A multisite synergistically chemically modified xnazyme and applications thereof

Abstract

The application discloses a kind of XNAzyme of multi-site synergic chemical modification and application thereof, the XNAzyme is obtained by 8-17 DNAzyme as template modification, catalytic core region simultaneously includes the 2'-O-methoxyethoxy (MOE) modification of 13th guanosine, and phosphorus sulfur (PS) modification between 2-3, 6-7 and 15-16; the catalytic efficiency of the XNAzyme under near physiological condition (1 mM MgCl2, 150 mM NaCl, pH 7.5) is increased by 4-8 times compared with unmodified 8-17 DNAzyme;Further, after introducing locked nucleic acid (LNA) modification in the terminal of binding arm, the XNAzyme still remains stable in 50% serum for 24 hours, the silencing efficiency of EGFP mRNA in mammalian cells reaches 90%, the silencing efficiency of endogenous c-myc gene reaches 40% and inhibits tumor cell proliferation, realizes the synchronous promotion of catalytic activity and biological stability, and can be applied to the field of gene therapy.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and biomedicine, specifically to an XNAzyme with multi-site synergistic chemical modification and its applications. Background Technology

[0002] Nucleic acid molecules have long been considered the primary medium for storing and transmitting genetic information. Deoxyribonucleic acid (DNA) is responsible for the long-term preservation of genomic information, while ribonucleic acid (RNA) participates in transcription and protein synthesis. With the deepening development of molecular biology and nucleic acid chemistry, research has shown that nucleic acids can not only serve as carriers of the genetic code but also possess catalytic functions similar to proteins. Naturally occurring ribozymes can catalyze reactions such as RNA cleavage and ligation. Based on this, researchers have obtained DNA molecules capable of catalyzing specific reactions, namely deoxyribozymes, through in vitro screening techniques (SELEX, or exponentially enriched ligand systematic evolution).

[0003] DNAzymes are composed of single-stranded DNA with predictable secondary structures, enabling them to bind metal ions or other cofactors to achieve efficient cleavage of specific RNA substrates. Compared to proteases or natural ribozymes, DNAzymes offer significant advantages: programmable sequences, ease of chemical synthesis, low cost for large-scale preparation, no need for cell expression systems, and stable physicochemical properties and easy storage. Therefore, DNAzymes have attracted widespread attention in nucleic acid detection, disease diagnosis, gene regulation, and potential therapeutic applications.

[0004] However, existing DNAzyme technologies, especially natural DNAzymes represented by 8-17 DNAzymes and their simple modified variants, still have the following shortcomings in practical applications: 1) The catalytic activity of existing DNAzymes is highly dependent on Mg. 2+ Concentration. Optimized in vitro conditions (e.g., Mg above 10 mM). 2+ Under normal conditions, its catalytic efficiency is still sufficient; however, under low Mg conditions close to physiological conditions, its catalytic efficiency is insufficient. 2+ At concentrations (approximately 1 mM), its catalytic efficiency drops sharply, severely limiting its application in vivo.

[0005] 2) Natural DNA is composed of unmodified deoxyribonucleotides, which are highly sensitive to nucleases that are widely present in serum and cells. The half-life of unmodified DNA zymes in serum is usually only tens of minutes. After entering the body, they are rapidly degraded and inactivated, making it difficult for them to perform their intended function within the effective time window.

[0006] 3) Complex biological systems contain a large number of nucleic acid binding proteins and RNA substrates with complex higher-order structures. Natural DNAzymes have difficulty effectively approaching and cleaving dense RNA targets and there is a certain risk of off-target effects, which limits their ability to precisely regulate. Summary of the Invention

[0007] To address the shortcomings of the existing technologies, this invention provides an XNAzyme with multi-site synergistic chemical modification and its applications, which combines catalytic efficiency, biological stability, substrate adaptability, and ease of preparation.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: An XNAzyme with multi-site synergistic chemical modification, wherein the XNAzyme is a mutant obtained by modifying an 8-17 DNAzyme template, and its catalytic core region simultaneously contains the following chemical modifications: The 2′-O-methoxyethoxy (MOE) modification of the guanosine monophosphate (G13) at position 13, and the phosphorus-sulfur (PS) modification between positions 2 and 3, between positions 6 and 7, and between positions 15 and 16.

