Potato long non-coding rna stlinc1624 mutants, methods and uses

CN122521689APending Publication Date: 2026-08-07SHANXI AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610984194.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-03
Publication Date
2026-08-07

Smart Images

  • Figure CN122521689A_ABST
    Figure CN122521689A_ABST
Patent Text Reader

Abstract

The application discloses a potato long-chain non-coding RNA StLINC1624 mutant, a method and application, wherein according to a sequence of potato long-chain non-coding RNA StLINC1624 (gene name XLOC_025937), multiple sgRNAs are designed in a binding region of the long-chain non-coding RNA StLINC1624 and miR156e and another conserved segment; a set of CRISPR / Cas9 multi-target systems suitable for dicotyledonous plants is used after being modified and optimized; multiple sgRNAs are simultaneously expressed; and high-efficiency site-specific knockout of the long-chain non-coding RNA StLINC1624 is realized in potatoes. The application promotes the progress of potato molecular breeding of anthocyanin traits, and has great guiding significance for cultivating new potato varieties with high anthocyanin and excellent traits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a CRISPR / Cas9-based potato long non-coding RNA StLINC1624 mutant, its method, and its application. Background Technology

[0002] Potatoes, an annual plant belonging to the Solanaceae family and the Solanum genus, are the fourth largest staple food after rice, wheat, and corn, playing an increasingly prominent role in agriculture and industry, and also contributing significantly to national food security. The edible part of the potato is the tuber, which serves as a nutrient storage and asexual reproduction organ. The tuber is rich in high-quality starch, protein, vitamin C, carotenoids, and inorganic salts, not only meeting basic human needs but also possessing medicinal value, such as protecting the cardiovascular system and preventing stroke. Anthocyanins, as core products in the phenylpropanoid metabolic pathway in plants, endow potato tubers with significant antioxidant, antitumor, and lipid metabolism-regulating functions through various mechanisms, including free radical scavenging and metal ion chelation. Furthermore, anthocyanins play a crucial role in plant stress responses, enhancing the plant's ability to scavenge reactive oxygen species (ROS), stabilizing cell membrane structure, and activating stress signaling pathways, thereby influencing the plant's response to abiotic stresses such as high temperature and drought. A compact plant type with fewer branches can improve ventilation and light penetration within the plant population, reduce redundant vegetative growth in the above-ground parts, and optimize the distribution of photosynthetic products to the tubers. This not only ensures stable yields but also effectively prevents lodging caused by excessive vegetative growth in the later stages of growth.

[0003] Genome editing technology is an emerging genetic engineering technique that involves targeted modification and alteration of DNA sequences at the genome level. It plays a crucial role in gene function research, plant genetic improvement, and molecular breeding. The CRISPR / Cas9 system, composed of sgRNA (Short guide RNA) and Cas9 nuclease, has become the most popular gene editing technology due to its advantages such as high efficiency, simplicity, low cost, and wide applicability.

[0004] Long non-coding RNAs are widely distributed in eukaryotes and participate in a variety of important biological processes. These RNA molecules can influence gene expression at multiple levels, including transcriptional regulation, post-transcriptional processing, and epigenetic modification, through interactions with macromolecules. Summary of the Invention

[0005] Building upon existing research techniques, this invention aims to provide a CRISPR / Cas9-based gene editing vector for the potato long non-coding RNA StLINC1624, its construction method, and gene editing materials, offering valuable germplasm resources for potato breeding. This invention designs multiple sgRNAs in the binding region of the long non-coding RNA StLINC1624 (gene name XLOC_025937) to miR156e and another conserved segment. Using a modified and optimized CRISPR / Cas9 multi-target system suitable for dicotyledonous plants, multiple sgRNAs are simultaneously expressed to achieve efficient site-specific knockout of this long non-coding RNA in potatoes.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows: A CRISPR / Cas9-based long non-coding RNA mutant of potato, StLINC1624, has the sequence shown in SEQ ID NO.1.

[0007] A gRNA for editing potato long non-coding RNA StLINC1624, comprising a mutant of the long non-coding RNA StLINC1624, wherein the gRNA sequence comprises gRNA1 and gRNA2, the nucleotide sequence of gRNA1 is shown in SEQ ID NO.2, and the nucleotide sequence of gRNA2 is shown in SEQ ID NO.3.

[0008] The application of the gRNA in constructing potato gene-editing materials, wherein the gene-editing materials include recombinant bacteria targeting potato long non-coding RNA StLINC1624, recombinant vectors, potato transgenic systems, and tissues.

