SiRNA of pyroptosis-related danger signal recognition and inflammasome assembly-related gene and application thereof

Abstract

The application discloses siRNA of a gene related to pyroptosis-related danger signal recognition and inflammasome assembly and application thereof, and belongs to the technical field of biological medicine. The application provides siRNA molecules targeting Aim2, Nlrp10, Nod1, Rig-1, Dhx9 and Gbp1 genes, wherein the sequences of the sense strands and antisense strands are respectively shown as SEQ ID NOs: 1-44. The application also provides a pharmaceutical composition containing the siRNA and application thereof in the preparation of a medicine for treating a pyroptosis-related disease. Experiments prove that the siRNA can efficiently and specifically inhibit the mRNA expression level of a target gene and significantly reduce the initiation of pyroptosis. The application provides a new nucleic acid drug strategy for the treatment of inflammatory diseases, autoimmune diseases, tumors and neurodegenerative diseases and other pyroptosis-related diseases, and has a wide clinical application prospect.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to siRNAs of genes related to pyroptosis-related danger signal recognition and inflammasome assembly, and their applications. Background Technology

[0002] Pyroptosis is a programmed cell death process dependent on caspase and Gasdermin (GSDM) family proteins. It not only exhibits characteristics of cell death but also possesses strong inflammatory response properties. Pyroptosis plays a central role in the body's immune defense, particularly in clearing intracellular pathogens (such as bacteria and viruses) and abnormal cells (such as tumor cells). It also serves as a crucial link between innate and adaptive immunity. However, dysfunction of pyroptosis is closely related to the pathogenesis of many major diseases, including but not limited to inflammatory diseases (such as inflammatory bowel disease and sepsis), autoimmune diseases, tumors, and neurodegenerative diseases (such as Alzheimer's disease). Therefore, regulating key nodes in pyroptosis has become a potential breakthrough in the field of disease diagnosis and treatment.

[0003] The initiation of pyroptosis depends on the recognition of upstream danger signals and the assembly of inflammasomes. This process is mainly accomplished by a series of pattern recognition receptors (PRRs) and accessory proteins. They can recognize pathogen-associated molecular patterns (PAMPs, such as bacterial DNA, RNA, and peptidoglycan) or damage-associated molecular patterns (DAMPs, such as host-derived abnormal DNA and RNA), thereby initiating the assembly of inflammasomes and laying the foundation for downstream Caspase-1 activation and Gasdermin D cleavage. This step is the "master switch" for pyroptosis initiation and plays a decisive regulatory role in the occurrence of pyroptosis.

[0004] Existing research indicates that multiple genes play key roles in danger signal recognition and inflammasome assembly: Aim2 (melanoma deficiency factor 2): As a sensor of intracellular double-stranded DNA, it can specifically recognize abnormal DNA from viruses or hosts and directly initiate the assembly of the AIM2 inflammasome (Burckstummer et al., 2009, Nature).

[0005] Nlrp10 (NLR family protein containing pyrin domain 10): involved in regulating the activation of inflammasomes and is an important regulator of pyroptosis initiation (Kanneganti et al., 2010, Immunity).

[0006] Nod1 (nucleotide-binding oligomerization domain 1) and Rig-1 (retinoic acid-induced gene protein I): the former recognizes bacterial peptidoglycan, and the latter recognizes abnormal cytoplasmic RNA. Both can synergistically participate in the assembly and initiation of inflammasomes (Wu et al., 2022, Cell Rep).

[0007] Dhx9 (DEAH-box helicase 9): As an RNA helicase, it helps cells recognize danger signals and participates in the regulation of immune responses (Meier et al., 2020, J Immunol).

[0008] Gbp1 (guanylate-binding protein 1): can promote the clearance of intracellular pathogens and assist in the activation of inflammasomes (Man et al., 2021, Cell Death Differ).

[0009] Although the importance of the aforementioned genes in pyroptosis regulation has been revealed, there is currently a lack of targeted therapeutics in the clinical setting for these key genes involved in pyroptosis-related danger signal recognition and inflammasome assembly. Small interfering RNA (siRNA) is a double-stranded RNA molecule of 20-25 nt in length that can specifically bind to and degrade target mRNA through RNA interference (RNAi) mechanisms, thereby efficiently and specifically silencing the expression of target genes at the posttranscriptional level. Targeting these key genes initiating pyroptosis using siRNA technology holds promise for blocking the abnormal activation of pyroptosis signaling pathways at their source, providing a novel strategy for the treatment of related diseases.

[0010] However, designing siRNA molecules with high silencing efficiency, good stability, and low off-target effects is no easy task. Currently, there are no effective siRNA sequences targeting the aforementioned gene combinations, nor are there any reports of using them as pharmaceutical compositions to treat pyroptosis-related diseases. Summary of the Invention

[0011] To address the shortcomings of existing technologies, the purpose of this invention is to provide siRNAs for pyroptosis-related danger signal recognition and inflammasome assembly-related genes and their applications. This aims to solve the problem of the lack of targeted therapeutic drugs for key genes (including Aim2, Nlrp10, Nod1, Rig-1, Dhx9, and Gbp1) involved in pyroptosis-related danger signal recognition and inflammasome assembly. To this end, this invention provides a series of rationally designed siRNA molecules with high silencing efficiency, which can specifically inhibit the expression of the aforementioned genes, thereby blocking the initiation of pyroptosis and providing effective nucleic acid drugs for the treatment of pyroptosis-related diseases.

