Genetically engineered bacteria with high yield of l-arginine, and construction method and application thereof

CN122521740BActive Publication Date: 2026-09-22GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610983943.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-07-03
Publication Date
2026-09-22
Estimated Expiration
2046-07-03

AI Technical Summary

Technical Problem

然而,方案多存在如下局限性:(1)使用强诱导型启动子(如Ptrc),在大规模发酵中需添加昂贵的诱导剂,增加了工艺复杂性和生产成本;(2)对L-精氨酸合成途径内部的代谢节点调控不够精细,未能充分挖掘途径内关键限速酶的协同增效潜力;(3)部分改造在质粒上进行,面临质粒丢失和表达不稳定等问题

Benefits of technology

[0030]1、系统性敲除降解、竞争性及副产物相关基因,阻断无效代谢循环,减少碳源与氮源损耗,显著提升底物利用率;

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122521740B_ABST
    Figure CN122521740B_ABST
Patent Text Reader

Abstract

The application discloses a genetically engineered bacterium with high L-arginine yield and a construction method and application thereof, and belongs to the technical field of genetic engineering and metabolic engineering. The genetically engineered bacterium with high L-arginine yield is obtained by modifying an Escherichia coli W3110 as a starting strain in the following manners: (1) gene knockout: crr, pflB, argR, speA, speF, adiA and astA; (2) gene integration and expression: integrating nar-vhb at an ldhA site, integrating trc-glk-galP modules at an adhE site, integrating grcA-argCJBDF at a speC site, and integrating grcA-argGH-lysE at an adiA site; and (3) key gene regulation: synergistically overexpressing argJ and argB, and expressing the genes in a genomic integration form with a PglgS or Pylb as a promoter, so as to obtain a genetically stable and high-yield L-arginine synthesis strain. The shake flask fermentation result shows that the L-arginine yield can reach 28 g / L, and the glucose yield can reach 0.7 g / g.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a recombinant strain that efficiently produces L-arginine by rationally modifying the metabolic network of Escherichia coli, the construction method of the strain, and its application in the fermentation production of L-arginine. Background Technology

[0002] L-arginine, a semi-essential amino acid, has wide applications in pharmaceuticals, food, feed, and cosmetics, and market demand continues to grow. Currently, the industrial production of L-arginine mainly relies on microbial fermentation. Compared with traditional mutagenesis screening, using genetic engineering technology to perform targeted and rational metabolic engineering modifications on production strains is the core strategy for improving L-arginine yield and production efficiency while reducing production costs.

[0003] Escherichia coli, with its clear genetic background, abundant molecular manipulation tools, short growth cycle, and ease of large-scale cultivation, has become an important substrate microorganism for the production of L-arginine and other high-value-added amino acids. However, the metabolic flux of L-arginine in wild-type E. coli is strictly and complexly regulated, with low carbon source-to-target product conversion efficiency and multiple competing metabolic pathways, resulting in wild-type strains accumulating almost no L-arginine. Therefore, systematic metabolic engineering of E. coli, especially the synergistic optimization of the L-arginine synthesis pathway, precursor supply network, competitive bypass, and product transport system, is crucial for constructing high-yielding strains.

[0004] In the existing technology, there are reports of increasing L-arginine production by enhancing the expression of key enzymes in the synthesis pathway and knocking out repressor proteins (such as ArgR) and degradation pathway genes (such as speA). However, the schemes have the following limitations: (1) the use of strongly inducible promoters (such as Ptrc) requires the addition of expensive inducers in large-scale fermentation, which increases the complexity of the process and the production cost; (2) the regulation of metabolic nodes within the L-arginine synthesis pathway is not precise enough, and the synergistic potential of key rate-limiting enzymes in the pathway is not fully explored; (3) some modifications are carried out on plasmids, which face problems such as plasmid loss and unstable expression.

[0005] Therefore, developing a genetically stable strain that can efficiently produce L-arginine without the need for inducing agents and through fine reconstruction of the endogenous metabolic network is of great value for achieving economical and efficient industrial production. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the existing technology and provide a genetically engineered bacterium with a clear genetic background, well-defined modification targets, and significantly improved L-arginine production and yield.

[0007] Another objective of this invention is to provide a method for constructing the above-mentioned genetically engineered bacteria, which achieves a stepwise improvement in strain performance by systematically knocking out competitive and degradative genes, precisely regulating key synthetic genes, optimizing module expression, weakening diversion pathways, blocking by-product pathways, and reshaping the nitrogen metabolism system.

[0008] Another objective of this invention is to provide the application of the above-mentioned genetically engineered bacteria in the fermentation production of L-arginine, so as to achieve stable fermentation with high yield and high efficiency.

[0009] Technical solution

[0010] The genetically engineered bacterium that produces high levels of L-arginine in this invention was constructed using the following method, with *Escherichia coli* W3110 as the starting strain and the following modifications:

[0011] (1) Knockout genes: crr, pflB, argR, speA, speF, adiA, astA;

[0012] (2) Gene integration and expression: nar-vhb is integrated at the ldhA site; the trc-glk-galP module is integrated at the adhE site; the grcA-argCJBDF is integrated at the speC site; and the grcA-argGH-lysE is integrated at the adiA site.

[0013] (3) Key gene regulation: argJ and argB are co-expressed with promoters PglgS or Pylb, and expressed in a genome-integrated form;

[0014] The specified gene IDs are: crr (Gene ID: 946880), ldhA (Gene ID: 946315), adhE (Gene ID: 945837), pflB (Gene ID: 945514), argR (Gene ID: 947861), speA (Gene ID: 947432), speF (Gene ID: 945297), speC (Gene ID: 947457), adiA (Gene ID: 948638), astA (Gene ID: 946261); nar (Gene ID: 945783); vhb (GenBank: L21670.1); glk and galP (Gene IDs: 946858 and 947434 respectively); and argC, J, B, D, and F (Gene IDs: 31923978 and 31923977 respectively). 31923976; 31923975; 31923974; grcA is Gene ID: 947068; argG and H are Gene IDs: 31923972 and 31923971 respectively; lysE is Gene ID: 1019244, and the nucleotide sequence of trc is GTTGACAATTAATCATCCGGCTCGTATAATGTGT (SEQ ID NO. 276); argJ is Gene ID: 31923977; argB is Gene ID: 948464; PglgS is Gene ID: 947533, and the nucleotide sequence of Pylb is ATTTTTTTTAAAAAAATATTTGACATTTTTAAATAAAGCGTTTATAATATATGTAGAAACAACA (SEQ ID NO. 277).

[0015] Preferably, the co-expression of argJ and argB is a two-gene module in the order argB-argJ that exists in the form of argA site integration in the genome, resulting in strain Warg028.

[0016] Preferably, strain Warg028 was further enhanced with an amino donor system: the gdhA-glnA-carAB module was overexpressed in a genome-integrated form using the Pylb promoter to obtain strain Warg035, with gdhA as Gene ID: 946802; glnA as Gene ID: 948370; carA as Gene ID: 949025; and carB as Gene ID: 944775.

[0017] Preferably, strain Warg035 also underwent competitive attenuation: the fhuA gene was knocked out, and the promoter of the sucA gene was replaced with the Pflic promoter to achieve expression attenuation, resulting in strain Warg036; sucA is Gene ID: 945303; fhuA is Gene ID: 944856.

[0018] Preferably, strain Warg036 also had the argE gene knocked out, resulting in strain Warg037; argE is Gene ID: 948456.

[0019] Preferably, strain Warg037 also replaced the promoter of the proB gene with the Pflic promoter to achieve attenuated expression, resulting in strain Warg038; proB is Gene ID: 946425; Pflic is Gene ID: 949101.

[0020] Preferably, strain Warg038 also replaces the promoter of the amtB gene with the PargO promoter; at the same time, the glnK gene is knocked out, resulting in strain Warg040, with the PargO promoter being Gene ID: 947418; amtB being Gene ID: 945084; and glnK being Gene ID: 945087.

