Application of NtNPF6.7 gene in regulating tobacco chloride ion transport and obtaining low-chlorine tobacco varieties
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ZHENGZHOU TOBACCO RES INST OF CNTC
- Filing Date
- 2026-03-26
- Publication Date
- 2026-08-07
AI Technical Summary
[0004](2)化学成分失衡:高氯含量会打破烟草中钾氯比的平衡
[0020]为了实现上述目的,本发明中NtNPF6.7基因在获得低氯烟草品种中的应用所采用的技术方案是:
Smart Images

Figure CN122521701A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to NtNPF6.7 The application of genes in regulating chloride ion transport in tobacco and obtaining low-chlorine tobacco varieties belongs to the field of plant genetic engineering technology. Background Technology
[0002] Chlorine, as an essential micronutrient for plants, plays a complex and contradictory role in the physiological metabolism of tobacco. At appropriate concentrations, chloride ions have multiple promoting effects on tobacco growth: as an osmotic regulator, it maintains cell turgor pressure, which helps leaf unfolding and overall growth; as a photosynthetic cofactor, it participates in the hydrolysis process of photosystem II, promoting oxygen release; as a charge balancer, it maintains the balance of anions and cations in cells, promoting nutrient absorption; and as an enzyme activator, it can activate key enzymes such as amylase, promoting metabolism.
[0003] However, tobacco has a strict concentration threshold for chloride ions; exceeding this threshold can trigger a series of negative effects. Studies have shown that when the chloride ion content in tobacco leaves exceeds 0.6%, the smoking quality significantly decreases. The chloride content standard for high-quality tobacco leaves should generally be controlled between 0.3% and 0.8%. The negative effects of excessive chloride ions on tobacco are mainly manifested in the following aspects: (1) Deterioration of combustion performance: Chloride ions generate highly hygroscopic chlorides during combustion, which reduces the burning rate of cigarettes and increases the quenching rate. Studies have shown that chloride ion content is significantly negatively correlated with the combustibility of tobacco leaves, especially affecting the industrial usability of strongly aromatic tobacco leaves.
[0004] (2) Imbalance of chemical composition: High chlorine content will disrupt the balance of potassium-chlorine ratio in tobacco. The ideal potassium-chlorine ratio (K / Cl) should be greater than 4, while excessive chloride ions will reduce this ratio, directly affecting the combustibility and aroma quality of tobacco leaves.
[0005] (3) Changes in physical properties: High-chlorine tobacco leaves often exhibit characteristics such as thicker leaves and coarser texture. After processing, the color is dull, the oil content is insufficient, and the hygroscopicity is enhanced, which is not conducive to storage and processing.
[0006] (4) Physiological metabolic disorders: Excessive chloride ions can interfere with the normal physiological processes of tobacco, including inhibiting photosynthesis, interfering with hormone balance, and destroying enzyme system activity, ultimately leading to hindered growth and development and a decline in quality.
[0007] Based on the direct impact and importance of chloride ion content in tobacco leaves on tobacco quality, some researchers have conducted statistical analysis on chloride ion content in tobacco leaves across various regions of China. The results (from the Zhengzhou Tobacco Research Institute of China National Tobacco Corporation, *China Tobacco Leaf Quality White Paper (2015)*) show that the chloride ion content in flue-cured tobacco leaves in Henan Province from 2011 to 2015 (0.53%-0.65%) was significantly higher than the national average (0.26%-0.30%). Furthermore, according to the average chloride content measurements taken by Shanghai Tobacco Group in the central Henan tobacco-growing region from 2012 to 2015, especially the 2014 data (lower leaves 2.21%, middle leaves 2.09%, and upper leaves 2.03%), the chloride ion content in the central Henan tobacco-growing region has been significantly higher than the national average in recent years. These statistics indicate that the unevenness in tobacco leaf quality in some regions, particularly the unevenness and even high chloride ion content, has become one of the bottlenecks restricting the improvement of the quality of strongly aromatic tobacco leaves.