[0012] The above-mentioned objective of this invention is achieved through the following technical solutions: This invention provides a nucleic acid molecule, which is a double-stranded RNA comprising a sense strand and an antisense strand, wherein the sequences of the sense strand and the antisense strand are selected from any one of the following groups: a. The sense chain shown in SEQ ID NO:1 and the antisense chain shown in SEQ ID NO:2; b. The justice chain shown in SEQ ID NO:3 and the antisense chain shown in SEQ ID NO:4; c. The sense chain shown in SEQ ID NO:5 and the antisense chain shown in SEQ ID NO:6; d. The justice chain shown in SEQ ID NO:7 and the antisense chain shown in SEQ ID NO:8; e. The positive chain shown in SEQ ID NO:9 and the negative chain shown in SEQ ID NO:10; f. The justice chain shown in SEQ ID NO:11 and the antisense chain shown in SEQ ID NO:12; g. The justice chain shown in SEQ ID NO:13 and the antisense chain shown in SEQ ID NO:14; h. The positive chain shown in SEQ ID NO:15 and the negative chain shown in SEQ ID NO:16; i. The justice chain shown in SEQ ID NO:17 and the antisense chain shown in SEQ ID NO:18; j. The justice chain shown in SEQ ID NO:19 and the antisense chain shown in SEQ ID NO:20; k. The justice chain shown in SEQ ID NO:21 and the antisense chain shown in SEQ ID NO:22; l. The justice chain shown in SEQ ID NO:23 and the antisense chain shown in SEQ ID NO:24; m. The justice chain shown in SEQ ID NO:25 and the antisense chain shown in SEQ ID NO:26; n. The justice chain shown in SEQ ID NO:27 and the antisense chain shown in SEQ ID NO:28; o. The justice chain shown in SEQ ID NO:29 and the antisense chain shown in SEQ ID NO:30; p. The justice chain shown in SEQ ID NO:31 and the antisense chain shown in SEQ ID NO:32; q. The justice chain shown in SEQ ID NO:33 and the antisense chain shown in SEQ ID NO:34; r. The justice chain shown in SEQ ID NO:35 and the antisense chain shown in SEQ ID NO:36; s. the justice chain shown in SEQ ID NO:37 and the antisense chain shown in SEQ ID NO:38; t. The justice chain shown in SEQ ID NO:39 and the antisense chain shown in SEQ ID NO:40; u. The justice chain shown in SEQ ID NO:41 and the antisense chain shown in SEQ ID NO:42; v. The justice chain shown in SEQ ID NO:43 and the antisense chain shown in SEQ ID NO:44.

[0013] According to one embodiment of the present invention, the ends of the double-stranded RNA contain two protruding thymine deoxynucleotide modifications.

[0014] The present invention also provides a pharmaceutical composition comprising one of the above-described nucleic acid molecules and a pharmaceutically acceptable carrier.

[0015] According to one embodiment of the present invention, the pharmaceutically acceptable carrier is selected from liposomes, nanoparticles, viral vectors or cationic polymers.

[0016] The present invention also provides the application of the above-mentioned nucleic acid molecule in the preparation of drugs for treating pyroptosis-related diseases.

[0017] According to one embodiment of the present invention, the pyroptosis-related disease is an inflammatory disease, an autoimmune disease, a tumor, or a neurodegenerative disease.

[0018] According to one embodiment of the present invention, the inflammatory disease is sepsis, acute pancreatitis, or inflammatory bowel disease.

[0019] The present invention also provides a method for inhibiting the expression of Aim2, Nlrp10, Nod1, Rig-1, Dhx9 or Gbp1 genes in cells, comprising introducing one of the above-mentioned nucleic acid molecules into the cells.

[0020] The present invention also provides a method for screening candidate drugs for treating pyroptosis-related diseases, including using one of the above-mentioned nucleic acid molecules as a positive control.

[0021] The present invention also provides a kit comprising one of the above-described nucleic acid molecules.

[0022] In summary, compared with the prior art, the present invention has at least one of the following beneficial technical effects: Filling a technological gap: This invention provides for the first time specific siRNA sequences targeting key pyroptosis initiation genes (Aim2, Nlrp10, Nod1, Rig-1, Dhx9, Gbp1). These siRNAs can block the recognition of danger signals and the assembly of inflammasomes at the source, thereby effectively inhibiting the occurrence of pyroptosis.

[0023] High efficiency and specificity: Through extensive experimental verification (see detailed implementation), the siRNA of the present invention can significantly reduce the mRNA expression level of target genes in various cell lines (such as A549, A431, CAL27), with some siRNAs having an inhibition efficiency of over 80%, and the off-target effect is effectively reduced through sequence design.

[0024] Broad Applicability: The siRNA provided by this invention covers multiple key nodes in the pyroptosis initiation pathway, allowing for selective application based on the differences in the dominant pyroptosis pathway in different disease models. It can also be used in combination to achieve synergistic inhibitory effects. The siRNA oligonucleotide combination can effectively inhibit the expression of genes related to pyroptosis-related danger signal recognition and inflammasome assembly, including Aim2, Nlrp10, Nod1, Rig-1, Dhx9, and Gbp1, thereby suppressing their biological functions.

