 in the preparation of a medicament for treating pyroptosis-related diseases.

10. The application according to claim 9, characterized in that, The pyroptosis-related diseases include one or more of the following: inflammatory diseases, tumors, and neurodegenerative diseases.

Images