[0021] Preferably, strain Warg040 also replaces the promoter of the ackA-pta gene with the Pflic promoter to obtain strain Warg042, where ackA is Gene ID: 946775 and pta is Gene ID: 946778.

[0022] The specific construction method of the above-mentioned genetically engineered bacteria includes the following steps in sequence:

[0023] (1) Construction of arginine synthesis chassis cells Warg000: In W3110, the following genes were knocked out: crr (Gene ID: 946880), ldhA (Gene ID: 946315), adhE (Gene ID: 945837), pflB (Gene ID: 945514), argR (Gene ID: 947861), speA (Gene ID: 947432), speF (Gene ID: 945297), speC (Gene ID: 947457), adiA (Gene ID: 948638), and astA (Gene ID: 946261); nar-vhb (nar, Gene ID: 945783; vhb GenBank: L21670.1) was integrated at the ΔldhA site; and trc(ΔlacO)-glk-galP (Gene ID: 945783; vhb GenBank: L21670.1) was integrated at the ΔadhE site. 946858; 947434); grcA-argCJBDF (Gene ID: 31923978; 31923977; 31923976; 31923975; 31923974; grcA, Gene ID: 947068 ;) was integrated at the ΔspeC site; grcA-argGH-lysE (Gene ID: 31923972; 31923971; lysE, Gene ID: 1019244) was integrated at the ΔadiA site to obtain the basic synthetic strain Warg000; (trc, GTTGACAATTAATCATCCGGCTCGTATAATGTGT)

[0024] (2) Optimization of argJ and argB co-expression: Based on Warg000, argJ (Gene ID: 31923977) and argB (Gene ID: 948464) were overexpressed individually and co-expressed in different combinations to determine that co-expression is a necessary condition for high yield; promoters such as Pthr (Gene ID: 945803), PgrcA (Gene ID: 947068), PglgS (Gene ID: 947533), and Pylb were screened, and PglgS was found to be the best; further, the genome of the expression module was integrated, and it was determined that the genome integration form driven by Pylb was 30% better than the plasmid form, and strain Warg028 was obtained; (Pylb, ATTTTTTTTAAAAAAATATTTGACATTTTTAAATAAAGCGTTTATAATATATGTAGAAACAACA);

[0025] (3) Enhanced amino donor synthesis system: Using Warg028 as the starting strain, two methods were employed: plasmid and genome integration. Overexpression of gdhA (Gene ID: 946802), glnA (Gene ID: 948370), and carAB (carA, Gene ID: 949025; carB, Gene ID: 944775) was performed using the PglgS and Pylb promoters, respectively. The optimal combination for genome integration of the gdhA-glnA-carAB module driven by the Pylb promoter was determined, with a 20% increase in yield compared to Warg028.

[0026] (4) Weakening competitive branching pathways: The promoters of sucA (Gene ID: 945303) and ackA-pta (ackA, Gene ID: 946775; pta, Gene ID: 946778) were replaced with the Pflic (Gene ID: 949101) promoter, and the promoter of proB (Gene ID: 946425) was replaced with the PargO promoter, so that more carbon metabolic flux was directed to L-arginine synthesis, resulting in an 86% increase in yield;

[0027] (5) Blocking byproducts and optimizing nitrogen metabolism: Knock out the acetic acid production-related gene argE (Gene ID: 948456); knock out the ammonia metabolism negative regulator gene glnK (Gene ID: 945087); and simultaneously overexpress the ammonia transporter gene amtB (Gene ID: 945084), further increasing the yield by 22%, ultimately obtaining a high-yielding strain.

[0028] The above-mentioned genetically engineered bacteria were used in the fermentation production of L-arginine using conventional microbial fermentation technology. After fermentation, the yield of L-arginine reached 28 g / L and the glucose yield reached 0.7 g / g.

[0029] Beneficial effects:

[0030] 1. Systematically knock out genes related to degradation, competition, and byproducts, block ineffective metabolic cycles, reduce carbon and nitrogen source depletion, and significantly improve substrate utilization;

[0031] 2. By employing synergistic expression and optimal promoter combination for argJ and argB, and achieving stable high expression through genome integration, we have overcome the pathway rate-limiting bottleneck.

[0032] 3. The gdhA-glnA-carAB module is enhanced by Pylb promoter genome integration to efficiently supply amino donors and carbamoyl phosphate, ensuring a continuous supply of synthetic precursors;

[0033] 4. Dynamically weaken the sucA, proB, and ackA-pta splitting pathways to precisely regulate carbon metabolism flux distribution; at the same time, optimize the ammonia transport and nitrogen metabolism regulation system to further improve synthesis efficiency;

[0034] 5. The final strain is genetically stable, plasmid-free, and exhibits excellent fermentation performance, with an L-arginine yield of 28 g / L and a glucose yield of 0.7 g / g, making it suitable for industrial-scale production. Attached Figure Description

[0035] Figure 1 The diagram shows the effects of overexpressing the argJ and / or argB genes in plasmid form with different promoters on L-arginine production in the chassis strain Warg000; A is a schematic diagram of the expression forms; B is the strain yield; and C is the strain biomass.

[0036] Figure 2 The image shows a comparison of L-arginine production in different engineered strains of the chassis strain Warg000 after the argJ-argB module was controlled by different promoters and integrated into the genome; A is a schematic diagram of expression; B is the strain yield; and C is the strain biomass.

[0037] Figure 3 The diagram shows the effects of different gene sequences (argJ-argB and argB-argJ) and different gene sources (endogenous in Escherichia coli and exogenous in Corynebacterium glutamicum) on L-argine production in the chassis strain Warg000. A represents the expression pattern; B represents the strain yield; and C represents the strain biomass.

[0038] Figure 4 To compare the effects of different linkage forms between the argB and argJ genes on L-argine production in the chassis strain Warg000 (Figure A: Schematic diagram of expression forms; B: strain yield; C: strain biomass).

[0039] Figure 5 This is a comparison of the effects of plasmid overexpression and genome integration of the four gene modules argJ-argB-gltA-gdhA on L-argine production in the chassis strain Warg000; A is a schematic diagram of the expression form; B is the strain yield; and C is the strain biomass.

[0040] Figure 6To compare the effects of plasmid and genome integration methods on L-arginine production in different arginine-synthesizing strains, and using the Pglgs and Pylb promoters to overexpress the gdhA-glnA-carAB module, the following diagram is presented: A is a schematic diagram of the expression form; B is the strain yield; and C is the strain biomass.

[0041] Figure 7 The graph shows the comparison of L-arginine production and yield of strains at each stage after gradually weakening the competitive pathway (sucA promoter replacement), modifying the acetic acid pathway (ackA-pta), and optimizing ammonia metabolism regulation (glnK knockout and amtB overexpression) based on the optimal strain. A represents strain yield; B represents strain biomass; and C represents sugar-acid conversion rate. Detailed Implementation

[0042] The technical solution of the present invention will be further described in detail below through specific embodiments. It should be noted that the following embodiments are only for explaining the present invention and do not constitute any limitation on the scope of protection of the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional molecular biology, microbiology, and fermentation engineering methods. Unless otherwise specified, the reagents, plasmids, strains, and other materials used are all available from publicly available commercial sources.

[0044] Arginine fermentation medium (g / L): glucose 40, peptone 2, yeast extract 5, betaine 0.5, (NH4)2SO4 20, K2HPO4 6, MgSO4·7H2O 2, FeSO4·7H2O 0.02, MnSO4·7H2O 0.02, calcium carbonate 20.