[0025] High drug-likeness: siRNA, as a novel nucleic acid drug, has the advantages of high specificity and low toxicity. The siRNA sequence provided by this invention has been optimized and can be used as an active ingredient to prepare formulations such as lipid nanoparticles, showing promising clinical application prospects. Attached Figure Description

[0026] Figure 1 This figure shows the inhibitory effect of siRNAs targeting the Aim2 gene on Aim2 mRNA expression levels in CAL27 cells. The figure demonstrates that AIM2-Homo-236, AIM2-Homo-735, AIM2-Homo-615, AIM2-Homo-1044, and AIM2-Homo-339 significantly inhibited Aim2 gene expression.

[0027] Figure 2 This figure shows the inhibitory effect of siRNA targeting the Nlrp10 gene on Nlrp10 mRNA expression in A431 cells. The figure demonstrates that Nlrp10-Homo / Mus-3 and Nlrp10-Homo-994 significantly inhibit Nlrp10 gene expression.

[0028] Figure 3This figure shows the inhibitory effect of siRNA targeting the Nod1 gene on Nod1 mRNA expression in CAL27 cells. The figure demonstrates that NOD1-Homo-545 and NOD1-Homo-2775 significantly inhibit Nod1 gene expression.

[0029] Figure 4 This figure shows the inhibitory effect of siRNAs targeting the Rig-1 gene on Rig-1 mRNA expression levels in CAL27 cells. The figure demonstrates that RIG-1-Homo-842, RIG-1-Homo-1374, and RIG-1-Homo-1656 significantly inhibit Rig-1 gene expression.

[0030] Figure 5 This figure shows the inhibitory effect of siRNAs targeting the Dhx9 gene on Dhx9 mRNA expression levels in A549 cells. The figure demonstrates that Dhx9-Homo / Mus-2, Dhx9-Homo / Mus-3, Dhx9-Homo / Mus-4, and Dhx9-Homo / Mus-5 significantly inhibit Dhx9 gene expression.

[0031] Figure 6 This figure shows the inhibitory effect of siRNAs targeting the Gbp1 gene on Gbp1 mRNA expression levels in CAL27 cells. The figure demonstrates that GBP1-Homo-778, GBP1-Homo-1364, GBP1-Homo-1478, GBP1-Homo-1727, and GBP1-Homo-1180 significantly inhibit Gbp1 gene expression. Detailed Implementation

[0032] The technical solutions in the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are within the scope of protection of this application.

[0033] Through extensive screening and experimental verification, this invention designs and obtains specific siRNA sequences targeting the Aim2, Nlrp10, Nod1, Rig-1, Dhx9, and Gbp1 genes. These siRNA molecules can efficiently and specifically reduce the mRNA expression levels of the target genes.

[0034] Dhx9-Homo / Mus-2 CAAUGCUGCCAGAGACUUUTT AAAGUCUCUGGCAGCAUUGTT Dhx9-Homo / Mus-3 UUACUACUCAAGAAAGGAATT UUCCUUUCUUGAGUAGUAATT Dhx9-Homo / Mus-4 AUAUAAGUACACCCAAGUGTT CACUUGGGUGUACUUAUAUTT Dhx9-Homo / Mus-5 GACCAUUUAUAUCAAGCAGTT CUGCUUGAUAUAAAUGGUCTT Nlrp10-Homo / Mus-3 AGGAUCUGAAGCAUUUUAA UUAAAAUGCUUCAGAUCCUGC Nlrp10-Homo-994 CUGCUGCACCUUCUAAUUA UAAUUAGAAGGUGCAGCAGGC AIM2-Homo-236 UCUUUCAGACGAGUUUAAU AUUAAACUCGUCUGAAAGAAA AIM2-Homo-735 ACACUGCUGAAAGAUAAAU AUUUAUCUUUCAGCAGUGUAU AIM2-Homo-615 CCAGUUAUGGUACUGAAAG CUUUCAGUACCAUAACUGGCA AIM2-Homo-1044 AACGAGGACACAAUGAAAU AUUUCAUUGUGUCCUCGUUUC AIM2-Homo-339 AUGAAGACCAUUCGUAUUU AAAUACGAAUGGUCUUCAUCA AIM2-Homo-1137 GGAGUUCAUAGCACCAUAA UUAUGGUGCUAUGAACUCCAG GBP1-Homo-778 UUUGAUCGGCCCGUUCACC GGUGAACGGGCCGAUCAAAGA GBP1-Homo-1364 AUCGUCUCUUUGUUCAGAA UUCUGAACAAAGAGACGAUAG GBP1-Homo-1478 UGACUGAUGCAAUUCUCCA UGGAGAAUUGCAUCAGUCAUA GBP1-Homo-1727 UUCAGGAACAGGAGCAACU AGUUGCUCCUGUUCCUGAAGU GBP1-Homo-1180 UCCUUCAAAGAUGUGGACC GGUCCACAUCUUUGAAGGAAC NOD1-Homo-545 ACAGUGAGAUGGAAAUAAU AUUAUUUCCAUCUCACUGUGG NOD1-Homo-2775 CGAAGAGCUGACCAAAUAC GUAUUUGGUCAGCUCUUCGCU RIG-1-Homo-842 UUUGUUUCACUGCUUAUAU AUAUAAGCAGUGAAACAAAGG RIG-1-Homo-1374 UGGAGCAAGUUGUUUAUAA UUAUAAACAACUUGCUCCAGU RIG-1-Homo-1656 CACAUUUGCGGAAAUAUAA UUAUAUUUCCGCAAAUGUGAA Preferably, the ends of the double-stranded RNA molecule contain two protruding thymine deoxynucleotide (dTdT) modifications.

