Low temperature promoters and their use in degrading triclosan

Abstract

The present application relates to the technical field of genetic engineering, in particular to a low-temperature promoter and its application in degrading triclosan. The present application provides a promoter obtained by performing transcriptome sequencing and analysis under the condition of 15 DEG C cold shock, and further obtains a promoter with strong starting effect under low-temperature condition through further starting effect verification, and further constructs a genetic engineering bacterium for degrading triclosan under low temperature based on the promoter. The experimental results show that the genetic engineering bacterium constructed by the present application can completely degrade triclosan with an initial concentration of 10 mg / L within 48 h under the culture condition of 15 DEG C, and can grow with triclosan as the sole carbon source. The genetic engineering strain provided by the present application can realize rapid and efficient bioremediation of new pollutants under low-temperature condition, which can reduce energy consumption and has good economic and environmental benefits.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to cryogenic promoters and their application in the degradation of triclosan. Background Technology

[0003] Microbial metabolism is one of the core pathways for removing triclosan from the environment. Existing studies have reported many triclosan-degrading bacteria, but most strains have low degradation efficiency, cannot completely mineralize, or have poor stress resistance, making it difficult to meet the needs of practical applications. The development of synthetic biology has provided new ideas for constructing highly efficient degrading engineered strains. The applicant team previously used the chlorophenol degradation model strain P. knackmussii B13 as the chassis cell and heterologously expressed the triclosan dioxygenase gene tcsAB and the 2,4-dichlorophenol monooxygenase gene tfdB to construct an engineered strain that can rapidly degrade triclosan at 30℃ (Yin, YR; Ren, H.; Wu, H.; Lu, ZM Triclosan dioxygenase: A novel two-component Rieskenonheme iron ring-hydroxylating dioxygenase initiates triclosan degradation. Environmental Science & Technology, 2024, 58(31), 13833-13844.). However, since the global average water temperature is around 15°C, constructing engineered strains that can efficiently degrade new pollutants under low-temperature conditions helps reduce energy consumption and costs, making them easier to promote.

[0004] Low temperature is a key environmental factor limiting the efficiency of microbial degradation. Under low temperature conditions, the metabolic activity of microorganisms decreases, and the catalytic rate of key enzymes drops significantly. In low-temperature environments, the host microorganism's own transcriptional system undergoes adaptive adjustments, and the promoters of certain endogenous genes are activated to express adaptive factors such as cold shock proteins. These strong low-temperature promoters can theoretically be used to drive the efficient expression of heterologous degradation genes, thereby enhancing the low-temperature degradation capacity of engineered strains at the transcriptional level. However, no studies have yet systematically extracted and validated strong low-temperature promoters from the transcriptome of host bacteria (such as *P. knackmussii* B13) and applied them to the construction of triclosan-degrading engineered strains. Summary of the Invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide a low-temperature promoter and its application in the degradation of triclosan. The present invention provides transcriptomic sequencing and analysis of *P. knackmussii* B13 under 15°C cold shock conditions to screen for genes highly expressed at 15°C and predict their promoter regions; by constructing a reporter vector, the activity of each promoter under low-temperature conditions is measured; the screened promoters are ligated with the triclosan dioxygenase gene *tcsAB* and the 2,4-dichlorophenol monooxygenase gene *tfdB* to construct an expression vector, which is then introduced into chassis cells of *P. knackmussii* B13 to obtain a genetically engineered strain. The engineered strain described in this invention can efficiently degrade triclosan at 15°C, with a degradation efficiency superior to the control strain using exogenous promoters, providing a new strain resource and technical approach for the bioremediation of new pollutants under low-temperature conditions.

[0006] This invention provides a promoter having:

[0007] (1) A nucleotide sequence as shown in SEQ ID NO:1; and / or

[0008] (2) A nucleotide sequence having the nucleotide sequence shown in (1) modified, substituted, deleted and / or added to one or more bases; and / or

[0009] (3) A sequence having at least 80% homology to the nucleotide sequence shown in (1); and / or

[0010] (4) Complementary sequences to sequences shown in (1), (2) or (3).