[0008] Traditional methods of improvement primarily focus on cultivation techniques, such as optimizing field management and refining fermentation processes to stabilize and enhance tobacco leaf quality. However, these measures have not fundamentally changed the situation of low-quality tobacco leaves and limited industrial applicability. With the development of molecular biology techniques, researchers have begun to analyze the regulatory mechanisms of chloride ion absorption and transport in tobacco at the gene level. Several genes related to chloride ion transport have been discovered, such as chloride ion channel genes and cotransporter protein genes. These genes provide targets for marker-assisted selection, accelerating the breeding process of low-chlorine varieties.
[0009] Chinese invention patent CN117025627B, published on November 1, 2024, discloses the tobacco chloride channel protein NtCLC13, its encoding gene, and its applications. Specifically, it discloses the cloning of the encoding gene of the tobacco chloride channel protein NtCLC13. NtCLC13 The gene was analyzed, and subcellular localization analysis revealed that the tobacco chloride channel protein NtCLC13 is located in the cytoplasm. Using CRISPR / Cas9 technology, the constructed gene-editing vector was successfully transferred into tobacco plants via Agrobacterium-mediated transformation, resulting in the successful construction of... NtCLC13 Gene knockout tobacco plants showed a significant reduction in chloride ion content in their leaves upon testing.
[0010] Chinese invention patent application CN119193674A, published on December 27, 2024, discloses a tobacco CBL family gene. NtCBL10 Application of the gene in regulating chloride ion accumulation in tobacco leaves NtCBL10The nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.3, and the encoded amino acid sequence is shown in SEQ ID NO.2 or SEQ ID NO.4. This will help to cultivate high-quality new tobacco varieties with the ability to regulate chloride ion absorption through transgenic technology.
[0011] In summary, although existing technologies have identified some genes capable of regulating chloride ion content in tobacco, plant biological processes are often precisely controlled by complex transcriptional regulatory networks, in which multiple transcription factors are involved. Therefore, further exploration of genes capable of regulating chloride ion content in plants is of great significance for accelerating the breeding process of low-chlorine tobacco. Summary of the Invention
[0012] The first objective of this invention is to provide NtNPF6.7 The application of genes in regulating chloride ion transport in tobacco is explored, providing a gene encoding chloride ion transport in tobacco plants.
[0013] The second object of the present invention is to provide NtNPF6.7 The application of genes in obtaining low-chlorine tobacco varieties provides an effective regulatory site for obtaining low-chlorine varieties using genetic engineering.
[0014] To achieve the above objectives, in this invention NtNPF6.7 The technical approach used in the application of genes in regulating chloride ion transport in tobacco is as follows: NtNPF6.7 The application of genes in regulating chloride ion transport in tobacco, inhibiting NtNPF6.7 Gene expression was significantly reduced, and chloride ion content in tobacco leaves was also significantly decreased. NtNPF6.7 The nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0015] The beneficial effects of the above technical solution are as follows: This invention NtNPF6.7 The application of genes in regulating chloride ion transport in tobacco is a pioneering invention. Specifically, this invention provides a gene encoding a tobacco nitrate transporter protein. NtNPF6.7 In tobacco applications, the protein encoded by this gene participates in the absorption and transport of chloride ions. NtNPF6.7 After gene editing, the chloride ion content in the leaves of gene-edited plants was significantly reduced; through the analysis of tobacco... NtNPF6.7 Gene regulation has important applications in regulating the chloride ion content of tobacco and in the breeding of low-chlorine tobacco.
[0016] As a further improvement, the suppression NtNPF6.7 Gene expression is used to construct gene-editing vectors for tobacco. NtNPF6.7 Genes are knocked out.
[0017] As a further improvement, the method for constructing the gene editing vector includes the following steps: ligating the target site double-stranded DNA into the empty gene editing vector, and sequencing for identification.
[0018] As a further improvement, the sgRNA sequence corresponding to the target site double-stranded DNA is shown in SEQ ID NO.9.
[0019] As a further improvement, the tobacco variety is K326.