[0035] The present invention also provides a pharmaceutical composition comprising the nucleic acid molecule described in any of the preceding claims and a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier includes, but is not limited to, liposomes, nanoparticles, viral vectors, cationic polymers, etc.

[0036] This invention also provides the application of the above-mentioned nucleic acid molecules in the preparation of drugs for treating pyroptosis-related diseases. These pyroptosis-related diseases include, but are not limited to, inflammatory diseases (such as sepsis, acute pancreatitis, and inflammatory bowel disease), autoimmune diseases, tumors, and neurodegenerative diseases (such as Alzheimer's disease).

[0037] Example 1: Design and Synthesis of siRNA Multiple candidate siRNA sequences were designed using bioinformatics software targeting the mRNA sequences of the human and mouse genes Aim2, Nlrp10, Nod1, Rig-1, Dhx9, and Gbp1. Design principles included: a GC content of 30%-60% for the target sequence; avoidance of consecutive repetitive sequences; and BLAST alignment to ensure no homology with other genes to reduce off-target effects. During synthesis, two deoxythymine (dTdT) molecules were added to the 3' end of each strand to enhance stability. The sequences listed in the table above were selected for further validation. All siRNAs were synthesized by a professional biotechnology company with a purity ≥95%.

[0038] Effects of siRNA on RNA expression levels of Aim2, Nlrp10, Nod1, Rig-1, Dhx9, and Gbp1 genes: 1. Six siRNAs were designed for each gene and transfected into A549, A431, and CAL27 cells. Cell samples were collected 48 hours after transfection for qPCR detection. Three replicates were set up for each siRNA.

[0039] 2. Culture the cells in DMEM medium containing 10% fetal bovine serum in a 10cm diameter cell culture dish until they reach 80-90% confluence. Discard the culture supernatant and wash the cells with PBS buffer.

[0040] 3. Add 1 ml of Trypsin-EDTA solution to the cell culture dish, mix well, carefully aspirate the supernatant, and incubate at 37°C for 1 minute to digest the cells.

[0041] 4. Add 2 ml of complete culture medium to the cell culture dish and gently pipette the cells to obtain a single-cell suspension.

[0042] 5. Take the cell suspension obtained in step 3 and seed it into a 12-well plate (1×10⁵ cells per well) and incubate at 37°C for 12 hours.

[0043] 6. Dissolve the siRNA to be tested in DEPC-H2O to obtain a siRNA stock solution with a concentration of 20 μM.

[0044] 7. Add the siRNA solution and DMEM culture medium obtained in step 5 to a 1.5 ml EP tube, mix well, and obtain 200 μl of mixture A; add 196 μl of DMEM culture medium and 4 μl of transfection reagent lipo2000 to another EP tube, mix well and let stand for 5 min, and obtain 200 μl of mixture B; mix the two mixtures to obtain 400 μl of mixture, let stand at room temperature for 20 min, and this is the transfection mixture.

[0045] 8. Take the 12-well plate after completing step 4, aspirate the supernatant, add 600 μl of DMEM culture medium to each well, let it stand for 20 min, then add 400 μl of the transfection mixture prepared in step 6 to each well. The concentration of siRNA in 1 ml of each well is 10 nM. After incubating at 37℃ for 6 hours, change the medium, add complete culture medium and continue incubating for 48 hours.

[0046] 9. Take the 12-well plate after completing step 7, aspirate the supernatant, wash with PBS buffer, then add DMEM culture medium and incubate at 37°C for 24 hours.

[0047] 10. Total RNA extraction: (1) Take the 12-well plate after completing step 8, collect the cells, add 1 ml of Ezol lysis buffer to the collected cell sample, and vortex to mix. Let stand at room temperature for 5 minutes.

[0048] (2) Add 0.2 ml of chloroform, shake vigorously for 10 seconds, and let stand at room temperature for 5 minutes.

[0049] (3) Centrifuge at 4℃, 12,000 x g for 15 min.

[0050] (4) Transfer the supernatant to another new RNase-free centrifuge tube and add an equal volume of 100% ethanol.

[0051] (5) Add the sample containing ethanol to a mini-spin centrifuge column with a 2ml collection tube in two portions. Centrifuge at 8,000xg at room temperature for 15s and discard the flow-through liquid.

[0052] (6) Add 700 μl WB to the centrifuge column, lightly cover the cap, centrifuge at 8,000 x g at room temperature for 15 s, and discard the flow-through liquid.

[0053] (7) Repeat step 6 and wash the centrifuge column twice with 500 μl WB.