[0009] Furthermore, the XNAzyme of the present invention has the nucleotide sequence shown in SEQ ID NO: 1: TG*CCAG*CGGCTC / i2MOErG / AA*.

[0010] The nucleotide at position 13 is a MOE-modified guanosine monophosphate, and the phosphodiester bonds at positions 2-3, 6-7, and 15-16 are phosphorus-sulfur modified.

[0011] Furthermore, the XNAzyme described in this invention exhibits an apparent rate constant of 0.12 min for RNA substrates at 37°C in a buffer solution containing 1 mM MgCl2, 150 mM NaCl, and pH 7.5. -1 The preferred value is 0.128 ± 0.001 min. -1 .

[0012] Furthermore, the binding arm length of the XNAzyme described in this invention is 9 nucleotides and 7 nucleotides, its melting temperature is 37~42℃, and it has a nucleotide sequence as shown in SEQ ID NO: 2: CCCAGCA TG*CCAG*CGGCTC / i2MOErG / AA* ACATGATTC.

[0013] The present invention also provides the use of the XNAzyme in the preparation of formulations for targeting and silencing target genes.

[0014] Furthermore, the target gene described in this invention is the EGFP gene or the c-myc oncogene.

[0015] Furthermore, the binding arm of the XNAzyme of the present invention further includes a locked nucleic acid (LNA) modification at its end. The LNA modification is located at the last three nucleotide positions of the 3′ and / or 5′ ends of the XNAzyme. The nucleotide sequence targeting the EGFP gene EG-ln is shown in SEQ ID NO: 3, / iLNA_A / / / iLNA_C / / iLNA_T / GCACGTG*CCAG*CGGCTC / i2MOErG / AA* GTAGGT / iLNA_C / / iLNA_A / / iLNA_G / , and the nucleotide sequence targeting the c-myc gene M-ln is shown in SEQ ID NO: 4, / iLNA_T / / / iLNA_C / / iLNA_T / GGTTCATG*CCAG*CGGCTC / i2MOErG / AA*ATGTCT / iLNA_C / / / iLNA_C / / iLNA_T / .

[0016] Furthermore, the composition of the present invention comprises: an effective amount of XNAzyme or LNA-modified XNAzyme and a pharmaceutically acceptable carrier or transfection reagent.

[0017] Furthermore, the composition of the present invention is used to inhibit the expression of EGFP or c-myc genes in cells, or to inhibit the proliferation of tumor cells.

[0018] Compared with the prior art, the present invention has the following beneficial effects: 1. By introducing a synergistic combination of G13 MOE modification and three specific PS modifications into the catalytic core region, the XNAzyme of this invention achieves near-physiological performance under near-physiological conditions (1 mM Mg). 2+ The catalytic activity under these conditions is 4-8 times higher than that of wild-type 8-17 DNAzyme, and it has high activity under physiological conditions.

[0019] 2. The combined chemical modification of the present invention endows XNAzyme with excellent resistance to nuclease degradation. After further combining with LNA terminal modification, the half-life of XNAzyme in serum is extended from tens of minutes to more than 24 hours, providing a basis for in vivo application.

[0020] 3. The XNAzyme of this invention can achieve highly efficient silencing of reporter gene (EGFP) and endogenous pathogenic gene (c-myc) in mammalian cells, with mRNA knockdown efficiencies of 90% and 40% respectively, and significantly inhibit tumor cell proliferation, providing a novel nucleic acid drug candidate molecule for gene therapy of diseases such as cancer.