[0020] To achieve the above objectives, in this invention NtNPF6.7 The technical solution used in applying genes to obtain low-chlorine tobacco varieties is as follows: NtNPF6.7 The application of genes in obtaining low-chlorine tobacco varieties, through inhibition NtNPF6.7 Gene expression reduces chloride ions in tobacco leaves, resulting in low-chlorine tobacco varieties; NtNPF6.7 The nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0021] The beneficial effects of the above technical solution are as follows: This invention, through the design of specific primers, cloned the encoding gene of the tobacco nitrate transporter NtNPF6.7 protein. NtNPF6.7 Gene, real-time quantitative PCR analysis showed that in normal tobacco plants, NtNPF6.7 The gene is expressed at higher levels in the stem and flowers. Further research is needed. NtNPF6.7 To investigate the role of this gene in the tobacco salt stress response, a CRISPR / Cas9 vector with the gene knocked out was constructed. After transforming this vector into tobacco plants, a model was successfully constructed. NtNPF6.7 Gene knockout mutant lines. Measurements of chloride ion content in the plants revealed a significant decrease in leaf chloride ion content compared to the control plant K326. Therefore, using... NtNPF6.7 The role of genes in chloride ion absorption and transport in tobacco, through the construction of NtNPF6.7 Gene-deleted transgenic mutants reduce the chloride ion content in tobacco. In summary, through the study of... NtNPF6.7 In-depth research on the gene (NtNPF6.7 protein) has important theoretical significance and practical application value for tobacco in chloride ion absorption and transport, and low-chlorine tobacco breeding.
[0022] As a further improvement, the suppression NtNPF6.7 Gene expression is used to construct gene-editing vectors for tobacco. NtNPF6.7 Genes are knocked out.
[0023] As a further improvement, the method for constructing the gene editing vector includes the following steps: ligating the target site double-stranded DNA into the empty gene editing vector, and sequencing for identification.
[0024] As a further improvement, the sgRNA sequence corresponding to the target site double-stranded DNA is shown in SEQ ID NO.9.
[0025] As a further improvement, the low-chlorine tobacco variety is obtained by the following method: transforming a gene-editing vector into Agrobacterium as an infection solution, then transforming tobacco, and obtaining tobacco varieties with significantly reduced chloride ion content in leaves through screening and identification. Attached Figure Description
[0026] Figure 1 In Embodiment 2 of the present invention NtNPF6.7 Gene expression characteristics in different tissues; Figure 2 In Embodiment 3 of the present invention NtNPF6.7 Gene expression characteristics under salt stress; Figure 3 In Embodiment 4 of the present invention NtNPF6.7 A schematic diagram of target site selection for gene knockout; Figure 4 The sequencing results of the knockout target sites in the T0 generation gene-edited plants in Example 4 of this invention; Figure 5 In Embodiment 5 of the present invention NtNPF6.7 Percentage of chloride ion content in leaves of gene-edited plants (where ** indicates...) P< 0.01). Detailed Implementation
[0027] Existing studies generally agree that the optimal chloride ion content in tobacco leaves is between 0.3% and 0.8%. A content of 1% affects smoldering and flame retention, and levels exceeding 1% lead to black ash and flameout. Furthermore, excessively high chloride ion content causes starch accumulation, resulting in thick, brittle leaves with high hygroscopicity, leading to darkening of color and the development of unpleasant odors during storage. In short, the chloride ion content in tobacco leaves has a significant direct impact on their quality. Currently, the chloride ion content in tobacco leaves from some tobacco-growing regions, such as Henan and Shandong, is excessively high, reducing both quality and yield. This has become a pressing issue for growers and researchers to address.
[0028] With the increasing maturity of molecular biotechnology and the achievements of chlorine nutrition molecular biology in other crops, studying the chlorine transport mechanism, chloride ion channels, and effective genes for chlorine absorption in tobacco at the molecular level is of great significance for addressing the high chloride ion content in tobacco from northern tobacco-growing areas of my country. Therefore, to further understand the molecular regulatory mechanism of chloride ion transport and achieve more precise tobacco breeding, identifying and screening proteins and encoding genes involved in the chloride ion transport process is an urgent problem to be solved.
[0029] Based on this, the present invention provides, on the one hand,NtNPF6.7 On the other hand, it provides the application of genes in regulating chloride ion transport in tobacco. NtNPF6.7 Application of genes in obtaining low-chlorine tobacco varieties.