[0054] (8) Transfer the centrifuge column to a new RNase-free 1.5ml centrifuge tube, add 40μl of DEPC water to the center of the silica membrane, and centrifuge at 10,000xg for 3 min at 4℃ to elute RNA.

[0055] 11. Random reverse transcription: (1) Take a centrifuge tube containing N6 primer powder, centrifuge at 13000 rpm for 5 minutes on a benchtop high-speed centrifuge, add RNase Free H2O to dilute, the amount of RNase Free H2O added is 10 times the number of nmol of primer powder, and the primer concentration obtained after dilution is 100 μM.

[0056] N6 (100 μM) 5 μl RNA Sample as required 2 μg 5×RT Buffer 1× 4 μl dNTP(10 mM) 0.4 mM 0.8 μl MMLV Reverse Transcriptase(200 U / μl) 2 U / μl 0.2 μl RNase Free H2O To 20 μl (3) After mixing, place it in a PCR instrument at 25℃ for 30 min, 42℃ for 45 min, 85℃ for 5 min, and 25℃ for 30 s.

[0057] 12. Real-time quantitative PCR was used to detect the relative expression levels of each gene: (1) Take a centrifuge tube containing F / R primer dry powder, centrifuge at 13000 rpm for 5 minutes on a benchtop high-speed centrifuge, add RNase Free H2O to dilute, the amount of RNase Free H2O added is 50 times the number of nmol of primer dry powder, and the primer concentration obtained after dilution is 20 μM.

[0058] 2× Real-time PCR Master Mix 1× 10 μl F primer (20 uM) 0.1μM 0.1 μl R primer (20 uM) 0.1μM 0.1 μl cDNA — 2 μl Taq DNA polymerase(5U / μl) 0.05 U / μl 0.2 μl ROX reference dye(50×) 1× 0.4 μl RNase-free H2O To 20 μl (3) Cyclic settings: 95℃, 3min pre-denaturation; 95 ºC, 12s, 62 ºC, 30s, 40 cycles, fluorescence signal acquisition.

[0059] (4) Melting curves: 95 ºC, 1 min, 62 ºC 30 s, 95 ºC 30 s.

[0060] 13. Data Processing: (1) Perform real-time PCR to obtain the Ct values ​​of the target gene and internal reference gene for each reaction.

[0061] (2) Calculate the average value of the three replicates of the sample and the calibration sample.

[0062] (3) Subtract the average Ct value of the internal reference gene from the average Ct value of the target gene to calculate the ΔCt value of each sample.

[0063] (4) The ΔCT value of each sample is calculated by subtracting the ΔCT value of the calibration sample from the ΔCt value of the test sample.

[0064] (5)Use 2 –ΔΔCtCalculate the relative gene expression ratio.

[0065] 14. Results are shown below. Figure 1-6 : (1) siRNAs AIM2-Homo-236, AIM2-Homo-735, AIM2-Homo-615, AIM2-Homo-1044, and AIM2-Homo-339 significantly inhibited the expression of endogenous Aim2 gene in CAL27 cells.

[0066] (2) siRNA Nlrp10-Homo / Mus-3 and Nlrp10-Homo-994 have a significant inhibitory effect on the expression of endogenous Nlrp10 gene in A431 cells.

[0067] (3) siRNA NOD1-Homo-545 and NOD1-Homo-2775 have a significant inhibitory effect on the expression of endogenous Nod1 gene in CAL27 cells.

[0068] (4) siRNAs RIG-1-Homo-842, RIG-1-Homo-1374, and RIG-1-Homo-1656 significantly inhibited the expression of endogenous Rig-1 gene in CAL27 cells.

[0069] (5) siRNAs Dhx9-Homo / Mus-2, Dhx9-Homo / Mus-3, Dhx9-Homo / Mus-4, and Dhx9-Homo / Mus-5 significantly inhibited the expression of endogenous Dhx9 gene in A549 cells.

[0070] siRNAs GBP1-Homo-778, GBP1-Homo-1364, GBP1-Homo-1478, GBP1-Homo-1727, and GBP1-Homo-1180 significantly inhibited the expression of the endogenous Gbp1 gene in CAL27 cells.

[0071] The above experimental results show that the siRNA sequence provided by this invention can efficiently and specifically inhibit the expression of genes related to pyroptosis-related danger signal recognition and inflammasome assembly that it targets.

[0072] Example 2: Cell Culture and Transfection Cell culture: Human non-small cell lung cancer cell line A549, human skin squamous cell carcinoma cell line A431, and human tongue squamous cell carcinoma cell line CAL27 (all purchased from the American Type Culture Collection, ATCC) were cultured in DMEM high glucose medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco) and 1% penicillin-streptomycin (Gibco) in a constant temperature incubator at 37°C and 5% CO2.

[0073] Cell passage: When cells reach 80%-90% confluence, discard the culture supernatant and wash 1-2 times with phosphate-buffered saline (PBS, pH 7.4). Add 1 mL of 0.25% trypsin-EDTA solution (Gibco), mix well, and discard most of the trypsin. Incubate at 37°C for 1-2 minutes. Observe under a microscope after the cells become rounded and detached. Add 2-3 mL of complete culture medium to stop digestion and gently pipette to prepare a single-cell suspension.