[0045] Table 1 Primers used for constructing strains in the embodiments of the present invention

[0046] ;

[0047] ;

[0048] ;

[0049] ;

[0050] ;

[0051] ;

[0052] ;

[0053] ;

[0054] ;

[0055] ;

[0056] ;

[0057]

[0058] Example 1: Construction of L-arginine synthesis chassis cell Warg000

[0059] This embodiment aims to construct a chassis cell that fundamentally removes the negative regulation of arginine synthesis and blocks its main degradation and competitive pathways, laying the foundation for subsequent fine regulation.

[0060] Using *Escherichia coli* W3110 as the starting strain, whose genome is highly similar to MG1655, this minimally modified K-12-derived strain is suitable as an industrial chassis. The following modifications were performed sequentially using CRISPR-Cas9-mediated scarless gene editing technology:

[0061] (1) Knockout of the crr gene: The crr gene encodes the enzyme IIAGlcGlc component of the glucose-specific PTS system. Knocking out this gene can weaken the consumption of phosphoenolpyruvate (PEP) by the PTS system, making more PEP available for the complementation pathway, thereby increasing the supply of the precursor oxaloacetate. Taking the construction of a crr gene knockout strain as an example, the guide plasmid was first constructed by amplifying the primer crr-CRISPR-F / R and using the plasmid pTarget reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Using the Escherichia coli W3110 genome as a template, homologous arms of the crr target gene were amplified by PCR using primers crr-UP-F / crr-UP-R and crr-DOWN-F / crr-DOWN-R. The knockout target block was obtained by ligating the homologous arms by fusion PCR. The guide plasmid and the knockout target block were then introduced into E. coli W3110 containing the pCas plasmid reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Positive clones were verified using primers crr-UP-F / crr-check-R, completing the gene knockout and yielding E. coli with crr knocked out. Other gene knockouts (pflB, argR, speA, speF, adiA) were performed using a similar method, with the corresponding primers listed in Table 1.

[0062] Integration of the nar-vhb module at the ldhA site: First, using primers ldhA-CRISPR-F / R, a guide plasmid was constructed by amplifying the plasmid pTarget as reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Using the Escherichia coli W3110 genome as a template, the promoter was amplified using primers nar-F / R; using the fully synthesized vhb as a template, the vhb gene was amplified using primers vhb-F / R, and the promoter and vhb gene were ligated by fusion PCR to obtain the expression module. Using the commercial plasmid pACYC-Duet-1 as a template, the plasmid backbone was amplified using primers pACYC-F0707 / R0707, and then ligated to the expression module to construct the plasmid, which served as the template for the next amplification step. The expression module containing the homologous arm was obtained by PCR amplification using long primers ldhA-F / R (containing a 50 bp homologous arm). The guide plasmid, along with the expression target block containing homologous arms, was introduced into *E. coli* that had its crr knockout module (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigeneediting in the *Escherichia coli* genome via the CRISPR-Cas9 system. *Applied and environmental microbiology*, 81(7), 2506–2514.). Positive clones were verified using primers ldhA-F / ldhA-check-R, and the expression module genome integration was completed, resulting in *E. coli* with crr knockout and nar-vhb module integration.

[0063] Integration of the trc-glk-galP module at the adhE site: First, using primers adhE-CRISPR-F / R, the guide plasmid was constructed by amplifying the plasmid pTarget as a template, as reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigeneediting in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Using the plasmid containing the trc-glk-galP module from the literature (Su, B., Lai, P., Deng, MR, & Zhu, H. (2024). Design of a dual-responding genetic circuit for high-throughput identification of L-threonine-overproducing Escherichia coli. Bioresource technology, 395, 130407.) as a template, PCR amplification was performed using long primers adhE-LA-F / adhE-RA-R to obtain the expression module containing homologous arms. The guide plasmid, along with the expression module containing homologous arms, was introduced into *E. coli* containing the pCas plasmid with the knockout crr and nar-vhb modules reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Positive clones were verified using primers adhE-LA-F / adhE-check-R, and the expression module genome integration was completed, resulting in *E. coli* with the knockout crr, nar-vhb, and trc-glk-galP modules integrated.

[0064] (2) E. coli with knockout of crr, nar-vhb module integration and trc-glk-galP module integration were obtained by knocking out the pflB gene using the primers in Table 1 in the same way as knocking out the crr gene.

[0065] Knockout of key genes in the mixed acid fermentation pathway: The ldhA gene encoding lactate dehydrogenase, the adhE gene encoding alcohol dehydrogenase, and the pflB gene encoding pyruvate-formate lyase were knocked out sequentially. Knockout of these genes significantly reduced the production of byproducts such as lactic acid, ethanol, and formic acid, directing more carbon metabolic flux toward the synthesis of the target product.

[0066] (3) Continue to knock out the argR gene in E. coli that have knocked out crr, pflB, nar-vhb module integration and trc-glk-galP module integration. Following the same method as knocking out the crr gene, knock out the argR gene using the primers in Table 1 to obtain E. coli that have knocked out crr, pflB, argR, nar-vhb module integration and trc-glk-galP module integration.

[0067] To relieve feedback repression in the arginine synthesis pathway, the argR gene, which encodes the global repressor protein of the arginine synthesis pathway, was knocked out. The ArgR protein negatively regulates the expression of all genes in the arginine synthesis pathway; knocking out this gene can relieve the transcriptional repression of the synthesis pathway by the end products.

[0068] (4) Continue to knock out the speA and adiA genes in the E. coli that have knocked out crr, pflB, argR, nar-vhb module integration and trc-glk-galP module integration. Following the same method as knocking out the crr gene, knock out the speA and adiA genes in the same way as knocking out the crr gene, and obtain E. coli that have knocked out crr, pflB, argR, speA, adiA, nar-vhb module integration and trc-glk-galP module integration.

[0069] Blocking the arginine degradation pathway: The speA gene encoding arginine decarboxylase and the astA gene encoding arginine succinyltransferase were knocked out sequentially. First, using primer astA-CRISPR-F / R, the guide plasmid was amplified using the plasmid pTarget reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). The guide plasmid was directly introduced into the genome containing the astA site homologous arm along with the synthesized long primer astA-deletion. The CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.) reported the knockout of the pCas plasmids crr, pflB, argR, speA, adiA, nar-vhb module integration, and trc-glk-galP module integration of E. coli. The positive clones were verified using primers astA-deletion / astA-check-R to complete the gene knockout. E. coli with the knockout of crr, pflB, argR, speA, adiA, astA, nar-vhb module integration, and trc-glk-galP module integration were obtained. Simultaneously, based on the E. coli with knockout of crr, pflB, argR, speA, adiA, astA, nar-vhb module integration, and trc-glk-galP module integration, the speF gene encoding ornithine decarboxylase was knocked out to obtain E. coli with knockout of crr, pflB, argR, speA, adiA, astA, speF, nar-vhb module integration, and trc-glk-galP module integration. Then, speC (speC in step 5) was knocked out to further block the degradation of arginine protozoa or the metabolic diversion towards polyamine synthesis.

[0070] (5) Enhance the arginine synthesis pathway: At the sites where speC and adiA are knocked out, constitutively expressed L-arginine synthesis gene clusters grcA-argCJBDF and grcA-argGH-lysE are integrated.