[0030] The present invention will be further described in detail below with reference to specific embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments, experimental examples and comparative examples are all commercially available.
[0031] Unless otherwise specified, the following examples were conducted under conventional experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001), or as recommended by the manufacturer's instructions.
[0032] Biomaterials: Tobacco variety: K326, seeds are preserved by the National Tobacco Gene Research Center; Vectors: pFF19 (preserved by the National Tobacco Gene Research Center), CRISPR / Cas9 vector (provided by the State Key Laboratory of Silkworm Genome Biology, Southwest University); Strains: Trans5α chemocompetent cells, purchased from Beijing TransGen Biotech Co., Ltd.; GV3101 Agrobacterium competent cells, purchased from Shanghai Weidi Biotechnology Co., Ltd. Primer synthesis and DNA sequencing were performed by Beijing BGI Genomics Co., Ltd.
[0033] Experimental reagents: RNA extraction kit (RNAprep Pure polysaccharide and polyphenol plant total RNA extraction kit) and genomic DNA extraction kit (polysaccharide and polyphenol plant genomic DNA extraction kit) were purchased from Tiangen Biotech (Beijing) Co., Ltd.; fluorescence quantitative reagent kit and reverse transcription kit (Transcriptor First Strand cDNA Synthesis Kit) were purchased from Roche; DNA amplification enzyme was purchased from Beijing TransGen Biotech Co., Ltd.; restriction endonuclease BsaI, plasmid extraction kit and DNA gel recovery kit were purchased from Takara.
[0034] Experimental equipment: The PCR instrument was a T Professional Thermocycler manufactured by Biometra; the quantitative PCR instrument was a LightCycler 96 manufactured by Roche.
[0035] This invention NtNPF6.7Specific examples of the application of genes in regulating chloride ion transport in tobacco and obtaining low-chlorine tobacco varieties: Example 1 NtNPF6.7 Acquisition of genes In this embodiment, K326 cDNA was used as a template, and the cDNA was obtained after PCR amplification. NtNPF6.7 Gene, NtNPF6.7 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and its encoded amino acid sequence is shown in SEQ ID NO.2. The specific implementation is as follows: 1. cDNA Acquisition After sterilization, K326 seeds were inoculated onto MS medium for germination. Two weeks after germination, seedlings were transplanted into pots and cultured in a plant culture room at 23-26℃. When the seedlings reached the six-leaf stage, they were transferred to 1 / 2 MS liquid medium for further culture. Two weeks later, root samples were taken, flash-frozen in liquid nitrogen, and stored for later use. RNA was extracted from tobacco roots using a plant RNA extraction kit. The RNA extraction procedure was performed according to the kit instructions. The RNA was then reverse transcribed into cDNA for later use.
[0036] 2. PCR amplification Referring to other existing species NPF6.3 Based on the gene sequences in the Solanaceae Genome Database (https: / / solgenomics.net), the following PCR amplification primer sequences were designed: NtNPF6.7 -F: 5'-ATGAGTTGGACTGTCTCAG-3' (shown in SEQ ID NO.3); NtNPF6.7 -R: 5'-CTAGCACTTCTCTTCAGCT-3' (shown in SEQ ID NO.4).
[0037] Using the cDNA reverse transcribed in step 1 as a template, PCR amplification was performed using the primers described above.
[0038] For PCR amplification, the 50 µL PCR amplification system is as follows: template cDNA, 2 µL; NtNPF6.7 -F primer (10 μmol / L), 1 µL; NtNPF6.7 -R primer (10 μmol / L), 1 µL; 5×GXL buffer, 10 µL; GXL enzyme, 1 µL; dNTP, 6 µL; ddH2O, to 50 µL.
[0039] The PCR reaction program was as follows: 98℃, 10 sec; 55℃, 15 sec; 68℃, 2 min; 30 cycles.
[0040] After PCR, the products were detected by agarose gel electrophoresis and the gene fragments were recovered using a DNA recovery kit.