[0011] This invention provides the application of the promoter described above in regulating the expression level of target genes at low temperatures.

[0012] In some embodiments, the low temperature includes 4~15°C.

[0013] In some embodiments, the target gene includes the following ① and / or ②:

[0014] ① tcsAB derived from Sphingopyxis sp. MC1;

[0015] ② tfdB derived from Sphingomonas sp. strain YL-JM2C.

[0016] In some embodiments, the target gene may further include a gene encoding a fluorescent protein.

[0017] The present invention provides an expression unit comprising the aforementioned promoter and target gene.

[0018] In some embodiments, the target gene includes the following ① and / or ②:

[0019] ① tcsAB derived from Sphingopyxis sp. MC1;

[0020] ② tfdB derived from Sphingomonas sp. strain YL-JM2C.

[0021] In some embodiments, the tcsAB has a nucleotide sequence as shown in SEQ ID NO:12;

[0022] The tfdB has a nucleotide sequence as shown in SEQ ID NO:13.

[0023] In some embodiments, it includes a promoter, the tcsAB, and the tfdB connected in sequence.

[0024] The present invention provides a plasmid vector comprising the promoter or the expression unit described herein.

[0025] This invention provides genetically engineered bacteria, including the aforementioned plasmid vector; and / or

[0026] Its genome integrates the aforementioned promoter or the aforementioned expression unit.

[0027] In some embodiments, the basal fungus is P. knackmussii B13.

[0028] This invention provides at least one of the following (i) to (iv) applications in the low-temperature degradation of triclosan:

[0029] i. The aforementioned promoter;

[0030] ii. The aforementioned expression unit;

[0031] iii. The plasmid vector;

[0032] iv. The genetically engineered bacteria.

[0033] In some embodiments, the low temperature includes 4~15°C.

[0034] This invention provides a method for low-temperature degradation of triclosan, based on the aforementioned genetically engineered bacteria.

[0035] In some embodiments, the low temperature includes 4~15°C.

[0036] This invention provides promoters obtained through transcriptomic sequencing and analysis under 15°C cold shock conditions. Further verification of the promoter performance revealed a promoter with strong initiation efficiency at low temperatures. Based on this promoter, a genetically engineered bacterium capable of degrading triclosan at low temperatures was constructed. Experimental results show that the genetically engineered bacterium constructed in this invention can completely degrade an initial concentration of 10 mg / L of triclosan within 48 hours under 15°C culture conditions, and can grow using triclosan as the sole carbon source. The genetically engineered strain provided by this invention enables rapid and efficient bioremediation of new pollutants under low-temperature conditions, reducing energy consumption while achieving both economic and environmental benefits. Attached Figure Description

[0037] Figure 1 Flowchart illustrating the construction of low-temperature triclosan-resistant engineered strains;

[0038] Figure 2 Schematic diagram showing the construction of fluorescent reporter vectors and strains containing different promoters;

[0039] Figure 3 The activity of different promoters at 15℃ is shown.

[0040] Figure 4 This diagram illustrates the construction of triclosan-degrading engineered strains containing different promoters.

[0041] Figure 5 The degradation activity of triclosan-degrading engineered strains containing different promoters against triclosan was determined at 15°C.

[0042] Figure 6 The pBBR-P4-tcsAB-tfdB spectrum of the expression vector is shown.

[0043] Figure 7 The degradation curve of triclosan by the engineered strain P. knackmussii B13-pBBR-P4-tcsAB-tfdB at 15℃ is shown.