[0071] Integration of the grcA-argCJBDF module at the speC site: First, using primers speC-CRISPR-F / R, the guide plasmid was constructed by amplifying the plasmid pTarget as a template, as reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigeneediting in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Using the *E. coli* W3110 genome as a template, the *grcA* promoter was amplified using primers *grcA-F1201 / R1201*. Using the *Corynebacterium glutamicum* ATCC 13032 genome as a template, the *argC*, *argJ*, *argB*, *argD*, and *argF* genes were amplified using primers *argC-F0907 / argC-R0821*, *argJ*, *argB*, *argD*, and *argF*, respectively. These genes were then ligated by fusion PCR to obtain the *argCJBDF* expression module. Using the commercially available plasmid *pACYC-Duet-1* as a template, the plasmid backbone was amplified using primers *pACYC-argCJBDF-F / R*, and ligated with the *argCJBDF* expression module to construct a plasmid, which served as the template for the next amplification step. The grcA-argCJBDF expression module was obtained by PCR amplification using primers grcA-F1201 / argF-R1204. Using the *E. coli* W3110 genome as a template, homologous arms of the speC target gene were amplified by PCR using primers speC-UP-F / R and speC-DOWN-F1201 / speC-DOWN-R. These homologous arms were then ligated to the grcA-argCJBDF expression module via fusion PCR to construct a genome integration module containing homologous arms.The guide plasmid, along with a genome integration module containing homologous arms, was introduced into a genome containing the genome of the Escherichiacoli genome (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichiacoli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7). E. coli with knockouts of the pCas plasmid crr, pflB, argR, speA, adiA, astA, speF, nar-vhb module integration, and trc-glk-galP module integration reported in 2506–2514 were validated using primers speC-UP-check-F0321 / speC-DOWN-R. The integration of the constitutively expressed L-arginine synthesis gene cluster grcA-argCJBDF at the speC knockout site was completed, resulting in E. coli with knockouts of crr, pflB, argR, speA, adiA, astA, speF, nar-vhb module integration, trc-glk-galP module integration, and grcA-argCJBDF module integration.

[0072] Integration of the grcA-argGH-lysE module at the adiA site: First, using primers adiA-CRISPR-F / R, the guide plasmid was constructed by amplifying the plasmid pTarget as a template, as reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigeneediting in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Using the *E. coli* W3110 genome as a template, the *grcA* promoter was amplified using primers *grcA-F1201 / R1201*. Using the *Corynebacterium glutamicum* ATCC 13032 genome as a template, the *argG*, *argH*, and *lysE* genes were amplified using primers *argJ-F0821 / R0821*, *argG-F0821 / R0821*, *argH-F0821 / R0821*, and *lysE-F0821 / R0821*, respectively. The expression module *argGH-lysE* was obtained by fusion PCR. Using the commercial plasmid *pACYC-Duet-1* as a template, the plasmid backbone was amplified using primers *pACYC-argGH-F / R*, and then ligated with the expression module *argGH-lysE* to construct a plasmid, which served as the template for the next amplification step. The grcA-argGH-lysE expression module was obtained by PCR amplification using primers grcA-F1201 / lysE-R1025. Using the E. coli W3110 genome as a template, the upstream and downstream homologous arms of the adiA target gene were amplified by PCR using primers adiA-UP-F / R and adiA-DOWN-F / R. The upstream and downstream homologous arms were then ligated to the grcA-argGH-lysE expression module by fusion PCR to construct a genome integration module containing homologous arms.The guide plasmid, along with the expression target block containing homologous arms, was introduced into a sample containing the gene from the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigeneediting in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7). E. coli with knockouts of the pCas plasmid crr, pflB, argR, speA, adiA, astA, speF, nar-vhb module integration, trc-glk-galP module integration, and grcA-argCJBDF module integration reported in 2506–2514 were obtained. Positive clones were verified using primers adiA-UP-F / adiA-check-R to complete the integration of the expression modules into the genome, resulting in E. coli with knockouts of the crr, pflB, argR, speA, adiA, astA, speF, nar-vhb module integration, trc-glk-galP module integration, grcA-argCJBDF module integration, and grcA-argGH-lysE module integration.

[0073] Among them, argCJBDF and argGH together constitute the core synthetic pathway from glutamate to L-arginine, and lysE is the gene encoding an arginine transporter, which can promote the expulsion of intracellular arginine from the cell and reduce the feedback inhibition and toxicity caused by the accumulation of intracellular products. The constitutive expression element grcA is used here to provide this chassis cell with a well-defined, basal level of synthetic capacity.

[0074] After the above modifications, a chassis strain with a clear genetic background, few byproducts, no arginine feedback inhibition, and basic synthetic ability was obtained. This strain is an *E. coli* strain with the following modules integrated: crr, pflB, argR, speA, adiA, astA, speF, nar-vhb, trc-glk-galP, grcA-argCJBDF, and grcA-argGH-lysE. It is named Warg000 (genotype can be expressed as: W3110, Δcrr, ΔldhA, ΔadhE, ΔpflB, ΔargR, ΔspeA, ΔspeF, ΔspeC::grcA-argCJBDF, ΔadiA::grcA-argGH-lysE, ΔastA). Single colonies were picked from the plate and inoculated into 5 ml test tubes of culture medium, incubated at 37°C and 200 rpm for 12 hours, and then completely inoculated into 30 ml fermentation medium, incubated at 37°C and 200 rpm for 48 hours. The fermentation medium was arginine fermentation medium (the shake-flask fermentation of the following strains was carried out under the same conditions). Warg000 accumulated only trace amounts of L-arginine during shake-flask fermentation, indicating that after the restriction was lifted, certain enzymes within the pathway became new rate-limiting steps.

[0075] Example 2: Expression regulation of key nodes argJ and argB in the arginine synthesis pathway

[0076] In the chassis strain Warg000, acetylglutamate kinase (encoded by argB) and the bifunctional enzyme ornithine acetyltransferase (encoded by argJ) are key enzymes catalyzing early steps in the arginine synthesis pathway. To investigate the effects of expression regulation of these two genes on L-arginine synthesis, a systematic study was conducted in this example.

[0077] First, plasmids overexpressing argJ or argB genes individually, as well as plasmids simultaneously overexpressing argJ and argB genes, were constructed. These plasmids were then introduced into the Warg000 strain for shake-flask fermentation. The results showed that overexpression of argJ or argB individually had limited effect on increasing L-arginine production. Only when argJ and argB were co-expressed under the same operon did L-arginine production significantly increase. Figure 1 This indicates that the enzymes encoded by argJ and argB have a close synergistic effect in metabolism, and that overexpressing either gene alone cannot effectively drive the metabolic flow of the entire pathway.

[0078] Taking the construction of an argJ gene overexpression strain as an example, the argJ gene, synthesized entirely using primers argJ-F / R, was first used as a template to amplify the gene fragment. Using the pACYC-glgS-thrA plasmid from the literature (Su, B., Lai, P., Deng, MR, & Zhu, H. (2024). Design of a dual-responding genetic circuit for high-throughput identification of L-threonine-overproducing Escherichia coli. Bioresourcetechnology, 395, 130407.) as a template, the plasmid backbone containing the PglgS promoter was amplified using primers pACYC-glgS-F / pACYC-glgS-R. The two fragments were then combined using a seamless cloning kit to construct the plasmid pACYC-glgS-argJ, completing the overexpression gene plasmid construction. This plasmid was then transformed into the chassis strain Warg000 to obtain Warg002, and the empty vector was transformed into the strain Warg000 to obtain Warg001.

[0079] To construct an argB gene overexpression strain, the gene fragment was first amplified using the Escherichia coli W3110 genome as a template with primers argB(ec)-F1201 / R1201. Using the pACYC-glgS-thrA plasmid from the literature (Su, B., Lai, P., Deng, MR, & Zhu, H. (2024). Design of a dual-responding genetic circuit for high-throughput identification of L-threonine-overproducing Escherichia coli. Bioresourcetechnology, 395, 130407.) as a template, the plasmid backbone containing the PglgS promoter was amplified using primers pACYC-glgS-F / pACYC-glgS-R. The two fragments were then combined using a seamless cloning kit to construct the plasmid pACYC-glgS-argB, completing the overexpression gene plasmid construction. This plasmid was then transformed into the chassis strain Warg000 to obtain Warg003.