[0009] A CRISPR / Cas9 system comprising the gRNA, a mutant potato long non-coding RNA StLINC1624.

[0010] Application of potato long non-coding RNA StLINC1624 or related biological materials in anthocyanin synthesis and accumulation.

[0011] A method for constructing a potato long non-coding RNA StLINC1624 CRISPR / Cas9 gene editing vector includes the following steps: Based on the CRISPR / Cas9 system, a gRNA was designed targeting the potato long non-coding RNA StLINC1624 sequence. Primers were designed for this gRNA sequence, and PCR amplification was performed using the pCBC-DTDT2 backbone vector as a template. The gRNA was then ligated to the pHSE401 expression vector to obtain the potato long non-coding RNA StLINC1624 CRISPR / Cas9 gene editing vector.

[0012] A method for obtaining potato plants with the long non-coding RNA StLINC1624 CRISPR / Cas9 gene-edited, comprising the following steps: A gRNA was designed based on the CRISPR / Cas9 system targeting the potato long non-coding RNA StLINC1624 sequence. Primers were designed for this gRNA sequence, and PCR amplification was performed using the pCBC-DTDT2 backbone vector as a template. The gRNA was then ligated to the pHSE401 expression vector to obtain a CRISPR / Cas9 gene editing vector for the potato long non-coding RNA StLINC1624. This vector was then transformed into potatoes to achieve site-specific knockout of the potato long non-coding RNA StLINC1624, thereby obtaining potato mutant plants.

[0013] A method for increasing anthocyanins in potatoes includes the following steps: A gRNA was designed based on the CRISPR / Cas9 system targeting the potato long non-coding RNA StLINC1624 sequence. Primers were designed for this gRNA sequence, and PCR amplification was performed using the pCBC-DTDT2 backbone vector as a template. The gRNA was then ligated to the pHSE401 expression vector to obtain a potato long non-coding RNA StLINC1624 CRISPR / Cas9 gene editing vector. This vector was then transformed into potatoes to achieve site-specific knockout of the potato long non-coding RNA StLINC1624, thereby increasing the anthocyanin content of potatoes.

[0014] Phenotypic observations of wild-type and transgenic potato plants, along with qRT-PCR analysis of the expression levels of anthocyanin synthesis-related genes in wild-type and transgenic lines (overexpression lines and CRISPR editing vectors) under normal treatment, were used to verify how the potato long non-coding RNA StLINC1624 participates in potato anthocyanin accumulation.

[0015] The results showed that, compared with the control (WT), the expression level of miR156e was upregulated, and anthocyanin-related synthetic genes were also affected. ANS and F3'5'H The expression level was upregulated. Attached Figure Description

[0016] Figure 1 The expression patterns of StLINC1624 and its target genes, miR156e; Figure 2 The structure and target location of StLINC1624; Figure 3 A schematic diagram of the skeleton of the CRISPR / Cas9 gene editing vector for the StLINC162 gene; Figure 4 The image shows the sequencing results of the CRISPR / Cas9 gene editing vector plasmid for the StLINC1624 gene. Figure 5 Phenotypic comparison of wild-type potato tissue culture seedlings, overexpression potato tissue culture seedlings, and gene-edited potato tissue culture seedlings under normal temperature conditions (tissue culture seedlings). Figure 6 Phenotypic comparison of wild-type potato tissue culture seedlings, overexpression potato tissue culture seedlings, and gene-edited potato tissue culture seedlings under normal temperature conditions (hydroponic seedlings). Figure 7 Comparison of leaves and mini-tubules of wild-type potatoes under normal temperature conditions, leaves and mini-tubules of overexpressed potatoes, and leaves and mini-tubules of gene-edited potatoes; Figure 8 The expression levels of miR156e and two anthocyanin synthesis-related genes were measured in wild-type and gene-edited potatoes.

[0017] Figure 9 The reverse complementary sequences of target 1 and target 2 in the primer sequence and Bsa Explanation of the restriction enzyme sites of I. Detailed Implementation

[0018] The present invention will be described in detail below with reference to specific embodiments.

[0019] To analyze the effect of potato StLINC1624 on anthocyanin accumulation, this embodiment presents a method for efficient site-specific knockout of potato StLINC1624 based on the CRISPR / Cas9 system, which yields potato gene-edited materials with increased anthocyanin content and reduced plant height.