[0044] Figure 8 The growth curve of engineered strain P. knackmussii B13-pBBR-P4-tcsAB-tfdB at 15℃ with triclosan as the sole carbon source is shown. Detailed Implementation

[0045] This invention provides a cryogenic promoter and its application in the degradation of triclosan. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art will clearly be able to modify or appropriately alter and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0046] This invention provides a method for screening the endogenous, cryogenically resistant promoter of *P. knackmussii* B13 based on transcriptomics, and for constructing a cryogenically efficient triclosan-degrading engineered strain. Compared with existing enzyme modification strategies, this invention starts from the transcriptional regulation level, utilizing the host bacterium's own cryogenic response elements, and has advantages such as short screening cycle, good host adaptability, and no need to introduce exogenous regulatory proteins. It provides a new technical pathway and strain resource for the bioremediation of new pollutants under cryogenic conditions.

[0047] The low-temperature-resistant triclosan-degrading engineered strain provided by this invention is derived from P. knackmussii B13. P. knackmussii B13 is deposited at the BCCM Collection Center in Belgium, accession number LMG 23759. The P. knackmussii B13 used in this invention was purchased from this collection center on April 25, 2023.

[0048] Furthermore, this invention screens for endogenous, cryogenically resistant promoters of *P. knackmussii* B13 using transcriptomics analysis. The specific steps are as follows: *P. knackmussii* B13 is subjected to 15°C cold shock treatment for different durations, total RNA is extracted and transcriptome sequencing is performed; by comparing gene expression levels in the control group and different treatment groups, genes highly expressed under 15°C conditions are screened; their promoter regions are amplified, and using the broad-host expression vector pBBR1MCS-2 as a backbone, candidate promoters are inserted upstream of the red fluorescent protein gene *mcherry* to construct reporter vectors containing different promoters, which are then introduced into *P. knackmussii* B13; after culturing at 15°C, the fluorescence intensity of *mCherry* is measured to characterize the expression activity of each promoter under low-temperature conditions.

[0049] Furthermore, different promoters were inserted upstream of the tcsAB gene and linked with the tfdB gene, and then inserted together into the broad-host expression vector pBBR1MCS-2 to obtain expression vectors containing different promoters. These vectors were then introduced into P. knackmussii B13 to construct a series of genetically engineered strains, and their triclosan degradation activity at 15℃ was measured.

[0050] Among the aforementioned engineered strains, *P. knackmussii* B13-pBBR-P4-tcsAB-tfdB completely degraded 10 mg / L triclosan within 48 h at 15°C, a faster degradation rate than the control strain with the inserted exogenous promoter *Plac*. Furthermore, this engineered strain could grow using triclosan as its sole carbon and energy source. Notably, this invention also discovered that strong promoters selected solely through reporter gene screening do not always linearly correspond to the most efficient expression of metabolic pathways. An optimal transcription-translation coupling or metabolic load balance may exist between promoter P4 and the degrading gene, resulting in the unexpected technical effects achieved by P4 in this invention.

[0051] The test materials used in this invention are all common commercial products and can be purchased on the market.

[0052] The culture medium and reagent formulations used in the examples are as follows:

[0053] LB liquid medium: tryptone: 10.0 g / L; yeast extract: 5.0 g / L; NaCl: 10.0 g / L.

[0054] LB solid medium: tryptone: 10.0 g / L; yeast extract: 5.0 g / L; NaCl: 10.0 g / L; agar: 2.0 g / 100 mL.

[0055] Inorganic salt liquid culture medium: (NH4)2SO4: 0.66 g / L; MgSO4·7H2O: 1.00 g / L; CaCl2·2H2O: 0.015 g / L; K2HPO4: 0.46 g / L; KH2PO4: 2.36 g / L; Trace elements: 1 mL / L.

[0056] Trace element stock solution: FeSO4·7H2O: 0.5 g / L; ZnSO4·7H2O: 0.4 g / L; MnSO4·H2O: 0.02 g / L; H3BO3: 0.015 g / L; NiCl2·6H2O: 0.01 g / L; EDTA: 0.25 g / L; CoCl2·6H2O: 0.05 g / L; CuSO4·2H2O: 0.005 g / L. Store at 4℃.