[0074] Plating: Seed the cell suspension into 12-well plates, approximately 1 × 10⁶ cells per well. 5 Add 1 mL of complete culture medium to each cell and incubate at 37°C in a 5% CO2 incubator for 12-16 hours. Transfect the cells when the cell confluence reaches 50%-70%.

[0075] siRNA transfection: a. Dissolve the synthesized siRNA dry powder in DEPC-treated water (DEPC-H2O) to prepare a 20 μM stock solution, aliquot it, and store it at -20℃.

[0076] b. In a sterile 1.5 mL EP tube, add 1.5 μL of siRNA stock solution (20 μM) and 198.5 μL of Opti-MEM. ® I. Reduce serum in culture medium (Gibco), mix well, and use as mixture A.

[0077] c. In another sterile 1.5 mL EP tube, add 4 μL of Lipofectamine. ™ 2000 transfection reagent (Invitrogen) and 196 μL Opti-MEM ® Mix culture medium I gently, let stand at room temperature for 5 minutes, and this is mixture B.

[0078] d. Mix mixture A with mixture B, gently pipette to mix, and let stand at room temperature for 20 minutes to form siRNA-liposome complex (total volume 400 μL).

[0079] e. Remove the 12-well plate containing the cultured cells, discard the supernatant, and add 600 μL of fresh Opti-MEM to each well. ® I. Culture medium.

[0080] f. Add 400 μL of the siRNA-liposome complex to each well and gently mix. The total volume of each well is now 1 mL, and the final concentration of siRNA is 10 nM.

[0081] g. After incubating the 12-well plate in a 37°C, 5% CO2 incubator for 6 hours, discard the culture medium containing the transfection reagent, replace it with 1 mL of fresh complete culture medium, and continue incubation for 48 hours.

[0082] Example 3: Detection of gene silencing efficiency by real-time quantitative PCR (qRT-PCR) Total RNA extraction: a. 48 hours after transfection, discard the culture medium in the 12-well plate and wash the cells once with PBS buffer.

[0083] b. Add 1 mL of TRIzol to each well. ® Cells were lysed with the reagent (Invitrogen), and after repeated pipetting, the cells were transferred to 1.5 mL RNase-free centrifuge tubes.

[0084] c. Let stand at room temperature for 5 minutes to allow the nucleic acid-protein complex to completely dissociate.

[0085] d. Add 0.2 mL of chloroform, shake vigorously for 15 seconds, and let stand at room temperature for 3 minutes.

[0086] Centrifuge at 12,000 × g for 15 minutes at 4℃. After centrifugation, the sample separates into three layers: a lower red organic phase, a middle layer, and an upper colorless aqueous phase (RNA is mainly present in the aqueous phase).

[0087] f. Carefully aspirate the upper aqueous phase into a new RNase-free centrifuge tube, add an equal volume of 100% ethanol, and mix well.

[0088] g. Transfer the above mixture (not exceeding 700 μL each time) to an RNA purification column with a collection tube, centrifuge at 8,000 × g for 15 seconds at room temperature, and discard the waste liquid in the collection tube.

[0089] h. Add 700 μL of Buffer RW1 (Qiagen) to the purification column, centrifuge at 8,000 × g for 15 seconds, and discard the waste liquid.

[0090] i. Add 500 μL of Buffer RPE (Qiagen) to the purification column, centrifuge at 8,000 × g for 15 seconds, and discard the waste liquid. Repeat this step once.

[0091] j. Transfer the purification column to a new RNase-free 1.5 mL centrifuge tube, add 40 μL of RNase-free water (RNase-free H2O) to the center of the column membrane, let stand at room temperature for 2 minutes, centrifuge at 10,000 × g for 3 minutes at 4 °C to elute RNA.

[0092] k. Use a NanoDrop 2000 spectrophotometer (Thermo Fisher) to determine the concentration and purity of RNA (A260 / A280 ratio should be between 1.8 and 2.0).

[0093] Reverse transcription to synthesize cDNA: a. Using PrimeScript ™ RT Master Mix (TaKaRa) is used for reverse transcription.

[0094] b. Prepare the reaction mixture on ice (total volume 20 μL): 4 μL of 5× PrimeScript RT Master Mix, 1 μg of total RNA (calculate the volume according to the concentration), and bring the volume to 20 μL with RNase-free H2O.

[0095] c. After gently mixing, proceed with the reaction on a PCR instrument according to the following procedure: 37℃ for 15 minutes (reverse transcription reaction), 85℃ for 5 seconds (enzyme inactivation reaction), and store at 4℃.

[0096] d. The obtained cDNA can be used immediately for qPCR or stored at -20℃ for later use.

[0097] qPCR reaction: a. Using TB Green ® Premix Ex Taq ™ II (TaKaRa) on StepOnePlus ™ The PCR was performed on a Real-Time PCR system (Applied Biosystems).

[0098] b. Prepare the reaction mixture on ice (total volume 20 μL): 10 μL of TB Green Premix Ex Taq II (TliRNaseH Plus) (2×), 0.4 μL each of forward and reverse primers (10 μM), 0.4 μL of ROX Reference Dye (50×), 2 μL of cDNA template, and bring the RNase-free H2O to 20 μL.

[0099] c. Set up 3 replicates for each sample. Also set up a template-free negative control (NTC).