[0020] The specific implementation process is as follows: 1. Construction of CRISPR / Cas9 gene editing vector for potato StLINC1624 gene (1) Selection of gRNA target sites and synthesis of primers This invention downloaded the sequence of potato non-coding RNA StLINC1624 (as shown in SEQ ID NO.1) from the database. Based on the analysis of the StLINC1624 sequence, target sites were screened and gRNAs were designed according to the CRISPR / Cas9 technology principle.

[0021] TGGTGTAGCTATTGTTTGTTCTCTTTTGGCACTTGTTGTGTAGCCATTAGAAGAATAATTGTAACTCTCTTATTGTTATAGTGAAGCAATTCGGATCTTGTCGATCCCGTGGTGGTTACCTTCGTTTTGAAGGATTTTTCCACGTTAAACTTGGTGTTCTTTATTTTAGTTTTTCGT TTTCATCTTTTCGTCACAACAAGTGGTATCAGAGCGAGGTTCTCTATATGGAGGGGAATATGAGCAAGATGGTATGTCTAAACGGAAGAAACTACAACATATGGAAAAGCAAGATGAAAGATCTACTGTTCGTGAAGAAGATGCATCTTCCCGTTTTTGCTGCTCATAAACCTG (SEQ ID NO.1) Target design principles: target length is 19bp+NGG; target needs to be on an exon; target should avoid repetitive sequences and TTTT; target should preferably start with "G"; GC content should be 20%-80%.

[0022] Two 19bp gRNA target sites were designed at the binding sites of StLINC1624 and miR156e and another conserved region. The region length is 19bp, and the PAM region is NGG.

[0023] gRNA1: 5'-GCTATTGTTTGTTCTCTTT-3', (SEQ ID NO. 2) gRNA2: 5'-GATCTTGTCGATCCCGTGG-3', (SEQ ID NO.3) Based on the two gRNA sequences mentioned above, the following primers were designed and sent to Shanghai Sangon Biotech Co., Ltd. for synthesis.

[0024] DT1-LINC1624-BsF: ATATATGGTCTCGATTGGCTATTGTTTGTTCTCTTTGTT (SEQ ID NO.4) DT1-LINC1624-F0: TGGCTATTGTTTGTTCTCTTTGTTTTAGAGCTAGAAATAGC (SEQ IDNO.5) DT2-LINC1624-R0: AACCCACGGGATCGACAAGATCCAATCTCTTAGTCGACTCTAC (SEQ IDNO.6) DT2-LINC1624-BsR:ATTATTGGTCTCGAAACCCACGGGATCGACAAGATCC (SEQ ID NO.7) like Figure 9 As shown, green represents the sequence of target 1 (NGG first 19-nt), blue represents the inverse complementary sequence of target 2 (NGG first 19-nt), and the underlined portion is... Bsa I. Restriction site.

[0025] (2) PCR amplification, purification and recovery Primers DT1-LINC1624-BsF and DT2-LINC1624-BsR were diluted to 100 μM, and primers DT1-LINC1624-F0 and DT2-LINC1624-R0 were diluted to 10 μM. PCR amplification was performed using the 100-fold diluted pCBC-DTDT2 backbone vector as a template, and the target band was recovered using a gel extraction kit.

[0026] Table 1: PCR reaction system (3) Ligation of the target band with the CRISPR / Cas9 gene editing vector use Bsa The gel recovery product and the pHSE401 expression vector were digested with restriction endonucleases, respectively, and then ligated with T4 ligase.

[0027] Table 2: Enzyme digestion reaction system

[0028] Table 3: Connection Reaction System

[0029] (4) Transformation of Escherichia coli and identification of expression vectors The ligation products were transformed into *E. coli* competent cells DH5α using the heat shock method, followed by Kan and SpR resistance screening and colony PCR identification. The primers were U626-IDF (SEQ ID NO. 8) and U629-IDR (SEQ ID NO. 9). Plasmids from the obtained positive clones were extracted and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Plasmids with correct sequencing results were stored for later use. The primer sequences are as follows: U626-IDF: TGTCCCAGGATTAGAATGATTAGGC (SEQ ID NO.8) U629-IDR: AGCCCTCTTTCTTTCGATCCATCAAC (SEQ ID NO.9) (5) Transformation of Agrobacterium The constructed vector CRISPR-StLINC1624 was transformed into Agrobacterium-competent cells GV3101 to obtain recombinant bacteria. The specific procedures are as follows: Preparation: Turn on the 42℃ water bath; connect the product; stopwatch; 1000 µL pipette; ice; take the competent cells at -80℃ in liquid nitrogen.