[0021] 4. This invention is the first to achieve comprehensive performance in terms of catalytic efficiency, biological stability, substrate adaptability and ease of preparation on the same molecule through multi-site synergistic chemical modification, which has industrial application value. Attached Figure Description

[0022] Figure 1 This is a schematic diagram of the chemical modification of the deoxyribozyme 8-17 of the present invention; wherein: Figure 1 In the sequence A, there is 8-17 deoxyribonuclease and its corresponding first substrate sequence. The chemical structure of the heterologous nucleic acid modification includes four structures: OMe (2'-methoxyribonucleic acid), MOE (2'-methoxyethoxyribonucleic acid), LNA (locked nucleic acid), and PS (phosphothiophosphate). Among them, 1 is the cleavage site. Figure 1 In the diagram, B represents the electrophoretic bands and corresponding bar graphs of the wild-type and unmodified wild-type deoxyribonuclease with three different modifications to the catalytic core G13 of the 8-17 deoxyribonuclease at a reaction time of 20 minutes. Among them, OMe modification is represented as OMe13, MOE modification as MOE13, LNA modification as LNA13, and unmodified wild-type as Wt. Figure 1 The figure shows the effect of individual PS (phosphothioester) modifications at the catalytic core positions (0-1, 1-2, ... 15-16) of the 8-17 deoxyribozymes on DNAzyme activity, with a reaction time of 30 minutes; the unmodified wild type is represented as Wt. Figure 1 The figure shows the effect of combined PS modification at three positions (2-3, 6-7, and 15-16) on DNAzyme activity in the catalytic core. The reaction time was 10 minutes. Unmodified wild-type is represented as Wt. 2 -3 PS 6-7 PS 15-16 The symbol indicates the catalytic core position of the PS modification; P, 2P1, 2P2, 2P3, and 3P represent heteronucleases with different PS modifications. Figure 1 In this context, E represents the apparent reaction rate constant of the heterologous nuclease variant (M3P) obtained by combining MOE and PS modifications at the G13 position of the catalytic core of the 8-17 deoxyribonuclease. k OBS diagram; where the unmodified wild type is represented by Wt; G13 represents the 13th base G position in the catalytic core, PS 2-3 PS 6-7 PS 15-16The symbol indicates the catalytic core position modified by PS; P, 3P, M, MP, and M3P represent heteronucleases with different modifications. Figure 2 This is a schematic diagram of the modular characteristics of the support structure of the M3P of the present invention, wherein: Figure 2 In the diagram, A represents the cleavage activity and melting temperature of M3P with different binding arm lengths at reaction times of 5 minutes and 10 minutes, respectively; where the sequence is the wild-type 8-17 DNAzyme, and M3P(X, Y) represent the number of bases in the binding arms at the 3-end and 5-end, respectively. For example, M3P(11,10) indicates that the binding arm at the 3-end is 11 bases long. Figure 2 In the diagram, B represents the M3P cleavage kinetics diagram with the binding arm lengths of M3P(9,7) and M3P(11,10), where wild-type 8-17 DNAzyme is represented as Wt; Figure 2 In the C, it represents the M3P-modified heteronuclease Dz2-M3P targeting the substrate sequence Dz2; where Dz2 represents the second substrate sequence. Figure 2 In the diagram, D represents the cleavage electrophoresis results and cleavage kinetics of the M3P-modified heteronuclease Dz2-M3P targeting the Dz2 DNA substrate and the unmodified wild-type deoxyribonuclease Dz2-Wt targeting the Dz2 DNA substrate. Figure 2 E in the figure represents the electrophoresis results and cleavage kinetics of the M3P-modified heteronuclease Dz2-M3P targeting Dz2 RNA substrate and the unmodified wild-type deoxyribonuclease Dz2-Wt targeting Dz2 RNA substrate. Figure 2 F in the text represents the M3P-modified heteronuclease myc-M3P targeting the substrate sequence myc, where the myc substrate sequence originates from the cancer-related c-myc gene. Figure 2 In the figure, G represents the electrophoresis results and cleavage kinetics of the M3P-modified heteronuclease myc-M3P targeting myc DNA substrate and the unmodified wild-type deoxyribonuclease myc-Wt targeting myc DNA. Figure 2 In the diagram, H represents the electrophoresis results and cleavage kinetics of the M3P-modified heteronuclease myc-M3P targeting myc RNA and the unmodified wild-type deoxyribonuclease myc-Wt targeting myc RNA. Figure 3 This diagram illustrates the in vitro activity and mechanism of action of the M3P XNAzyme targeting EGFP mRNA in this invention, wherein: Figure 3In the diagram, A represents the target site of green fluorescent protein EGFP and the corresponding deoxyribonuclease sequence. EG-Wt represents the wild-type deoxyribonuclease that targets EGFP, EG-M3P represents the heteronuclease that targets EGFP after M3P modification, and EG-ln represents the addition of 3 LNAs at the end of EG-M3P. Figure 3 In the diagram, B represents the electrophoresis results and cleavage activity diagrams of the EG-Wt, EG-M3P, and EG-ln variants against the 19-nt RNA substrate. Figure 3 In the figure, C represents the DNAzyme biostability and degradation kinetics of the variants EG-Wt, EG-M3P, and EG-ln in the presence of 50% fetal bovine serum; Figure 3 In the figure, D represents the cleavage effect of EG-Wt, EG-M3P, and EG-ln variants on full-length EGFP mRNA under simulated physiological conditions, and a blank control figure. Figure 3 The figure shows the electrophoresis results of 19-nt RNA substrate incubated for 20 minutes with / without E. coli RNase H.