[0100] d. Reaction procedure: Step 1: Pre-denaturation, 95℃ for 30 seconds; Step 2: PCR reaction, 95℃ for 5 seconds, 60℃ for 30 seconds, for a total of 40 cycles; Step 3: Melting curve analysis, 95℃ for 15 seconds, 60℃ for 1 minute, 95℃ for 15 seconds.

[0101] e. The primer sequences used (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) are as follows: GAPDH (Internal Reference): Forward primer: 5'-GGAGCGAGATCCCTCCAAAAT-3' Reverse primer: 5'-GGCTGTTGTCATACTTCTCATGG-3' Aim2: Forward primer: 5'-GCTTGGACACTCAAGAAACC-3' Reverse primer: 5'-CACATCCACCTTTCCGTTCT-3' Nlrp10: Forward primer: 5'-GGAGACCTACCAGAGCATCAG-3' Reverse primer: 5'-CAGAGACAGATTTGAGCCGCT-3' Nod1: Forward primer: 5'-CCAGCCAGTCGGACTTATCC-3' Reverse primer: 5'-AACGGCTGCTCAGAACAGTT-3' Rig-1: Forward primer: 5'-CCAAACCCACATCTGTGGAA-3' Reverse primer: 5'-CGTACACAGGGCAAATGCAT-3' Dhx9: Forward primer: 5'-CAACCTGGAACACGAAATGC-3' Reverse primer: 5'-CTGCATCGTTGACCAAGTGA-3' Gbp1: Forward primer: 5'-TCCAGATGTCTTTCTCTCCCAG-3' Reverse primer: 5'-CTGAGCAGGTACAGGGATTTG-3' Data processing and statistical analysis: a. Obtain the Ct value for each sample using the software included with the qPCR instrument.

[0102] b. The relative expression level of the target gene was calculated using the 2-ΔΔCt method.

[0103] ΔCt = Ct (target gene) - Ct (internal reference gene GAPDH) ΔCt = ΔCt (siRNA treatment group) - ΔCt (negative control group) Relative expression level = 2 -ΔΔCt This value represents the fold change in the expression level of the target gene mRNA in the siRNA treatment group relative to the negative control group (transfected with non-target control siRNA).

[0104] c. The relative expression level of the negative control group was normalized to 1, and the siRNA treatment group was compared with it. The gene inhibition rate (%) was calculated as (1 - relative expression level of the treatment group) × 100%.

[0105] d. All data are expressed as mean ± standard deviation (Mean ± SD). Statistical analysis was performed using GraphPad Prism 9.0 software. One-way ANOVA was used for comparisons between groups, and p < 0.05 was considered statistically significant.

[0106] Example 4: Preparation of the pharmaceutical composition The effective siRNAs (e.g., AIM2-Homo-236, Dhx9-Homo / Mus-2, etc.) screened in this invention are mixed in an equimolar ratio as the active ingredient. The drug composition is prepared using lipid nanoparticle (LNP) delivery technology. The specific steps are as follows: Lipid phase preparation: Ionizable cationic lipids (such as SM-102), phospholipids (such as DSPC), cholesterol (Cholesterol), and polyethylene glycol-modified lipids (such as PEG2000-DMG) were dissolved in anhydrous ethanol at a molar ratio of 50:10:38.5:1.5.

[0107] Aqueous phase preparation: Dissolve the above-mentioned mixed siRNA in citrate buffer (pH 4.0) to make the siRNA concentration 0.5 mg / mL.

[0108] Microfluidic mixing: The lipid phase and aqueous phase are rapidly mixed at a volume ratio of 1:3 using a microfluidic device to form LNPs encapsulating siRNA.

[0109] Purification and concentration: Ethanol was removed using dialysis or tangential flow filtration (TFF) and the buffer was replaced with PBS (pH 7.4), while LNP was concentrated to the desired concentration.

[0110] Characterization: The particle size (typically less than 100 nm) and polydispersity index (PDI < 0.2) of LNPs were detected by dynamic light scattering (DLS), and the encapsulation efficiency (> 90%) of siRNA was determined by an encapsulation efficiency assay kit.

[0111] Aseptic filtration: The final formulation is sterilized by filtration using a 0.22 μm filter membrane to obtain the final product.

[0112] Example 6: Application in a mouse model of sepsis Animal model establishment: 6-8 week old male C57BL / 6J mice were selected and septicemia model was induced by intraperitoneal injection of lipopolysaccharide (LPS, 20 mg / kg) combined with D-galactosamine (D-GalN, 800 mg / kg).

[0113] Grouping and administration: Mice were randomly divided into three groups of 10 each: (1) Blank control group (injected with an equal volume of PBS); (2) Model group (negative control siRNA-LNP injected via tail vein after modeling); (3) Treatment group (siRNA-LNP prepared in Example 5 injected via tail vein after modeling, wherein the siRNA is a mixture of AIM2-Homo-236 and Dhx9-Homo / Mus-2, at a dose of 1 mg / kg).

[0114] Results: Serum IL-1β and IL-18 levels were measured at 6, 12, and 24 hours after drug administration (ELISA method), and mouse survival rates were observed. Expected results: Serum inflammatory cytokine levels in the treatment group were significantly lower than those in the model group, and the survival rate was significantly improved.