[0030] Thaw Agrobacterium competent cells GV3101 stored at -80℃ on ice. Add 5 µL of the successfully constructed CRISPR-StLINC1624 plasmid to 100 µL of GV3101 competent cells. Do not pipette. Incubate on ice for 30 min, then in a 42℃ water bath for 90 s, and immediately place in liquid nitrogen for 1 min. After thawing naturally, add 900 µL of LB liquid medium to each tube in a clean bench and incubate at 28℃ and 180 rpm for 4 h 30 min on a shaker. Centrifuge at 12000 rpm for 1 min to collect the cells. Discard the supernatant and resuspend the cells in 100 µL of supernatant. Spread the supernatant evenly onto LB solid medium containing 50 mg / mL Kan + 50 mg / mL Lf. After drying, incubate in a 28℃ incubator in the dark and upside down. Forty-eight hours later, single colonies were streaked onto LB solid medium containing 50 mg / mL Kan + 50 mg / mL Rif, air-dried, and then incubated upside down in a 28°C incubator in the dark. After colony PCR verification, positive colonies were transferred to LB liquid medium containing 50 mg / mL Kan + 50 mg / mL Rif and incubated overnight at 28°C and 180 rpm in a shaker. The bacterial culture was then mixed with 50% glycerol at a 1:1 ratio and stored at -80°C for long-term storage.

[0031] 2. Obtaining and identifying potato non-coding RNA StLINC1624 CRISPR / Cas9 gene-edited plants (1) Prepare Agrobacterium infection solution Agrobacterium was activated by storage at -80℃ and cultured in a resistant liquid medium to obtain OD. 600 Agrobacterium suspension at 0.25-0.35 μL was centrifuged at 4000 rpm for 9 min to collect the bacterial cells. M1 medium (1 L of M1 medium is prepared by mixing 4.43 g of vitamin-containing MS salt, 30 g of sucrose, and distilled water, pH 5.8) was added, and the suspension was centrifuged at 4000 rpm for 15 min. The supernatant was discarded, and M2 medium (M2 medium is M1 medium + 200 μM AS, pH 5.4) was added to resuspend the bacterial suspension to OD. 600 The value is 0.8, pending.

[0032] (2) Agrobacterium infection Two to three days before the genetic transformation experiment, sterile potato mini-tubers were selected and sliced ​​into 0.1 cm thick slices. These slices were then evenly spread on the surface of EY1 pre-medium and pre-cultured at 23°C in the dark. After pre-culture, the potato slices were immersed in the prepared bacterial solution for 10 min, gently shaking every 2.5 min to ensure adequate contact. After infection, the potato slices were transferred to sterile filter paper to remove excess bacterial solution, and then evenly placed on EY2 co-medium. Finally, the culture dishes were incubated at 23°C in the dark for 48 h.

[0033] (3) Screening and regeneration culture Miniature potato chips were transferred to sterile culture flasks and washed 2-3 times with sterile water containing Cef. They were then blotted dry with sterile filter paper and transferred to EY3 medium for callus induction. The medium was changed every 2 weeks, and the culture was maintained at 25°C with 16 h light / 8 h dark and 2500 Lux light intensity. After approximately 1-2 months, small, spherical green buds appeared on the cut surface and outer ring, indicating callus tissue. These green buds were then transferred to differentiation medium EY4 and cultured at 25°C with 16 h light / 8 h dark and 2500 Lux light intensity. Once the potato buds reached 3-5 cm in length, they were transferred to rooting medium EY5 and cultured at 25°C with 16 h light / 8 h dark and 2500 Lux light intensity. After rooting, the transgenic potato plants were obtained.

[0034] (4) Identification of potato non-coding RNA StLINC1624 CRISPR / Cas9 gene-edited plants Leaf DNA was extracted from wild-type and transgenic regenerated plants. PCR identification was performed using primer pairs U626-IDF (SEQ ID NO. 8) and U629-IDR (SEQ ID NO. 9). Regenerated plants yielding fragments of the expected size after amplification were identified as transgenic positive plants. Primers were designed upstream of gRNA1 and downstream of gRNA2 at the target site. PCR was performed using DNA from wild-type and transgenic positive plants as templates, respectively. PCR products were sequenced using HI-TOM technology, and the editing status of the target sequence was analyzed. Primer sequences are as follows: HI-TOM-LINC1624-F:GAGTACGTGTGCACAGCAGTTGAGTTT (SEQ ID NO.10) HI-TOM-LINC1624-R:GGATGCTGGATGGGATACCACTTGTTGTGAC (SEQ ID NO.11) HI-TOM sequencing results showed that at target site 1, the CR-LINC1624-2 strain exhibited base deletions compared to the wild type, while the CR-LINC1624-4, CR-LINC1624-6, CR-LINC1624-9, and CR-LINC1624-10 strains all showed varying degrees of base deletions and substitutions at target site 1. At target site 2, the CR-LINC1624-2 strain remained consistent with the wild type, while the CR-LINC1624-4, CR-LINC1624-6, CR-LINC1624-9, and CR-LINC1624-10 strains showed three different degrees of base substitutions at target site 2 (Table 4), indicating that StLINC1624 was successfully edited.