[0023] Figure 4 This is a diagram showing how the M3P XNAzyme of this invention inhibits exogenous EGFP expression in HeLa cells; in, Figure 4 In the diagram, A represents the experimental procedure for EG-ln-mediated plasmid expression of EGFP silencing; B represents a fluorescence microscope image 24 hours after transfection; C represents the RT-qPCR results 24 hours after transfection; and D represents the EGFP protein level detected by flow cytometry 48 hours after transfection.

[0024] Figure 5 This is a diagram illustrating how M3P XNAzyme of the present invention inhibits the endogenous c-myc oncogene in HeLa cells; in, Figure 5 In the diagram, A represents the experimental procedure for inhibiting c-myc with the M-ln construct; B represents the change in c-mycmRNA expression 24 hours after transfection; and C represents the detection results of the proliferation activity of different constructs on HeLa cells 24 hours after transfection. Detailed Implementation

[0025] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0026] Example 1 8-17 Chemical Modification and Activity Assay of DNAzyme

[0027] I. Experimental Methods This embodiment investigates the effect of different chemical modifications introduced into the 8-17 DNAzyme catalytic core on cleavage efficiency.

[0028] The reaction system was configured as follows: substrate concentration was 1 μM, and DNAzyme concentration was 100 nM. The buffer solution simulated physiological conditions, containing 50 mM HEPES, 150 mM NaCl (pH 7.5), and 1 mM MgCl2. Before the reaction, the system was pre-incubated at 37°C for 10 min, and then the reaction was initiated by adding MgCl2. Samples were taken at different time points, and an equal volume of stop solution (99% formamide, 1% 6× DNA loading buffer) was added immediately after each sample to terminate the reaction. The terminated samples were heated at 95°C for 5 min to ensure complete denaturation of secondary structures.

[0029] Samples were separated by 15% denaturing polyacrylamide gel electrophoresis (containing 7 M urea), and imaging was performed using a Tanon 5200 Multi imaging system. Band intensity was analyzed using ImageJ software.