[0041] The purified product was then ligated into the pFF19 vector. The ligation system was as follows: DNA, 6 μL; pFF19 vector, 1 μL; after mixing, ligation was carried out at 25°C for 25 min.
[0042] The ligation product was transformed into E. coli DH5α competent cells, and the experimental procedure was as follows: Remove DH5α competent cells from the -80℃ freezer and thaw them on ice. Add the ligation product to 100 μL of DH5α competent cells, gently tumble to mix, and incubate on ice for 20 min. Heat shock in a 42℃ water bath for 90 s, then immediately place on ice for 2 min. Add 900 μL of LB (antibiotic-free) liquid medium and incubate at 37℃ with shaking for 1 h. Centrifuge at 4000 rpm for 3 min, discard a portion of the supernatant, and retain 100 μL. Mix the precipitate thoroughly and spread evenly onto LB agar plates (containing 50 μg / μL kanamycin). Invert the plates and incubate overnight at 37℃. The next day, select single clones for sequencing.
[0043] Sequencing and analysis results indicate that the cloned... NtNPF6.7 The gene sequence is shown in SEQ ID NO.1, and its encoded amino acid sequence is shown in SEQ ID NO.2.
[0044] Example 2 Tobacco NtNPF6.7 Gene expression analysis For research NtNPF6.7 This example describes the expression of genes in various tissues of tobacco. Roots, stems, leaves, and flowers of tobacco K326 were collected, and quantitative real-time PCR was used to analyze their expression. NtNPF6.7 Gene expression was analyzed, and the specific procedures were as follows: 1. Collection of tissue samples Commonly cultivated tobacco variety K326 was grown in the plant culture room of the National Tobacco Gene Research Center under the following conditions: temperature (23±1)℃, relative humidity 60%±2%, 16 h of light culture, and 8 h of darkness culture. Roots, stems, and leaves were harvested and flash-frozen in liquid nitrogen for preservation when the seedlings reached their vigorous growth stage; flowers were harvested and flash-frozen in liquid nitrogen for preservation when the seedlings reached their full flowering stage.
[0045] 2. qPCR detection NtNPF6.7 Gene expression status RNA was extracted from the preserved material, and cDNA was synthesized using a reverse transcription kit. Then, tobacco... Nt26S The gene was used as an internal control for quantitative real-time PCR detection. The primer sequences for the detection were designed as follows: Detection NtNPF6.7The primers for quantitative fluorescence of the gene are as follows: RT- NtNPF6.7 -F: 5'-CTGGACAAGGCTGCTATAGT-3' (as shown in SEQ ID NO.5); RT- NtNPF6.7 -R: 5'-CTCAACTCTTGTCACTGTG-3' (shown in SEQ ID NO.6).
[0046] Tobacco testing Nt26S For gene sequencing, the specific primers are: Nt26S -F: 5'-GAAGAAGGTCCCAAGGGTTC -3' (shown in SEQ ID NO.7); Nt26S -F: 5'-TCTCCCTTTAACACCAACGG -3' (as shown in SEQ ID NO.8).
[0047] The reaction system for real-time PCR was as follows: 10 μL of 2×SYBRGreen premix; 1 μL of cDNA; 0.5 μL each of upstream and downstream primers; and 8 μL of H2O.
[0048] The conditions for quantitative real-time PCR are as follows: Step 1: pre-denaturation, 95℃ for 10 s; Step 2: PCR reaction, 95℃ for 5 s, 60℃ for 30 s, 39 cycles; Step 3: melting curve.
[0049] Each sample was biologically replicated three times, using 2 -△△CT Methods were used to analyze relative differences in gene expression. Results are as follows: Figure 1 As shown, NtNPF6.7 The gene is expressed at the highest levels in the stem and flower.