[0035] Table 4: Statistics on editing efficiency of potato non-coding RNA StLINC1624 CRISPR / Cas9 gene-edited plants

[0036] (5) Phenotypic analysis in potato non-coding RNA StLINC1624 gene-edited plants The identified positive gene-edited potato plants were further cultured in sterile tissue culture flasks, and their phenotypes were analyzed. Observations revealed that, compared to wild-type (WT) and overexpression (OE) lines, gene-edited potato plants exhibited a dwarfing phenotype. Figure 5 , Figure 6 In addition, the leaves and tubers of gene-edited potato plants showed a deeper purple color and increased anthocyanin content. Figure 7 ).

[0037] Two strains were selected for anthocyanin-related gene assays. The results showed that, compared to the control (WT), miR156e expression was upregulated, and anthocyanin-related synthesis genes were also detected. ANS and F3'5'H Upregulation of expression ( Figure 8 ).

[0038] It should be understood that those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of the appended claims.

Claims

1. A CRISPR / Cas9-based potato long non-coding RNA StLINC1624 mutant, characterized in that, The non-coding RNA sequence is shown in SEQ ID NO.

1.

2. A gRNA for editing the potato long non-coding RNA StLINC1624, characterized in that, It is contained in the long non-coding RNA StLINC1624 mutant of claim 1, wherein the gRNA sequence comprises gRNA1 and gRNA2, the nucleotide sequence of gRNA1 is shown in SEQ ID NO.2, and the nucleotide sequence of gRNA2 is shown in SEQ ID NO.

3.

3. The application of the gRNA of claim 2 in constructing potato gene-editing materials, wherein the gene-editing materials include recombinant bacteria targeting potato long non-coding RNA StLINC1624, recombinant vectors, potato transgenic systems, and tissues.

4. A CRISPR / Cas9 system comprising the gRNA of claim 2, mutating potato long non-coding RNA StLINC1624.

5. Application of potato long non-coding RNA StLINC1624 or related biological materials in anthocyanin synthesis and accumulation.

6. A method for constructing a potato long non-coding RNA StLINC1624 CRISPR / Cas9 gene editing vector, characterized in that, Includes the following steps: Based on the CRISPR / Cas9 system, a gRNA was designed targeting the potato long non-coding RNA StLINC1624 sequence. Primers were designed for this gRNA sequence, and PCR amplification was performed using the pCBC-DTDT2 backbone vector as a template. The gRNA was then ligated to the pHSE401 expression vector to obtain the potato long non-coding RNA StLINC1624 CRISPR / Cas9 gene editing vector.

7. A method for obtaining potato plants with long non-coding RNA StLINC1624 CRISPR / Cas9 gene-edited, characterized in that, Includes the following steps: A gRNA was designed based on the CRISPR / Cas9 system targeting the potato long non-coding RNA StLINC1624 sequence. Primers were designed for this gRNA sequence, and PCR amplification was performed using the pCBC-DTDT2 backbone vector as a template. The gRNA was then ligated to the pHSE401 expression vector to obtain a CRISPR / Cas9 gene editing vector for the potato long non-coding RNA StLINC1624. This vector was then transformed into potatoes to achieve site-specific knockout of the potato long non-coding RNA StLINC1624, thereby obtaining potato mutant plants.

8. A method for increasing anthocyanin content in potatoes, characterized in that, Includes the following steps: A gRNA was designed based on the CRISPR / Cas9 system targeting the potato long non-coding RNA StLINC1624 sequence. Primers were designed for this gRNA sequence, and PCR amplification was performed using the pCBC-DTDT2 backbone vector as a template. The gRNA was then ligated to the pHSE401 expression vector to obtain a potato long non-coding RNA StLINC1624 CRISPR / Cas9 gene editing vector. This vector was then transformed into potatoes to achieve site-specific knockout of the potato long non-coding RNA StLINC1624, thereby increasing the anthocyanin content of potatoes.