[0030] II. Experimental Results

[0031] like Figure 1 As shown in A and B, introducing MOE modification alone at the G13 position can moderately increase activity, while introducing LNA modification alone significantly decreases activity; as Figure 1 As shown in C and D, a systematic comparison of PS modifications at 16 phosphodiester bond positions revealed that modifications at positions 2-3, 6-7, and 15-16 can respectively improve catalytic efficiency, and combined PS modifications at these three positions can further enhance catalytic efficiency; Figure 1 As shown in Figure E, five different 8-17 DNAzyme variants were obtained by combining MOE and PS modifications. All of these variants exhibited higher catalytic efficiencies than the wild-type 8-17 DNAzyme (sequence: TGTCCCAGCATGCCAGCGGCTCGAA ACATGATTCTG). Among them, the M3P variant, obtained by combining three-site PS modification with MOE13 modification, showed an apparent rate constant of 0.128 ± 0.001 min⁻¹, obtained by fitting a first-order kinetic curve using Prism software. -1 The apparent rate constant of the wild-type 8-17 DNAzyme is only 0.029 ± 0.002 min. -1 .

[0032] Therefore, it can be confirmed that the chemical modification evolution of the present invention significantly improves the catalytic efficiency of 8-17 DNAzyme.

[0033] Example 2: Optimization of the binding arm and target adaptation of M3P XNAzyme

[0034] To evaluate the effect of binding arm length on cutting activity, this embodiment designed M3P variants with different binding arm lengths, including M3P(11,10) and M3P(9,7). The melting temperature Tm was predicted using mFold software and compared with the experimental temperature (37℃). like Figure 2 As shown in A and B, the Tm value of M3P(9,7) is approximately 39 °C, which matches the reaction conditions and exhibits the highest cleavage activity, with an apparent rate constant of 0.246 ± 0.003 min. -1 It is approximately 8.5 times that of the wild-type 8-17 DNAzyme.

[0035] To further verify its modularity, the substrate-binding arm of the M3P variant was modified to target different sequences: one was the random sequence Dz2, and the other was the mRNA sequence of the oncogene c-myc. Experimental conditions were the same as in Example 1.

[0036] like Figure 2 As shown in C~H, both modified XNAzymes (Dz2-M3P and myc-M3P) can efficiently cleave their corresponding DNA and RNA substrates. The DNA substrate sequence of Dz2 is: GACACCCT / rG / GTGAACCGC, and the RNA substrate sequence is: / rG / / rA / / rC / rA / / rC / / rC / / rC / / rT / / rG / / rG / / rT / / rG / / The DNA substrate sequence of c-myc is: AGGAGACAT / rG / GTGAACCAGA, and the RNA substrate sequence is: / rA / / rG / / rG / / rA / / rG / / rA / / rC / / rA / / rT / / rG / / rG / / rT / / rG / / rA / / rA / / rA / / rC / / rC / / rA / / rG / / rA / . The rate constants of Dz2-M3P and myc-M3P are 0.128 ± 0.001 min compared to the original M3P rate constant. -1 Approximately; (wherein, the rate constant of Dz2-M3P is 0.142 ± 0.004 min) -1 The rate constant of myc-M3P is 0.147 ± 0.005 min. -1The values ​​were close to those of wild-type Dz2-Wt (sequence: GCGGTTCA TGCCAGCGGCTCGAA AGGGTGTC) and wild-type myc-Wt (sequence: TCTGGTTCA TGCCAGCGGCTCGAA ATGTCTCCT).

[0037] Therefore, it can be confirmed that the M3P XNAzyme of the present invention has good reprogrammability and can be used for efficient cutting of different sequences.

[0038] Example 3: In vitro application of M3P XNAzyme targeting EGFP mRNA

[0039] like Figure 3 As shown in A, an M3P derivative targeting EGFP mRNA was designed, and three LNA modifications were introduced at the end of the binding arm to construct EG-ln.