[0080] Simultaneously, strains overexpressing argB with different plasmid backbones were constructed. The glgS-argB(ec)-F0722 / glgS-argB(ec)-R0722 was used to amplify the glgS-argB(ec) module using the pACYC-glgS-argB plasmid as a template. The plasmid backbones were amplified using the primers pCDF-argB(ec)-F0722 / pCDF-argB(ec)-R0722 and pET30a-F0728 / pET30a-R0728, respectively, using the commercial pCDF-Duet-1 and pET30a plasmids as templates. These were then ligated into the glgS-argB(ec) module to construct the pCDF-glgS-argB(ec) and pET30a-glgS-argB(ec) plasmids. These plasmids were then transformed into the chassis strain Warg000 along with pACYC-glgS-argJ to obtain Warg004 and Warg005.

[0081] To construct the argJ-argB gene overexpression strain, firstly, using primers pACYC-glgS-F / argJ-R, the pACYC plasmid backbone containing argJ was amplified using the pACYC-glgS-argJ plasmid as a template. Then, using primers argB(ec)-F1201 / R1201, the argB gene fragment was amplified using the *E. coli* W3110 genome as a template. These two fragments were then combined using a seamless cloning kit to construct the plasmid pACYC-glgS-argJ-argB, completing the overexpression gene plasmid construction. This plasmid was then transformed into the chassis strain Warg000 to obtain Warg006.

[0082] Next, this embodiment compared four different promoters (PglgS, Pylb, PgrcA, Pthr, i.e., replacing the PglgS promoter in plasmid pACYC-glgS-argJ-argB with the promoters Pylb, PgrcA, and Pthr). Primers grcA-F1222 / grcA-R1222 amplified the PgrcA promoter, primers Pthr-F0616 / Pthr-R0616 amplified the Pthr promoter, and primers Pylb-F0626 / ... pACYC-R0628 was amplified in the first round using the pACYC-glgS-argJ-argB plasmid as a template. Then, using the PCR product as a template, a second round of amplification was performed using primers Pylb-F-2 / pACYC-R0628 to complete the amplification. The Pylb promoter was replaced (it's shorter and can be added to the primers; promoter addition is completed through two rounds of amplification). The effects of pACYC-Pylb-argJ-argB, pACYC-PgrcA-argJ-argB, and pACYC-Pthr-argJ-argB) on L-argine production when controlling the argJ-argB co-expression module were obtained. The results showed that the strain using the PglgS promoter had the highest L-argine production. Figure 1 , Figure 1 In the A sequence, PglgS, Pylb, PgrcA, and Pthr control the co-expression modules of argJ-argB (corresponding to warg006, 007, 008, and 009, respectively). PglgS is a constitutive promoter that provides an appropriate level of constitutive transcription for the argJ-argB module, thereby achieving an optimal balance of enzyme activity.

[0083] To construct genetically more stable strains, we integrated the four argJ-argB modules carrying different promoters into the argA site of the Warg000 strain genome. Evaluation of shake-flask fermentation revealed that the effect of genome integration was not simply positively correlated with the effect of plasmid form. For most promoters (including the best-performing plasmid PglgS), the L-argine yield of the integrated strains decreased significantly. However, an unexpected finding was that the argJ-argB module controlled by the Pylb promoter, after genome integration, not only did not decrease in L-argine yield compared to its plasmid form, but actually increased by 30%, becoming the strain with the highest yield in this round of modification. Figure 2PglgS, PgrcA, Pthr, and Pylb control the co-expression modules of argJ-argB, corresponding to Warg010, 011, 012, and 013, respectively. This phenomenon reveals complex differences in promoter expression intensity and regulatory patterns between plasmids and the genome, and that the Pylb promoter can better coordinate the expression of argJ-argB in the genome-integrated state.

[0084] Taking the construction of a strain that overexpresses argJ-argB at the argA site in the genome as an example, the guide plasmid was first constructed using primers argA-CRISPR-F / R and the plasmid pTarget reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S.(2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Using the previously constructed plasmid containing the argJ-argB module (pACYC-glgS-argJ-argB) as a template, the functional module was amplified by PCR using primers argJ-B(ec)-F / argJ-B(ec)-R. Using the Escherichia coli W3110 genome as a template, the upstream and downstream homologous arms of the argA gene were amplified by PCR using primers argA-UP-F / argA-UP-R and argA-DOWN-F / argA-DOWN-R. The upstream and downstream homologous arms were then ligated to the argJ-argB module via fusion PCR to obtain the integration target block. The guide plasmid and the integration target block were introduced together into the chassis strain Warg000 containing the pCas plasmid reported in the literature (Jiang, Y., Chen, B.,Duan, C., Sun, B., Yang, J.,&Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Positive clones were verified using primers argA-UP-F / argA-check-R, thus completing the genome integration of the integration target block. This resulted in the integration of four argJ-argB modules carrying different promoters into the argA site of the Warg000 strain genome. Integration of other modules was performed using a similar method, employing the primers listed in Table 1.

[0085] Based on this finding, we further explored the key factors affecting the efficiency of this co-expression module. First, we examined the gene sequence and origin of argJ and argB. We compared two co-expression modules with different sequences: argJ-argB (the previously constructed pACYC-glgS-argJ-argB) and argB-argJ (using primers pACYC-argB(ec)-F0705 / pACYC-argB(ec)-R0705 with pACYC-glgS-argB as a template to amplify the plasmid backbone, and then ligating the fragment amplified using primers argJ-F0715 / argJ-R0715 with pACYC-glgS-argJ-argB as a template to construct plasmid pACYC-glgS-argB-argJ). These modules were then transformed into Warg000 (pACYC-glgS-argB-argJ corresponds to Warg020), and expressed using endogenous E. coli genes (argAm (Gene ID: ...). The combination of primer argAm-F0722 / argAm-F0722 (947289) amplified the gene, placed in argB, and transformed into Warg000, corresponding to Warg021, and the exogenous homologous gene of Corynebacterium glutamicum (argBcg (Gene ID: 1019372), amplified with primer argB(cg)-F0805 / argB(cg)-R0805, placed in argJ, and transformed into Warg000, corresponding to Warg022). Shake-flask fermentation data showed that the L-argine yield was significantly better than other combinations when the endogenous argB gene of E. coli was placed upstream of the argJ gene in the argB-argJ arrangement. Figure 3 This suggests that relatively high levels of transcription and translation of the argB gene are more conducive to forming functional metabolic couplings with enzymes encoded by argJ.

[0086] Secondly, the effects of different linkage forms between the argJ and argB genes were investigated. Flexible linker peptides (GGGGS, amplified using primers argB-GS-F0801 / argJ-GS-R0801 for full plasmid amplification of pACYC-glgS-argJ-argB, Warg014), rigid linker peptides (EAAAK, amplified using primers argB-EAK-F0806 / argJ-EAK-R0806 for full plasmid amplification of pACYC-glgS-argJ-argB, Warg015), direct fusion (fusion, amplified using primers argB-fusion-F0808 / argJ-fusion-R0808 for full plasmid amplification of pACYC-glgS-argJ-argB, Warg016), and RA-RD binding (amplified using primers argB-RA-F / argJ-RD-R for full plasmid amplification of pACYC-glgS-argJ-argB, Warg016) were tested. The plasmid was constructed using gS-argJ-argB. Then, using the constructed plasmid with added RA as a template, the first round of amplification was performed using argJ-RD-F0805 / argJ-RD-R. The second round of amplification was then performed using argJ-RD2-F0809 / argJ-RD-R-2 as a template, allowing the addition of RD (Warg017). Artificial ligation elements (SYTlinker, using primers argB-SYTlinker-F / argJ-SYTlinker-R to amplify the full plasmid pACYC-glgS-argJ-argB, Warg018; using primers argB-SYTlinker-F / argJ-SYTlinker-R to amplify the full plasmid pACYC-glgS-argB-argJ, Warg019) were used. The results showed... Figure 4 None of the various connection methods showed a significant promoting effect compared to the direct cistron structure. This indicates that the substrate channel effect between the two enzymes does not depend on physical fusion or specific spatial arrangement, but rather on their relative abundance balance within the cell.