[0050] Example 3 NtNPF6.7 Preliminary analysis of gene function For research NtNPF6.7 The specific response of genes to salt stress was demonstrated in this example by treating conventionally cultivated tobacco K326 with salt stress. Roots were collected at different treatment times, and quantitative real-time PCR was used to analyze the results. NtNPF6.7 Gene expression was analyzed, and the specific procedures were as follows: 1. Salt stress experiment Commonly cultivated tobacco variety K326 was grown in the plant culture room of the National Tobacco Gene Research Center under the following conditions: temperature (23±1)℃, relative humidity 60%±2%, 16 h of light followed by 8 h of darkness. Once the seedlings reached the six-true-leaf stage, they were transferred to Hoagland's nutrient solution for further cultivation. One week later, when changing the nutrient solution, 300 mM NaCl was added. Root samples were collected at 0 h, 12 h, 3 d, and 7 d of salt treatment. Before sampling, the roots were rinsed with distilled water, blotted dry with absorbent paper, flash-frozen in liquid nitrogen, and then stored at -80℃. Three independent replicates were established for each line, with at least three seedlings of uniform growth selected for each replicate.
[0051] 2. qPCR detection NtNPF6.7 Gene expression level The experimental method is the same as described in Example 2, and will not be repeated here.
[0052] Analysis results as follows Figure 2 As shown, after salt stress, NtNPF6.7 Gene expression levels decreased significantly, especially after 12 hours of salt stress, indicating that... NtNPF6.7 This gene plays a role in salt stress.
[0053] Example 4 NtNPF6.7 Construction of gene knockout tobacco plants Based on Examples 1-3, in order to determine NtNPF6.7 To investigate the function of this gene in the absorption and transport of chloride ions in tobacco, this embodiment utilizes gene editing to knock out the gene. The specific implementation steps are as follows: 1. Construction of gene editing vectors Target sites were designed based on the recognition characteristics of the CRISPR / Cas9 system. NtNPF6.7 Design a 20bp sgRNA target sequence (e.g., from the third exon region of the gene) Figure 3 As shown): GCCTTGTACCTCATAGCATT (as shown in SEQ ID NO.9).
[0054] Design knockout primer sequences based on sgRNA target sequences. NtNPF6.7 -T1_F and NtNPF6.7 -T1_R is as follows: NtNPF6.7 -T1_F:5'-TTCTAGCTCTAAAACAATGCTATGAGGTACAAGGCTGCACCAGCCGGGAAT-3' (shown in SEQ ID NO.10); NtNPF6.7-T1_R:5'-TTCTAGCTCTAAAACAATGCTATGAGGTACAAGGC-3' (shown in SEQ ID NO. 11).
[0055] The reaction system was designed to obtain the target site's DNA double strand (annealing). The 20 μL reaction system is as follows: Annealing Buffer for DNA Oligos (5×), 4 μL; Upstream and downstream primers ( NtNPF6.7 -T1_F、 NtNPF6.7 -T1_R), 4 μL each (50 μmoL / μL); Nuclease-free water was added to bring the volume up to 20 μL.
[0056] The reaction procedure is as follows: 95℃ for 5 min, then decrease the temperature by 0.1℃ every 8 s until it reaches 25℃; the reaction product can be stored at 4℃ for later use, or it can be directly used for subsequent reactions.
[0057] The annealed product was ligated into a BsaI-digested CRISPR / Cas9 vector, and samples were screened to obtain the knockout target. NtNPF6.7 The CRISPR / Cas9 expression vector for the gene, with a 20 μL ligation system, was designed as follows: Annealed product, 6 μL; Enzyme digestion product (CRISPR / Cas9 vector digested with BsaⅠ), 3 μL; 10× T4 DNA Ligase Buffer, 2 μL; T4 DNA Ligase, 1 μL; Add sterile water to 20 μL and connect at 37°C for 3 h.
[0058] The ligation product was then transformed into competent E. coli cells. Positive clones were selected, cultured in large quantities, and plasmids were extracted. After confirming the successful vector construction by PCR, the cells were stored at low temperature for Agrobacterium transformation.