[0057] 50 mg / mL Kanamycin (Km): Dissolve 0.5 g Km in sufficient water, bring the volume to 10 mL, filter sterilize using a 0.22 μm sterile filter, and dispense into 1.5 mL EP tubes. Store at -20°C.

[0058] 75 mM 2,6-Diaminopimelic acid (2,6-DAP): Dissolve 0.1426 g of 2,6-DAP in sufficient water, bring the volume to 10 mL, filter sterilize using a 0.22 μm sterile filter, and dispense into 1.5 mL EP tubes. Store at -20°C.

[0059] 10 g / L Triclosan Stock Solution: Dissolve 1.0 g of triclosan in sufficient methanol, bring the volume to 100 mL, filter and sterilize using a 0.22 μm sterile filter, and dispense into 1.5 mL EP tubes. Store at 4 °C.

[0060] The present invention will be further illustrated below with reference to the embodiments.

[0061] Example 1: Screening of endogenous cryogenic promoters of P. knackmussii B13 based on transcriptomics sequencing

[0062] P. knackmussii B13 was inoculated into LB medium and cultured at 30°C and 200 rpm until mid-logarithmic growth phase. Subsequently, the bacterial culture was transferred to 1.5 mL EP tubes and subjected to cold shock treatment in a 15°C metal bath, with the non-cold shock treatment group serving as a control. Three biological replicates were set up for each treatment group. Samples were taken from the treatment and control groups at the non-cold shock (control sample), and at 10 min and 30 min of cold shock, respectively. Immediately after sampling, the cells were centrifuged at 4°C and 15,000 × g for 2 min to collect the bacterial cells. After centrifugation, the supernatant was removed, and the bacterial cells were flash-frozen in liquid nitrogen and then stored at -80°C for later use.

[0063] Bacterial RNA extraction and transcriptome sequencing were outsourced to Beijing Novogene Technology Co., Ltd. After removing Illumina adapter sequences and low-quality bases, high-quality RNA-Seq data were aligned, and gene expression abundance was quantified using the FPKM (Fragments Per Kilobase of transcript per Million mapped reads) method.

[0064] Gene expression levels were ranked according to FPKM values, and the top 10 genes with the highest FPKM values ​​in the control group, the 15℃ cold shock for 10 min group, and the cold shock for 30 min group were selected. The spacer sequences between these genes and their upstream genes were used as candidate promoter sequences, resulting in 10 candidate promoter sequences, as shown in Table 1. The 10 promoter sequences are shown in SEQ ID NO: 1~10.

[0065] Table 1. Ten highly expressed genes and candidate promoters screened based on transcriptomics sequencing

[0066]

[0067] The nucleotide sequences of the 10 promoters are shown below:

[0068] P4 promoter:

[0069] ttccgcagaccttgcgggccatttcgcaaagaatggcccgcaagggtggacaggcaaaaaaaaaccacgtaaaaacacttccgaacagtt ttttgtcccgcctcgactgttccactccccccactgccgccctggcagaccccgctaaaaaatccgaatttcccgccaactgcgcaccac aatggagcgcagcggtacagttcgccccaaaatcgccattacagttcgccaaaacaattcgctgacgctatttaattcagagcaactgtacctgtatcagctgaccaaaaagtcagaagatatgtttcaacaacttccgtaacccactgcccgccacaagcgggaaggacgaaaatc (SEQ ID NO:1)

[0070] Promoter P1:

[0071] tgcactcgccttcgatgaaaggcgcccagtgtagcaagccggcaccggccgatttccccccggaagtcttaagccgatgaatccgttgaaaaaaagatttgcgttcggggaattgtttgagtaaagtgcgcgcctcgacagacacagcgctgtcgagattctggtgaggtgtccgagcggttgaaggagcacgcctggaaagtgtgtatacgggaaaccgtatcgagggttcgaatccctccctcaccgccagatcaaaagcccggctaactgatgaagttagcctagccgggctttttcgttctcgagccattacttccccgatacctgcaagttcggattgaactaattcgaagatggcgatcaagccacttgctggccagaaaacagcactccaccccctccgccgagcactcgcttgagccgccctaggactcgcccgccagcgcaaccgtttcataaattgaacactttttgtgcaaatgcatgacgaaactagtgcaaagttcgctcaagcataaaaaaaattgctctacttgcgcttggtcagtttacttactacaagtaatgagtactatgtagtccggctaatttcccagtcatgggagattgctttaatggaaatgtccaccttaaggggaacacg (SEQ ID NO:2)

[0072] Promoter P2:

[0073] cgggctcttctgaatcgtttggcggatgcgcagagactagcttgtgacgtccttatggcctagtgctggcgcattttcgcagtcgcgtctttactcggtaattgtcggttcagacctatctcagaggagagactgatat (SEQID NO:3)

[0074] Promoter P3:

[0075] aagatttcccgagccgaagcccttttcagcgggaccgcctgcggcccctcgcatccgtggtcgcaccacggacaccctaaataccaaagccttccacaacgctgcgacccaaggccgcaacacgaggcccattcgtcgggatgagagtttctctcaactaccgacatattcatttaccactccgagcaaacccgcagcctggcaggcctgccgtccggcgaacggttttcaggccgggaaaacttatggcctgaaccccagaagagttacgtccttatgacaaaacggttgttcacagtgcctgacgccttggtttagaactcagcttaacccgtcgccgcaaaggtgtcgggcggggtcagtcacgccggcaacagaccccataggcggaaaccttccgcctggcctccctggggggccaacgggacataacagtcaacaagtgagggcaacaccct (SEQ ID NO:4)

[0076] Promoter P5:

[0077] gtggcagcctccaagcgatgccgtcagggagtatagaccgcagtagaaatgtggctttcggtgtcccacaagcggacgagcggttcgttcagccgaggttcagagagctgacaggttgcgttcagtcgcccccgcttaacctgttctccgtcaactacttacacacctctctgacggagaatgacg (SEQ ID NO:5)

[0078] Promoter P6:

[0079] ttcgccgctgagcaaaaggccgccccgggaaaccgcggcggcctttttcatggtttttccttcggacctgtaggagcgcgccatgcgcgcgaatcgcggccatgggccgctcctacggggaaaccgtgcgatccgtgggcaaattcgctcctacagacggtgtcctactattgaccccgcgcaagggaatctcccggagacagcgctagagtcaactcaccaagccactcattgagggaaacatc (SEQ ID NO:6)

[0080] Promoter P7:

[0081] acttgatccagatcagacgccgggcccaggcaggcgcgtagtcttgcaatcaaggagaaggtagcgagggcggagagtgggacgccgagctactctactctgagggcgacccggaacatcgggtcgcccgacttctccaccgcacaggaggcacttc (SEQ ID NO:7)

[0082] Promoter P8:

[0083] ttgggtaaatgttgtctctctaattcgcgagttctgataaacttgcgcgcaagttgcttgtcctgatttttgtcgatggcttgcagcttactgaccaccaagatggggatttaacgg (SEQ ID NO:8)

[0084] Promoter P9:

[0085] gaacaccgaaagcctgaaagtcccggcagccagccgaagcccccgacttgtgccgccttccggcaggcggcaaagcctctctggatagcagcccaggccgcggcgcagacgctgaccgccgggcctttttcgcttgcactggcctagtgccagttttacccttcccttcttctgaaggaacgttcccacaaggagtccatt (SEQ ID NO:9)

[0086] Promoter P10:

[0087] gggggtgtgactccagatacatcgcgaaggcggccattctaacggctgcccgggaaatccgcgaccgctgccgccgagcgcgccacggaactgttgaatagccaagccaatacattcggatgttta acttaattacaacgaatgacgctgacgattcattaattcccggtttactccaagtaatcaactgactattattgagagtaaaacttccctccaacgccgaacctcaagataaggtaccccaa (seq ID NO:10)

[0088] Example 2: Activity determination of the intrinsic low-temperature resistant promoter of P. knackmussii B13

[0089] The promoter from *P. knackmussii* B13 and the red fluorescent protein gene *mcherry* were synthesized in vitro, and codon optimization of *mcherry* was performed using *Pseudomonas* as the host. The *mcherry* gene sequence is shown in SEQ ID NO: 11. Gene synthesis was commissioned to Nanjing GenScript Biotech Co., Ltd.