[0115] Through the above description of specific embodiments, those skilled in the art can clearly understand that the siRNA and its pharmaceutical composition provided by the present invention can effectively inhibit the expression of key genes for pyroptosis initiation and have broad clinical application prospects.

[0116] The implementation principle of this invention is as follows: This invention discloses siRNAs related to pyroptosis-related danger signal recognition and inflammasome assembly genes and their applications, belonging to the field of biomedical technology. This invention provides siRNA molecules targeting the Aim2, Nlrp10, Nod1, Rig-1, Dhx9, and Gbp1 genes, with their sense and antisense strand sequences shown in SEQ ID NO:1-44, respectively. This invention also provides pharmaceutical compositions containing the siRNAs and their application in the preparation of drugs for treating pyroptosis-related diseases. Experiments have demonstrated that the siRNAs of this invention can efficiently and specifically inhibit the mRNA expression levels of target genes, significantly reducing the initiation of pyroptosis. This invention provides a novel nucleic acid drug strategy for the treatment of pyroptosis-related diseases such as inflammatory diseases, autoimmune diseases, tumors, and neurodegenerative diseases, and has broad clinical application prospects.

[0117] The embodiments described herein are preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Therefore, all equivalent changes made in accordance with the structure, shape and principle of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A nucleic acid molecule, characterized in that, The nucleic acid molecule is a double-stranded RNA, comprising a sense strand and an antisense strand, the sequences of which are selected from any one of the following groups: a. The sense chain shown in SEQ ID NO:1 and the antisense chain shown in SEQ ID NO:2; b. The justice chain shown in SEQ ID NO:3 and the antisense chain shown in SEQ ID NO:4; c. The sense chain shown in SEQ ID NO:5 and the antisense chain shown in SEQ ID NO:6; d. The justice chain shown in SEQ ID NO:7 and the antisense chain shown in SEQ ID NO:8; e. The positive chain shown in SEQ ID NO:9 and the negative chain shown in SEQ ID NO:10; f. The justice chain shown in SEQ ID NO:11 and the antisense chain shown in SEQ ID NO:12; g. The justice chain shown in SEQ ID NO:13 and the antisense chain shown in SEQ ID NO:14; h. The positive chain shown in SEQ ID NO:15 and the negative chain shown in SEQ ID NO:16; i. The justice chain shown in SEQ ID NO:17 and the antisense chain shown in SEQ ID NO:18; j. The justice chain shown in SEQ ID NO:19 and the antisense chain shown in SEQ ID NO:20; k. The justice chain shown in SEQ ID NO:21 and the antisense chain shown in SEQ ID NO:22; l. The justice chain shown in SEQ ID NO:23 and the antisense chain shown in SEQ ID NO:24; m. The justice chain shown in SEQ ID NO:25 and the antisense chain shown in SEQ ID NO:26; n. The justice chain shown in SEQ ID NO:27 and the antisense chain shown in SEQ ID NO:28; o. The justice chain shown in SEQ ID NO:29 and the antisense chain shown in SEQ ID NO:30; p. The justice chain shown in SEQ ID NO:31 and the antisense chain shown in SEQ ID NO:32; q. The justice chain shown in SEQ ID NO:33 and the antisense chain shown in SEQ ID NO:34; r. The justice chain shown in SEQ ID NO:35 and the antisense chain shown in SEQ ID NO:36; s. the justice chain shown in SEQ ID NO:37 and the antisense chain shown in SEQ ID NO:38; t. The justice chain shown in SEQ ID NO:39 and the antisense chain shown in SEQ ID NO:40; u. The justice chain shown in SEQ ID NO:41 and the antisense chain shown in SEQ ID NO:42; v. The justice chain shown in SEQ ID NO:43 and the antisense chain shown in SEQ ID NO:

44.

2. A nucleic acid molecule according to claim 1, characterized in that, The double-stranded RNA has two protruding thymine deoxynucleotide (dTdT) modifications at its ends.

3. A pharmaceutical composition, characterized in that, It comprises the nucleic acid molecule as described in claim 1 or 2 and a pharmaceutically acceptable carrier.

4. The pharmaceutical composition according to claim 3, characterized in that, The pharmaceutically acceptable carrier is selected from liposomes, nanoparticles, viral vectors, or cationic polymers.

5. The use of a nucleic acid molecule according to claim 1 or 2 in the preparation of a drug for treating pyroptosis-related diseases.

6. The application according to claim 5, characterized in that, The pyroptosis-related diseases mentioned are inflammatory diseases, autoimmune diseases, tumors, or neurodegenerative diseases.

7. The application according to claim 6, characterized in that, The inflammatory disease is sepsis, acute pancreatitis, or inflammatory bowel disease.

8. A method for inhibiting the expression of Aim2, Nlrp10, Nod1, Rig-1, Dhx9, or Gbp1 genes in cells, characterized in that, This includes introducing a nucleic acid molecule as described in claim 1 or 2 into the cell.

9. A method for screening candidate drugs for treating pyroptosis-related diseases, characterized in that, This includes using a nucleic acid molecule as described in claim 1 or 2 as a positive control.

10. A reagent kit, characterized in that, It comprises a nucleic acid molecule as described in claim 1 or 2.

Images