[0059] 2. Genetic transformation of tobacco The gene-editing vector constructed above was transformed into Agrobacterium, and then into tobacco to obtain... NtNPF6.7 The specific experimental process for gene knockout transgenic plants is briefly described below: (1) Agrobacterium transformation Remove Agrobacterium GV3101 competent cells from a -80℃ freezer, freeze-thaw them on ice, and add 5 μL of the pre-constructed gene-editing vector just before thawing. Gently mix. Incubate on ice for 30 min, freeze in liquid nitrogen for 5 min, then incubate in water at 37℃ for 5 min, and immediately place on ice. Add 900 μL of antibiotic-free LB liquid medium and incubate at 200 rpm with shaking for 4 h. Centrifuge the bacterial suspension at 4500 rpm for 3 min, discard half of the supernatant, resuspend the suspension, and evenly spread it on LB solid medium containing Rifampicin (100 μg / mL) and Kan (50 μg / mL). Incubate upside down at 28℃ for about 2-3 days until single colonies form. Pick single colonies, expand the culture, and perform PCR identification on the bacterial suspension. The correctly identified positive clones are the correctly transformed engineered bacteria.
[0060] (2) Tobacco Conversion Leaves from sterile tobacco seedlings that have grown for about one month were taken and perforated into leaf discs with a diameter of 0.5 cm using a perforator. The perforated leaf discs were then pre-cultured on MS solid medium for 3 days. The transformed Agrobacterium tumefaciens prepared above was then cultured until OD200. 600 =Approximately 0.6, collect bacterial cells by centrifugation at 4000 rpm for 5 min, and then suspend the bacterial cells in 20 mL of MS liquid medium; then place the pre-cultured leaf discs in the bacterial solution and infect for 10 min; blot off excess bacterial solution around the infected leaf discs with sterile filter paper, and incubate in the dark for 3 days on MS + 6-BA (6-benzylaminopurine, 2 mg / L) + NAA (naphthaleneacetic acid, 0.5 mg / L) solid medium; wash the leaf discs with sterile water containing Cef (cefotaxime sodium, 400 mg / L), and blot off excess liquid with sterile filter paper, then transfer the leaf discs to MS solid selection medium containing 6-BA (2 mg / L), NAA (0.5 mg / L), Cef (200 mg / L), and Kan (50 mg / L), and incubate under light at 28℃; when the adventitious shoots grow to 0.5 cm, transfer them to a medium containing Cef (200 mg / L) and Kan (50 mg / L). Rooting occurred on MS solid medium (mg / L).
[0061] 3. Identification of gene-edited strains After about one month of growth, a small number of leaves were taken, and DNA was extracted according to the instructions of the plant genome extraction kit. Positive transgenic lines and mutation forms were detected using PCR amplification, cloning, and sequencing. The specific identification method is as follows: exist NtNPF6.7 On the genome, a pair of detection primers were designed, located on either side of the knockout target site, specifically: NtNPF6.7-JF:5'-ggagtgagtacggtgtgcCCATCGTCATGATGTCAAT-3' (shown in SEQ ID NO. 12); NtNPF6.7 -JR:5'-gagttggatgctggatggTCATCTTGGATGTAAACAAG-3' (shown in SEQ ID NO. 13).
[0062] Using T0 generation transgenic DNA as a template, PCR amplification was performed. The PCR conditions were: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 40 s, for a total of 25 cycles; followed by a final extension at 72℃ for 10 min. The PCR products were sent to Hi-tom for sequencing. The sequencing results were analyzed to determine whether editing had occurred and the type of mutation.
[0063] Sequencing results as follows Figure 4 As shown, in 11 T0 generation plants, [the following was detected] NtNPF6.7 There are three forms of gene mutations, all of which occur at the knockout target site, while wild-type plants... NtNPF6.7 No mutations were detected in the genes, indicating that the mutations have been successfully achieved in the T0 generation plants. NtNPF6.7 The gene was knocked out.
[0064] Example 5 NtNPF6.7 Gene regulation of chloride ion transport in tobacco Based on Example 3, in order to investigate tobacco NtNPF6.7 Regarding the function of chloride ion absorption and transport in tobacco, this embodiment measures the chloride ion content in the leaves of the gene-edited plants constructed in Example 4 and the control plants. The specific implementation is as follows: 1. Planting NtNPF6.7 Gene-edited plants (T1 generation) and control plants (K326 generation) were cultured in the plant culture room of the National Tobacco Gene Research Center under the following conditions: temperature (23±1)℃, relative humidity 60%±2%, 16 h light exposure followed by 8 h darkness. At the vigorous growth stage, leaves were collected for subsequent chloride ion content determination. Each line was divided into three independent replicates, with at least three seedlings of uniform growth selected for each replicate.