[0087] Building upon this, to explore the feasibility of further coupling upstream precursor synthesis with the arginine initiation step, we tandem the citrate synthase gene gltA and the glutamate dehydrogenase gene gdhA downstream of the argJ-argB module, constructing a four-gene co-expression module of argJ-argB-gltA-gdhA. To construct an overexpression strain of the argJ-argB-gltA-gdhA module, we first used primers pACYC-thr-F0616 / argJ-argB(ec)-R0725, using the pACYC-glgS-argJ-argB plasmid as a template, to amplify the pACYC plasmid backbone containing argJ-argB. Using primers gltA-F0725 / R0725 and gdhA-F0725 / R0725, and with the *E. coli* W3110 genome as a template, the gltA and gdhA gene fragments were amplified. These three fragments were then combined using a seamless cloning kit to construct the plasmid pACYC-glgS-argJ-argB-gltA-gdhA, completing the overexpression gene plasmid construction. This plasmid was then transformed into the chassis strain Warg000, yielding Warg025. When this module was expressed as a plasmid, L-arginine production was significantly increased. Figure 5 This indicates that the driving force that enhances the entry of acetyl-CoA into the TCA cycle and the ammonia assimilation to glutamate can form an effective metabolic push-pull effect with the steps catalyzed by argJ-argB.

[0088] To construct an overexpression strain of the argB-argJ-gltA-gdhA module, the pACYC plasmid backbone containing argB-argJ was first amplified using primers pACYC-thr-F0616 / argB(ec)-argJ-R0809, with the pACYC-glgS-argB-argJ plasmid as a template. Then, using primers gltA-F0725 / R0725 and gdhA-F0725 / R0725, the gltA and gdhA gene fragments were amplified using the *E. coli* W3110 genome as a template. These three fragments were then combined using a seamless cloning kit to construct the plasmid pACYC-glgS-argB-argJ-gltA-gdhA, completing the overexpression gene plasmid construction. This plasmid was then transformed into the chassis strain Warg000, yielding Warg026.

[0089] First, using primer argA-CRISPR-F / R, and with plasmid pTarget as a template (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coligenome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.), a guide plasmid was constructed. Then, using primer pACYC-thr-F0616 / argJ-argB(ec)-R0725, and with plasmid pACYC-Pylb-argJ-argB as a template, the pACYC plasmid backbone containing Pylb-argJ-argB was amplified. Using primers gltA-F0725 / R0725 and gdhA-F0725 / R0725, and with the E. coli W3110 genome as a template, the gltA and gdhA gene fragments were amplified. The three fragments were then used to construct the plasmid pACYC-Pylb-argJ-argB-gltA-gdhA using a seamless cloning kit. Using the constructed pACYC-Pylb-argJ-argB-gltA-gdhA plasmid as a template, the argJ-argB-gltA-gdhA module was obtained by PCR amplification using primers argJ-B(ec)-F / argJ-B(ec)-R. Using the Escherichia coli W3110 genome as a template, the upstream and downstream homologous arms of the argA gene were amplified by PCR using primers argA-UP-F / argA-UP-R and primers argA-DOWN-F / argA-DOWN-R. The upstream and downstream homologous arms were then ligated to the argJ-argB-gltA-gdhA module by fusion PCR to obtain the integrated target block.The guide plasmid and the integration target block were introduced together into the Warg000 strain containing the pCas plasmid reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigeneediting in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). The positive clone strain was verified using primers argA-UP-F / argA-check-R, and the genome integration of the integration target block was completed, resulting in Warg027.

[0090] Using primers pACYC-Pylb-F / pACYC-Pylb-R as a template, amplify the plasmid backbone containing the promoter. Then, using primers argB(ec)-argJ-F / argB(ec)-argJ-R as a template, amplify the argB-argJ module. Finally, ligate the plasmid backbone and the argB-argJ module to construct the plasmid pACYC-Pylb-argB-argJ. Using primers argA-CRISPR-F / R, and the plasmid pTarget reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.), a guide plasmid was constructed. Using the previously constructed pACYC-Pylb-argB-argJ plasmid as a template, and primers argJ-B(ec)-F / argJ-B(ec)-R (this primer uses the sequence on the vector and can be used as a universal primer to amplify modules on the plasmid), the argB-argJ module was obtained by PCR amplification using pACYC-Pylb-argB-argJ as a template. Using the Escherichia coli W3110 genome as a template, primers argA-UP-F / argA-UP-R and argA-DOWN-F / argA-DOWN-R were used to amplify the upstream and downstream homologous arms of the argA gene by PCR. The upstream and downstream homologous arms were then ligated to the argB-argJ module by fusion PCR to obtain the integrated target block.The guide plasmid and the integration target block were introduced together into the Warg000 strain containing the pCas plasmid reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). The positive clone strain was verified using primers argA-UP-F / argA-check-R, and the genome integration of the integration target block was completed, resulting in Warg028.

[0091] When we integrated the four-gene module argJ-argB-gltA-gdhA into the Warg000 genome to construct a genetically stable strain, its L-arginine production decreased significantly, far below its performance in plasmid form. Figure 5 Analysis suggests that single-copy integration into the genome leads to low overall transcriptional efficiency of this long module, or a severe imbalance in gene expression levels, which in turn causes metabolic flux disruption.

[0092] Based on the above systematic trial and error and comparison, an unexpected but crucial conclusion was finally confirmed: the two-gene module, existing in the form of argB-argJ integrated into the genomic argA site, exhibited the highest L-argine synthesis capacity among all genome-integrated strains. This finding emphasizes that, in the context of genome integration, the precise regulation of local enzyme activity ratios is far more important than the simple extension of modules. Therefore, the optimal strain is Warg028.

[0093] Example 3: Enhancement of the amino donor synthesis pathway

[0094] The nitrogen atom in the L-arginine molecule originates from glutamate and ammonia. Enhancing the synthesis of amino donors (glutamate and glutamine) is another important strategy for increasing L-arginine production. In this example, using strain Warg028 as the starting strain, the gene encoding gdhA (glutamate dehydrogenase responsible for assimilating ammonia to glutamate), the gene encoding glnA (glutamine synthase responsible for glutamine synthesis), and the gene encoding carAB (carbamoyl phosphate synthase responsible for carbamoyl phosphate synthesis) were co-expressed.

[0095] gdhA-glnA-carAB was used as a module, and overexpression was performed using both plasmid and genome integration methods, respectively, and under the control of the Pglgs and Pylb promoters.

[0096] To construct the gdhA-glnA-carAB module overexpression plasmid, firstly, using primers pACYC-Pylb-F / pACYC-glgS-R1121 and the pACYC-glgS-argJ-argB plasmid as a template, the pACYC plasmid backbone containing the PglgS promoter was amplified. Then, using primers gdhA-F1121 / gdhA-R1121; glnA-F1121 / glnA-R1201; and carAB-F1201 / carAB-R1121 as a template from the *E. coli* W3110 genome, the gdhA, glnA, and carAB gene fragments were amplified respectively. These four fragments were then combined using a seamless cloning kit to construct the plasmid pACYC-glgS-gdhA-glnA-carAB, completing the overexpression gene plasmid construction. The promoter glgS in plasmid pACYC-glgS-gdhA-glnA-carAB was replaced with the promoter Pylb. Using primers pACYC-Pylb-F / pACYC-Pylb-R and plasmid pACYC-Pylb-argJ-argB as a template, the pACYC plasmid backbone containing the Pylb promoter was amplified. Using primers gdhA-F1121 / carAB-R1121 and plasmid pACYC-glgS-gdhA-glnA-carAB as a template, the gdhA-glnA-carAB module was amplified and ligated to the pACYC plasmid backbone containing the Pylb promoter to construct the plasmid pACYC-Pylb-gdhA-glnA-carAB.