[0090] The nucleotide sequence of the gene mcherry is shown below:

[0091] (SEQ ID NO: 11)

[0092] After gene synthesis, the promoter was linked to the mcherry gene using homologous recombination and inserted into the broad-host expression plasmid pBBR1MCS-2. After successful construction, the plasmid was extracted using a plasmid extraction kit. All inserted fragments were sequenced to confirm the absence of mutations; sequencing was commissioned to Beijing Qingke Biotechnology Co., Ltd.

[0093] The plasmid was then transformed into Escherichia coli WM3064 competent cells. After colonies grew, PCR verification was performed using 2×T5 Super PCR Mix and the primers shown in Table 2. After confirming the successful introduction of fluorescent reporter vectors containing different promoters into E. coli WM3064, the E. coli WM3064 cells containing the reporter vector were cultured in LB medium containing 50 mg / L Km and 0.3 mM 2,6-DAP to late logarithmic or stationary phases. Simultaneously, P. knackmussii B13 was cultured to the logarithmic or stationary phases. After washing twice with LB medium, the E. coli WM3064 cells containing the reporter vector and P. knackmussii B13 were mixed at a volume ratio of 2:1 and dropped onto LB solid medium containing 0.3 mM 2,6-DAP. The mixture was incubated overnight at 30°C. The mixed cells were washed off with LB medium twice, and then cultured at 10... -1 and 10 -2 Diluted and spread onto LB solid medium containing 50 mg / L Km, and incubated overnight at 30°C.

[0094] After single colonies grew on the plates, multiple single colonies were picked and transferred to LB liquid medium containing 50 mg / L Km. After overnight incubation at 30°C and 200 rpm, the bacterial culture was used to perform PCR using 2 × T5 Super PCR Mix and the primers shown in Table 2 to verify whether the fluorescent reporter vector had been introduced into *P. knackmussii* B13. All PCR products were sequenced to confirm that no mutations were introduced; sequencing was commissioned to Beijing Qingke Biotechnology Co., Ltd. The construction process for fluorescent reporter strains containing different promoters is as follows: Figure 2 As shown.

[0095] Table 2. Primer sequences for constructing fluorescent reporter vectors

[0096]

[0097] The strains *P. knackmussii* B13 containing different promoter fluorescent reporter vectors were inoculated into LB liquid medium containing 50 mg / L Km and cultured at 15°C and 150 rpm for 48 h. After culture, 1 mL of bacterial culture was transferred to a 1.5 mL EP tube and centrifuged at 15,000 × g for 1–2 min to collect the bacterial cells. The supernatant was discarded, and the bacterial cells were resuspended in sterile PBS. 200 μL of the resuspended bacterial culture was transferred to a 96-well plate, and the OD of each sample was measured using a microplate reader. 600The fluorescence intensity and mCherry fluorescence value were measured. The fluorescence detection wavelengths were 587 nm for excitation and 610 nm for emission. The fluorescence intensity was calculated as follows: Fluorescence intensity = Fluorescence value / OD. 600 value.

[0098] This embodiment measured the fluorescence intensity of the red fluorescent protein mCherry driven by different promoters, such as... Figure 3 As shown in the figure. The results indicate that all endogenous promoters are active within the tested range at 15℃; among them, promoter P1 mediated the highest fluorescence intensity, indicating that it has the strongest promoter activity.