[0040] like Figure 3 As shown in B, experiments targeting the 19nt RNA short-chain substrate (sequence: / rC / / rU / / rG / / rA / / rC / / rC / / rU / / rA / / rC / / rG / / rG / / rC / / rG / / rU / / rG / / rC / / rA / / rG / / rU / ) showed that the activity of EG-ln (sequence: / iLNA_A / / / iLNA_C / / iLNA_T / GCACG TG*CCAG*CGGCTC / i2MOErG / AA* GTAGGT / iLNA_C / / iLNA_A / / iLNA_G / ) was almost identical to that of EG-M3P (sequence: ACTGCACG TG*CCAG*CGGCTC / i2MOErG / AA*GTAGGTCAG), indicating that the introduction of LNA modification at the end of the binding arm does not affect the catalytic efficiency of M3P. Experimental conditions were the same as in Example 1.

[0041] The biostability of the DMEM system containing 50% fetal bovine serum was investigated at 37 °C. Sampling times were 0, 10 min, 30 min, 1 h, 4 h, 8 h, and 24 h.

[0042] like Figure 3 As shown in C~D, wild-type EG-Wt (sequence: ACTGCACG TGCCAGCGGCTCGAAGTAGGTCAG) was completely degraded within 20 min, EG-M3P was degraded within 30 min, while EG-ln still had a large number of intact bands after 24 h.

[0043] Further testing was conducted to determine its cleavage performance on full-length EGFP mRNA. The reaction was performed in a simulated physiological buffer (1 mM MgCl2, 150 mM NaCl, pH 7.5), and the results are as follows: Figure 3 As shown in E, EG-ln can achieve effective cutting at the target location, while EG-Wt has lower cutting efficiency.

[0044] Therefore, it can be confirmed that by introducing appropriate chemical modifications at the end of the binding arm, the present invention can significantly improve the serum stability of XNAzyme and its efficiency in cleaving long-chain mRNA.

[0045] Example 4: Silencing of the EGFP gene in cells using M3P XNAzyme

[0046] like Figure 4 As shown in Figure A, EG-ln and the control construct were co-transfected into HeLa cells (EGFP plasmid + XNAzyme, 100 nM or 200 nM concentration) using ExFect transfection reagent at a ratio of 2 μL / 1 μg DNA. Fluorescence imaging and cellular RNA extraction were performed 24 hours after transfection. EGFP transcription levels were detected by real-time quantitative PCR, with GAPDH used as an internal control.

[0047] like Figure 4 As shown in B, the fluorescence level of the EG-ln group was significantly lower than that of the blank control group transfected with EGFP plasmid only, the antisense nucleotide group of the control, and the mutation inactivation group (the antisense nucleotide EG-ASO sequence is: / iLNA_A / / / iLNA_C / / iLNA_T / GCACGCCGTAGGT / iLNA_C / / iLNA_A / / iLNA_G / ; the EG-mut sequence of the mutation inactivation group is: / iLNA_A / / / iLNA_C / / iLNA_T / GCACG TG*CCAA*CGGCTT / i2MOErG / AA* GTAGGT / iLNA_C / / iLNA_A / / iLNA_G / ).

[0048] like Figure 4 As shown in C, at a concentration of 200 nM, the EGFP transcription level in the EG-ln group was reduced by approximately 90%, which was significantly lower than that in the control antisense nucleotide group and the mutation inactivation group.

[0049] Simultaneously, flow cytometry was used to detect EGFP protein levels. Figure 4 As shown in D, the fluorescence intensity of the EG-ln group was significantly lower than that of the control group, while the antisense oligonucleotide group and the mutation inactivation group did not show significant silencing effects.

[0050] Therefore, it can be confirmed that the M3P XNAzyme of the present invention can be stably present in mammalian cells and achieve effective silencing of exogenous genes.