[0097] Import pACYC-glgS-gdhA-glnA-carAB into Warg028 to obtain Warg032.

[0098] Import pACYC-Pylb-gdhA-glnA-carAB into Warg028 to obtain Warg033.

[0099] Using primers poxB-CRISPR-F / R, and with plasmid pTarget as a template (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coligenome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.), guide plasmids were amplified. Using the previously constructed pACYC-glgS-gdhA-glnA-carAB plasmid as a template, the glgS-gdhA-glnA-carAB module was obtained by PCR amplification using primers gdhA-glnA-carAB-cluster-F1031 / gdhA-glnA-carAB-cluster-R1031. Using the Escherichia coli W3110 genome as a template, primers poxB-UP-F1031 / poxB-UP-R1031 and poxB-DOWN-F1031 / poxB-DOWN-R1031 were used to amplify the upstream and downstream homologous arms of the proB gene by PCR. The upstream and downstream homologous arms were then ligated to the glgS-gdhA-glnA-carAB module by fusion PCR to obtain the integration target block. The guide plasmid and the integration target block were introduced together into strain Warg028 containing the pCas plasmid reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigeneediting in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Positive clones were verified using primers poxB-UP-F1031 / poxB-DOWN-R1031, and the genome integration of the integration target block was completed, resulting in Warg034.

[0100] Replacing pACYC-glgS-gdhA-glnA-carAB with pACYC-Pylb-gdhA-glnA-carAB, the Pylb-gdhA-glnA-carAB module was obtained by PCR amplification using primers gdhA-glnA-carAB-cluster-F1031 / gdhA-glnA-carAB-cluster-R1031 with plasmid pACYC-Pylb-gdhA-glnA-carAB as a template. Using the E. coli W3110 genome as a template, the upstream and downstream homologous arms of the proB gene were amplified by PCR using primers poxB-UP-F1031 / poxB-UP-R1031 and poxB-DOWN-F1031 / poxB-DOWN-R1031. The upstream and downstream homologous arms were then ligated to the Pylb-gdhA-glnA-carAB module by fusion PCR to obtain the integration target block. The guide plasmid and the integration target block were introduced together into strain Warg028 containing the pCas plasmid reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigeneediting in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Positive clones were verified using primers poxB-UP-F1031 / poxB-DOWN-R1031, and the genome integration of the integration target block was completed, resulting in Warg035.

[0101] Shake-flask fermentation results showed that different combinations had significant effects on L-arginine yield. Figure 6 Among these studies, placing the gdhA-glnA-carAB module under the control of the Pylb promoter and overexpressing it via genome integration yielded the highest L-arginine production. This optimal strain showed a 20% increase in L-arginine production compared to its originating strain, Warg028.

[0102] Example 4: Synergistic optimization of competitive pathway weakening, acetic acid pathway blocking, and global regulation of ammonia metabolism

[0103] Based on the aforementioned strain Warg035, this embodiment further refines the global regulatory network for precursor consumption and competitive pathways, acetic acid synthesis pathway, and ammonia metabolism.

[0104] First, the fhuA gene was knocked out using primers fhuA-CRISPR-F / R. The guide plasmid was constructed using the plasmid pTarget reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Using the Escherichia coli W3110 genome as a template, the upstream and downstream homologous arms of the fhuA target gene were amplified by PCR using primers fhuA-UP-F / fhuA-UP-R and fhuA-DOWN-F / fhuA-DOWN-R. The knockout target block was obtained by ligating the upstream and downstream homologous arms by fusion PCR. The guide plasmid and the knockout target block were introduced together into a strain (Warg035) containing the Pylb-gdhA-glnA-carAB module integrated with the pCas plasmid reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coligenome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). The positive clone was verified using primers fhuA-check-F / fhuA-check-R, and gene knockout was completed to obtain the fhuA knockout strain (Warg035).

[0105] Next, α-ketoglutarate dehydrogenase (encoded by the sucA gene) is a key enzyme in the TCA cycle, and its catalyzed reaction competes with the L-arginine synthesis pathway for the common precursor—α-ketoglutarate. To direct more metabolic flux towards L-arginine synthesis without significantly affecting cell growth, we replaced the original promoter of the sucA gene with the low-intensity Pflic promoter. This modification resulted in a significant 86% increase in L-arginine production.

[0106] Taking the sucA gene promoter replacement as an example, the guide plasmid was first constructed by amplifying the primers sucA-CRISPR-F0719 / sucA-CRISPR-R0719 and using the plasmid pTarget reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S.(2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Using the Escherichia coli W3110 genome as a template, primers sucA-UP-F0402 / sucA-UP-R0402, Pflic-F0402 / Pflic-R0402 and sucA-DOWN-F0402 / sucA-DOWN-R0220 were used to amplify the upstream and downstream homologous arms of the sucA gene and the Pflic promoter by PCR. The replacement target block was obtained by ligating the upstream and downstream homologous arms to the Pflic promoter by fusion PCR. The guide plasmid and the replacement target block were introduced together into the aforementioned fhuA knockout strain (Warg035) containing the pCas plasmid reported in the literature (Jiang, Y.,Chen, B., Duan, C., Sun, B., Yang, J.,&Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Positive clones were verified using primers sucA-UP-F0402 / sucA-CHECK-R0402, completing the promoter replacement and obtaining strain Warg036. Other gene knockouts were amplified using similar methods with the corresponding primers in Table 1.

[0107] Next, to reduce the generation of the byproduct acetic acid, mitigate its inhibitory effect on cell growth, and conserve carbon sources, we performed promoter replacement (weakening) on ​​the ackA-pta operon, a key gene in the acetic acid synthesis pathway. Simultaneously, to improve the strain's efficiency in ammonia uptake and utilization, we knocked out the glnK gene, which encodes a global negative regulator of ammonia metabolism, and overexpressed the amtB gene, which encodes an ammonia transporter.

[0108] Warg037 is based on Warg0036 with argE knocked out (the knockout method is the same as for knocking out the ccr gene, using the primers in Table 1). First, using primers argE-CRISPR-F / argE-CRISPR-R, the guide plasmid was constructed by amplifying the plasmid pTarget as a template, as reported in the literature (Jiang, Y., Chen, B.,Duan, C., Sun, B., Yang, J.,&Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmentalmicrobiology, 81(7), 2506–2514.). Using the Escherichia coli W3110 genome as a template, primers argE-UP-F0901 / argE-UP-R0901 and argE-DOWN-F0901 / argE-DOWN-R0901 were used to amplify the upstream and downstream homologous arms of the argE gene by PCR. The knockout target block was obtained by ligating the upstream and downstream homologous arms by fusion PCR. The guide plasmid and the knockout target block were introduced into Warg036, which contained the pCas plasmid reported in the literature (Jiang, Y., Chen, B.,Duan, C., Sun, B., Yang, J., &Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). The positive clone strain was verified using primers argE-UP-F0901 / argE-check-R, and the argE gene knockout was completed to obtain Warg037.

[0109] Warg038 is based on Warg0037 with ΔPproB::PfliC. First, using primers proB-CRISPR-F / proB-CRISPR-R, and using the plasmid pTarget reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.) as a template, a guide plasmid was constructed. Using the Escherichia coli W3110 genome as a template, primers proB-UP-F / proB-UP-R, PfliC-F1021 / PfliC-R1021 and primers proB-DOWN-F / proB-DOWN-R were used to amplify the upstream and downstream homologous arms of the proB gene and the Pflic promoter by PCR. The replacement target block was obtained by fusion PCR to connect the upstream and downstream homologous arms to the Pflic promoter. The guide plasmid and the replacement target block were introduced into Warg037 containing the pCas plasmid reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichiacoli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). The positive clone strain was verified using primers proB-UP-F / proB-CHECK-R, and the promoter replacement was completed to obtain strain Warg038.