[0099] Example 3: Construction of a low-temperature resistant triclosanthemic biodegradation engineered strain

[0100] The fluorescent reporter vectors containing different promoters constructed in Example 2 were linearized using high-fidelity enzyme 2 × Phanta Flash Master Mix and primers shown in Table 3, respectively, to amplify the pBBR1MCS-2 backbone and promoter. The circular plasmid was then removed using the restriction endonuclease Dpn I. The triclosan dioxygenase gene tcsAB from *Sphingopyxis* sp. MC1 (GenBank accession number: GCA_000371385) and the 2,4-dichlorophenol monooxygenase tfdB from *Sphingomonas* sp. strain YL-JM2C (GenBank accession number: GCA_000439355.1) were synthesized in vitro. The sequences of the tcsAB and tfdB genes are shown in SEQ ID NO:12-13. Gene synthesis was commissioned to Nanjing GenScript Biotech Co., Ltd.

[0101] The nucleotide sequence of the tcsAB gene is shown below:

[0102]

[0103] The nucleotide sequence of the tfdB gene is shown below:

[0104]

[0105] After gene synthesis, the tcsAB and tfdB genes were amplified using the primers shown in Table 3, and then ligated to plasmid backbones containing different promoters using homologous recombination. After successful construction, plasmids were extracted using a plasmid extraction kit. All inserted fragments were sequenced to confirm that no mutations were introduced; sequencing was commissioned to Beijing Qingke Biotechnology Co., Ltd.

[0106] Subsequently, the plasmid was transformed into E. coli WM3064 competent cells. After colonies grew, PCR verification was performed using 2 × T5 Super PCR Mix and the primers shown in Table 3. After confirming the successful introduction of expression vectors containing different promoters into E. coli WM3064, E. coli WM3064 containing different vectors and P. knackmussii B13 were conjugated according to the method shown in Example 2, and PCR was used to verify whether the expression vectors containing different promoters were introduced into P. knackmussii B13. All PCR products were sequenced to confirm that no mutations were introduced; sequencing was commissioned to Beijing Qingke Biotechnology Co., Ltd. The construction process of triclosan-degrading engineered strains containing different promoters is as follows: Figure 4 As shown. After screening and verification, among the 10 candidate promoters, 7 engineered strains containing promoters P1, P2, P3, P4, P5, P7, and P8 were successfully obtained, which can stably inherit and degrade genes.

[0107] Table 3. Primer sequences for expression vector construction

[0108]

[0109] After obtaining engineered bacterial strains with different promoters, they were activated using LB liquid medium containing Km. One mL of the activated bacterial culture was taken, washed three times with sterile PBS, and then resuspended in 1 mL of sterile PBS. The cells were then inoculated into an inorganic salt solution containing 10 mg / L triclosan and cultured at 15°C and 150 rpm. 500 μL of culture was collected at 0 h and 48 h to detect the triclosan concentration in the medium. Each experiment was performed in triplicate. The culture was mixed with an equal volume of methanol, centrifuged at 15,000 × g for 10 min, and the supernatant was pretreated through a 0.45 μm filter before detection. The triclosan concentration was detected using high-performance liquid chromatography (HPLC) (Agilent Technologies, Germany). The detection conditions for triclosan were as follows: mobile phase: 76% methanol + 24% water; chromatographic column: Eclipse XDB-C18 column (5 μm 4.6 × 250 mm); detection wavelength: 281 nm; column temperature: 30℃; flow rate: 2.0 mL / min; and injection volume: 20 μL.

[0110] Figure 5 The results showed that among the candidate promoters, the engineered strains driven by promoter P4 (expression vector plasmid map as shown) Figure 6 (As shown) It has the ability to degrade triclosan under low temperature conditions, and it can degrade triclosan with an initial concentration of 10 mg / L within 48 h.