[0051] Example 5: Silencing of the c-myc gene in cells using M3P XNAzyme

[0052] like Figure 5 As shown in Figure A, the M-ln targeting c-myc mRNA (sequence: / iLNA_T / / / iLNA_C / / iLNA_T / GGTTCA TG*CCAG*CGGCTC / i2MOErG / AA* ATGTCT / iLNA_C / / / iLNA_C / / iLNA_T / ), its antisense nucleotides, and the mutant inactivation group were transfected into HeLa cells at a final concentration of 100 nM. Twenty-four hours after transfection, total RNA was extracted from the cells, and the c-myc transcription level was detected by real-time quantitative PCR. Furthermore, the CCK-8 cell viability assay reagent was added after 24 hours of culture, and the absorbance was measured at 450 nm after 1 hour of incubation to detect cell proliferation capacity.

[0053] like Figure 5 As shown in B, compared with the blank control, the c-myc expression level in the M-ln group decreased by about 40%, which was significantly lower than that in the control antisense nucleotide group and the mutation inactivation group (the antisense nucleotide M-ASO sequence is: / iLNA_T / / / iLNA_C / / iLNA_T / GGTTCACCATGTCT / iLNA_C / / / iLNA_C / / iLNA_T / ; the mutation inactivation group M-mut sequence is: / iLNA_T / / / iLNA_C / / iLNA_T / GGTTCA TG*CCAA*CGGCTT / i2MOErG / AA* ATGTCT / iLNA_C / / / iLNA_C / / iLNA_T / ).

[0054] like Figure 5 As shown in C, cell proliferation in the M-ln treatment group was significantly inhibited, while the control antisense oligonucleotide group and the mutation inactivation group showed no significant difference.

[0055] Therefore, it can be confirmed that the M3P XNAzyme of the present invention can not only cleave endogenous oncogene mRNA in vitro, but also achieve efficient silencing and inhibit tumor cell proliferation in cells, and has potential therapeutic application value.

Claims

1. An XNAzyme with multi-site synergistic chemical modification, characterized in that, The XNAzyme is a mutant obtained by modifying 8-17DNAzyme as a template, and it contains the following chemical modifications in its catalytic core region: The 2′-O-methoxyethoxy modification of the guanosine monophosphate at position 13, and the phosphorus-sulfur (PS) modification between positions 2 and 3, between positions 6 and 7, and between positions 15 and 16.

2. The XNAzyme according to claim 1, characterized in that, The XNAzyme has a nucleotide sequence as shown in SEQ ID NO: 1, wherein the nucleotide at position 13 is a MOE-modified guanosine monophosphate, and the phosphodiester bonds at positions 2-3, 6-7 and 15-16 are phosphorus-sulfur modified.

3. The XNAzyme according to claim 2, characterized in that, The XNAzyme exhibited an apparent rate constant of 0.12 min for RNA substrates at 37°C in a buffer solution containing 1 mM MgCl2, 150 mM NaCl, and pH 7.

5. -1 The preferred value is 0.128 ± 0.001 min. -1 .

4. The XNAzyme according to any one of claims 1 to 3, characterized in that, The XNAzyme has binding arms of 9 and 7 nucleotides in length, a melting temperature of 37-42°C, and a nucleotide sequence as shown in SEQ ID NO:

2.

5. The use of XNAzyme according to any one of claims 1 to 3 in the preparation of formulations for targeting and silencing target genes.

6. The application according to claim 5, characterized in that, The target gene is either the EGFP gene or the c-myc oncogene.

7. The application according to claim 6, characterized in that, The binding arm of the XNAzyme further includes a locked nucleic acid (LNA) modification at its end, the LNA modification being located at the last three nucleotide positions of the 3′ and / or 5′ ends of the XNAzyme, wherein the nucleotide sequence targeting the EGFP gene EG-ln is shown in SEQ ID NO: 3, and the nucleotide sequence targeting the c-myc gene M-ln is shown in SEQ ID NO:

4.

8. A composition for gene silencing, characterized in that, The composition comprises the XNAzyme as described in any one of claims 1 to 3 or the LNA-modified XNAzyme as described in claim 7.

9. The composition according to claim 8, characterized in that, The composition is used to inhibit the expression of EGFP or c-myc genes in cells, or to inhibit the proliferation of tumor cells.

Images