[0110] Warg039 is based on Warg0037 with ΔglnK-PamtB::PargO. First, using primers glnK-CRISPR-F / glnK-CRISPR-R, and using the plasmid pTarget reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.) as a template, a guide plasmid was constructed. Using the Escherichia coli W3110 genome as a template, primers glnK-UP-F0919 / glnK-UP-R01013, PargO-F0919 / PargO-M35-R0919 and primer glnK-down-F0919 / glnK-down-R0919 were used to amplify the upstream and downstream homologous arms of the glnK gene and the PargO promoter by PCR. The replacement target block was obtained by ligating the upstream and downstream homologous arms to the PargO promoter by fusion PCR. The guide plasmid and the replacement target block were introduced into Warg037 containing the pCas plasmid reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Positive clones were verified using primers glnK-UP-F0919 / glnK-check-R0919. Since the glnK gene and the amtB gene are adjacent in the genome, the amtB gene promoter was replaced using the PargO promoter while the glnK gene was knocked out, resulting in strain Warg039.

[0111] Warg040 is based on Warg0038 with ΔglnK-PamtB::PargO. The operation is the same as described above.

[0112] Warg041 is based on Warg0040 and ΔackA-pta. First, using primers ackA-pta-CRISPR-F / R, the guide plasmid was constructed by amplifying the plasmid pTarget as a template, as reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Using the Escherichia coli W3110 genome as a template, the upstream and downstream homologous arms of the ackA-pta gene were amplified by PCR using primers ackA-pta-UP-F1215 / ackA-pta-UP-R1215 and primers ackA-pta-DOWN-F1215 / ackA-pta-DOWN-R1215. The upstream and downstream homologous arms were then ligated by fusion PCR to obtain the replacement target block. The guide plasmid and the replacement target block were introduced together into Warg040, which contains the pCas plasmid reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). The positive clone strains were verified using primers ackA-pta-UP-F1215 / ackA-pta-CHECK-R1215, thus completing the ackA-pta gene knockout.

[0113] Warg042 is based on Warg0040 and uses PackA::PfliC. First, using primers ackA-pta-CRISPR-F1222 / ackA-pta-CRISPR-R1222, the guide plasmid was constructed by amplifying the plasmid pTarget as a template, as reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). Using the Escherichia coli W3110 genome as a template, primers ackA-pta-UP-F1222 / ackA-pta-UP-R1222, PfliC-F1222 / PfliC-R1222 and primers ackA-pta-DOWN-F1222 / ackA-pta-DOWN-F1222 were used to amplify the upstream and downstream homologous arms of the ckA-pta gene and the Pflic promoter by PCR. The replacement target block was obtained by fusion PCR to connect the upstream and downstream homologous arms to the Pflic promoter. The guide plasmid and the replacement target block were introduced into Warg040, which contained the pCas plasmid reported in the literature (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., & Yang, S. (2015). Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology, 81(7), 2506–2514.). The positive clone strain was verified using primers ackA-pta-UP-F1222 / ackA-pta-CHECK-R1222, and the promoter replacement was completed to obtain strain Warg042.

[0114] By gradually integrating the above-mentioned optimizations and modifications, the final engineered strain Warg042 was obtained. Warg035: Based on Warg0028, ΔpoxB::Pylb-gdhA-glnA-carAB; Warg036: Based on Warg0035, ΔfhuA, ΔPsucA::PfliC; Warg037: Based on Warg0036, ΔargE; Warg038: Based on Warg0037, ΔPproB::PfliC; Warg039: Based on Warg0037, ΔglnK-PamtB::PargO; Warg040: Based on Warg0038, ΔglnK-PamtB::PargO; Warg041: Based on Warg0040, ΔackA-pta; Warg042: Based on Warg0040, PackA::PfliC. Shake-flask fermentation results showed that the L-arginine yield of this engineered strain Warg042 was further increased by 22% compared with the previous generation strain, with a final yield of 28 g / L and a glucose yield of 0.7 g / g (see results). Figure 7 ).

[0115] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for constructing a genetically engineered bacterium that produces high levels of L-arginine, characterized in that, Order W3110 Order: (1) Gene knockout: crr、pflB、argR、speA、speF、adiA、astA ; (2) Gene integration and expression: In ldhA Site integration nar-vhb ; adhe Site integration of the trc-glk-galP module; speC Site integration grcA-argCJBDF ; adiA Site integration grcA-argGH-lysE ; (3) Regulation of key genes: argJ and argB Cooperative overexpression is performed, with the promoter being Pylb It is expressed in a genome-integrated form; the aforementioned... argJ and argB Cooperative overexpression occurs through integration at the genomic argA site, in the following order: argB-argJ The two gene modules were overexpressed in synergistic manner to obtain strain Warg028; The aforementioned crr for Gene ID: 946880、ldhA for Gene ID: 946315、adhE for Gene ID: 945837、 pflB for Gene ID: 945514、argR for Gene ID: 947861、speA for Gene ID: 947432、speF for Gene ID:945297、speC for Gene ID:947457、adiA for Gene ID: 948638、astA for Gene ID: 946261 ; nar for Gene ID: 945783 ; vhb for GenBank: L21670.1 glk and galP are respectively Gene ID:946858; 947434 ; argC、J、B、D、F They are respectively Gene ID: 31923978; 31923977; 31923976; 31923975; 31923974; grcA for Gene ID: 947068;argG、H They are respectively Gene ID:31923972; 31923971:lysE for Gene ID:1019244 The nucleotide sequence of trc is shown in SEQ ID NO.

276. argJ Gene ID: 31923977; argB for Gene ID:948464 ; PglgS for Gene ID:947533,Pylb The nucleotide sequence is shown in SEQ ID NO.

277.

2. The construction method according to claim 1, characterized in that, strain Warg028 was also enhanced with an amino donor system: Pylb Startup driver gdhA-glnA-carAB The module was overexpressed in a genome-integrated form to obtain strain Warg035. gdhA for Gene ID: 946802 ; glnA for Gene ID: 948370 ; carA for Gene ID: 949025 ; carB for Gene ID: 944775 .

3. The construction method according to claim 2, characterized in that, Strain Warg035 also employs a competitive attenuation pathway: gene knockout. fhuA ,Will sucA Gene promoter replacement Pflic The promoter was used to achieve expression attenuation, resulting in strain Warg036; fhuA for Gene ID: 944856 ; sucA for Gene ID: 945303 ; Pflic for Gene ID: 949101 .

4. The construction method according to claim 3, characterized in that, strain Warg036 also had its genes knocked out. Silver strain Warg037 was obtained; Silver for Gene ID: 948456 .

5. The construction method according to claim 4, characterized in that, strain Warg037 will also proB Gene promoter replacement Pflic The promoter was used to achieve expression attenuation, resulting in strain Warg038; proB for Gene ID: 946425 ; Pflic for Gene ID: 949101 .

6. The construction method according to claim 5, characterized in that, strain Warg038 will also amtB Gene promoter replacement PargO Starter; complete simultaneously glnK Gene knockout yielded strain Warg040. PargO The promoter is Gene ID: 947418 ; amtB for Gene ID:945084;glnK for Gene ID: 945087 .

7. The construction method according to claim 6, characterized in that, strain Warg040 will also ackA-pta Gene promoter replacement Pflic Promoter, strain Warg042 was obtained. ackA for Gene ID:946775; pta for Gene ID: 946778 . 8.Remove the 1-7 connections from the L-connector and the L-connector. 9.The 8-year-old L-L-Such 100-year-old household is not allowed to do so.

Citation Information

Patent Citations

  • Recombinant corynebacterium crenatum for over expression of N-acetylglutamate kinase and application thereof

    CN101381698A

  • Genetically engineered bacterium for producing L-arginine and construction method and application thereof

    CN110964683A