[0111] Example 4: Determination of triclosan by engineered strain P. knackmussii B13-pBBR-P4-tcsAB-tfdB under low temperature conditions

[0112] The obtained engineered strain *P. knackmussii* B13-pBBR-P4-tcsAB-tfdB was activated using LB liquid medium containing Km. One mL of the activated bacterial culture was washed three times with sterile PBS, and then resuspended in 1 mL of sterile PBS. The cells were then inoculated into inorganic salt solutions containing 50 mg / L Km and 10 mg / L triclosan, respectively, and cultured at 15°C and 150 rpm. 500 μL of culture was collected every 12 h for OD detection. 600 For the concentration of triclosan, each experiment was performed in triplicate. The culture used to determine triclosan concentration was mixed with an equal volume of methanol, centrifuged at 15,000 × g for 10 min, and the supernatant was pretreated through a 0.45 μm filter before detection. Triclosan concentration was detected using high-performance liquid chromatography (HPLC). Detection conditions were the same as in Example 3. Simultaneously, the strain *P. knackmussii* B13-pBBR containing the empty vector pBBR1MCS-2 and the strain *P. knackmussii* B13-pBBR-Plac-tcsAB-tfdB, constructed in previous studies, were used as controls.

[0113] The results showed that the engineered strain P. knackmussii B13-pBBR-P4-tcsAB-tfdB, under culture conditions at 15℃, could completely degrade triclosan at an initial concentration of 10 mg / L within 48 h. Figure 6 ), and can grow using triclosan as the sole carbon source ( Figure 7 In contrast, when strain P. knackmussii B13-pBBR-Plac-tcsAB-tfdB was cultured under the same conditions for 60 h, residual triclosan was still detected in the culture medium. Figure 6The above results indicate that promoter P4 exhibits superior transcriptional stability and sustained expression capacity under low-temperature conditions, thereby endowing the engineered strain with more efficient triclosan degradation performance under low-temperature conditions. The engineered strain constructed in this invention is suitable for the treatment of triclosan pollution under low-temperature conditions, and is particularly suitable for low-temperature wastewater treatment systems that operate continuously for extended periods.

[0114] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A promoter, characterized in that, It has the following characteristics: (1) A nucleotide sequence as shown in SEQ ID NO:1; and / or (2) A nucleotide sequence having the nucleotide sequence shown in (1) modified, substituted, deleted and / or added to one or more bases; and / or (3) A sequence having at least 80% homology to the nucleotide sequence shown in (1); and / or (4) Complementary sequences to sequences shown in (1), (2) or (3).

2. The application of the promoter according to claim 1 in regulating the expression level of the target gene at low temperature.

3. The application according to claim 2, characterized in that, The low temperature range includes 4~15℃.

4. An expression unit, characterized in that, It includes the promoter and target gene as described in claim 1.

5. The expression unit according to claim 4, characterized in that, The target gene includes the following ① and / or ②: ① tcsAB derived from Sphingopyxis sp. MC1; ② tfdB derived from Sphingomonas sp. strain YL-JM2C; The tcsAB has a nucleotide sequence as shown in SEQ ID NO:12; The tfdB has a nucleotide sequence as shown in SEQ ID NO:

13.

6. A plasmid vector, characterized in that, It includes the promoter as described in claim 1 or the expression unit as described in claim 4 or 5.

7. Genetically engineered bacteria, characterized in that, Including the plasmid vector of claim 6; and / or Its genome is integrated with the promoter as described in claim 1 or the expression unit as described in claim 4 or 5.

8. The genetically engineered bacteria according to claim 7, characterized in that, Its basal fungus is P. knackmussii B13.

9. At least one of the following applications (i-iv) in the low-temperature degradation of triclosan: i. The promoter as described in claim 1; ii. The expression unit as described in claim 4 or 5; iii. The plasmid vector according to claim 6; iv. The genetically engineered bacteria as described in claim 7 or 8.

10. A method for low-temperature degradation of triclosan, characterized in that, Degradation based on the genetically engineered bacteria described in claim 7 or 8.

Images