[0065] 2. Determination of chloride ion content After freeze-drying the preserved leaf samples, they were ground into powder using a mixing oscillating grinder. Approximately 0.0500 g (accurate to 0.1 mg) of the powder was weighed and placed in 10 mL of 5% (volume fraction) acetic acid. The mixture was then extracted by shaking at 30°C for 30 min. The extract was then filtered through qualitative filter paper. After dilution, the chloride ion content of the filtrate was determined using an Alalis MP6500 benchtop pH meter.
[0066] The measurement results are as follows Figure 5 As shown, NtNPF6.7 After gene editing, the chloride ion content in the leaves decreased significantly.
[0067] Based on the above results, NtNPF6.7 Genes are closely related to chloride ion transport in tobacco. Inhibiting the expression of this gene significantly reduces the chloride ion content in tobacco leaves. In practical applications, genetic engineering techniques can be used to inhibit chloride ion transport in tobacco. NtNPF6.7 Gene expression can reduce the chloride ion content in tobacco leaves, thereby obtaining low-chlorine tobacco varieties, which can significantly accelerate the breeding process of low-chlorine varieties.
[0068] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. NtNPF6.7 The application of genes in regulating chloride ion transport in tobacco is characterized by: inhibition NtNPF6.7 Gene expression was significantly reduced, and chloride ion content in tobacco leaves was also significantly decreased. NtNPF6.7 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. As described in claim 1 NtNPF6.7 The application of genes in regulating chloride ion transport in tobacco is characterized by: The inhibition NtNPF6.7 Gene expression is used to construct gene-editing vectors for tobacco. NtNPF6.7 Genes are knocked out.
3. As described in claim 2 NtNPF6.7 The application of genes in regulating chloride ion transport in tobacco is characterized by: The method for constructing the gene editing vector includes the following steps: ligating the target site double-stranded DNA into the empty gene editing vector and sequencing for identification.
4. The method according to claim 3 NtNPF6.7 The application of genes in regulating chloride ion transport in tobacco is characterized by: The sgRNA sequence corresponding to the target site double-stranded DNA is shown in SEQ ID NO.
9.
5. The method according to any one of claims 1 to 4 NtNPF6.7 The application of genes in regulating chloride ion transport in tobacco is characterized by: The tobacco variety is K326.
6. NtNPF6.7 The application of genes in obtaining low-chlorine tobacco varieties is characterized by: By inhibiting NtNPF6.7 Gene expression reduces chloride ions in tobacco leaves, resulting in low-chlorine tobacco varieties; NtNPF6.7 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
7. The method according to claim 6 NtNPF6.7 The application of genes in obtaining low-chlorine tobacco varieties is characterized by: The inhibition NtNPF6.7 Gene expression is used to construct gene-editing vectors for tobacco. NtNPF6.7 Genes are knocked out.
8. The method according to claim 7 NtNPF6.7 The application of genes in obtaining low-chlorine tobacco varieties is characterized by: The method for constructing the gene editing vector includes the following steps: ligating the target site double-stranded DNA into the empty gene editing vector and sequencing for identification.
9. The method according to claim 8 NtNPF6.7 The application of genes in obtaining low-chlorine tobacco varieties is characterized by: The sgRNA sequence corresponding to the target site double-stranded DNA is shown in SEQ ID NO.
9.
10. The claim 7 to 9 NtNPF6.7 The application of genes in obtaining low-chlorine tobacco varieties is characterized by: The low-chlorine tobacco varieties were obtained by the following method: gene-editing vectors were transformed into Agrobacterium as an infection solution, and then tobacco was transformed. Through screening and identification, tobacco varieties with significantly reduced chloride ion content in leaves were obtained.
Citation Information
Patent Citations
Tobacco chloride channel protein NtCLC13 and its encoding gene and application
CN117025627B
Tobacco CBL family gene NtCBL10, bio-based material containing same and application
CN119193674A