A method for improving drought resistance of tomato by using platz18 gene

Abstract

The application discloses a method for improving drought resistance of tomatoes by using PLATZ18 a gene, and belongs to the technical field of biotechnology. PLATZ18 The CDS sequence of the gene is shown as SEQ ID NO. 1, and the method comprises the following steps: making the function of the gene in a tomato plant lost by using a biological technical means, so as to improve the drought resistance of the tomato plant to drought stress. PLATZ18 The method obtains the drought-resistant plant without introducing an exogenous gene. The application provides a basis for creation and selection of drought-resistant tomato varieties.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method utilizing... PLATZ18 Methods to improve drought resistance in tomatoes through gene therapy. Background Technology

[0002] tomato( Solanum lycopersicum Tomatoes (L.) are an important vegetable crop widely cultivated globally, possessing both fresh consumption and processing value, and occupying a significant position in the fruit and vegetable consumption market. As a fruit and vegetable crop, tomatoes have a high water requirement during their growth and development. With the continuous rise in global temperatures and the intensification of the contradiction between agricultural water supply and demand, drought stress has become one of the key adverse factors restricting tomato yield and quality, and in severe cases, it can lead to plant growth stagnation or even death (Teker Yıldız M, Akı C. Evaluation of physiological and biochemical responses of fourtomato). Solanum lycopersicum L.) cultivars at different drought stress levels[J]. Agronomy, 2025, 15(3): 653.).

[0003] Therefore, identifying key functional genes involved in the drought stress response of tomatoes and elucidating their molecular regulatory networks is of great scientific significance and application value for revealing the drought resistance mechanism of tomatoes and guiding drought-resistant breeding practices.

[0004] PLATZ (PlantA / T-rich protein and zinc-binding protein), a plant-specific transcription factor, has a characteristic domain that can bind to the A / T-rich region (LiX, et al. Genome-wide identification and phylogenetic and expression analyses of the) in a zinc-dependent manner. PLACE gene family in Medicago sativa L[J]. International Journal of Molecular Sciences, 2023, 24(3): 2388.). In recent years, its regulatory function in abiotic stress response has gradually attracted attention.

[0005] Previous studies have shown that some PLATZ members participate in the regulation of drought stress and ABA signaling pathways in multiple species. For example, AtPLATZ4 in Arabidopsis positively regulates drought resistance by transcriptionally repressing the expression of the aquaporin PIP2;8 (Liu M, et al. Regulation of drought tolerance in Arabidopsis involves the PLATZ4-mediated transcriptional repression of plasma membrane aquaporin). PIP2;8 [J]. The Plant Journal, 2023, 115(2): 434-451.). PhePLATZ1 in moso bamboo was significantly upregulated under drought stress, and its heterologous overexpression could activate antioxidant enzyme genes and the ABA signaling pathway in Arabidopsis thaliana, enhancing the plant's drought resistance (Zhang K, et al. PhePLATZ1, a PLATZ transcription factor in moso bamboo). Phyllostachys edulis ), improves drought resistance of transgenic Arabidopsis thaliana [J]. Plant physiology and biochemistry, 2022, 186: 121-134.). GmPLATZ17 in soybean interacts with GmDREB5 protein to weaken the expression of downstream stress response genes, thereby increasing the plant's drought sensitivity (Zhao J, et al. The soybean PLATZ transcription factor GmPLATZ17 suppresses drought tolerance by interfering with stress-associated gene regulation of GmDREB5[J]. The Crop Journal, 2022, 10(4):1014-1025.).

[0006] However, compared to other species, there are few reports on the role of PLATZ family members in tomato drought resistance. Exploring whether PLATZ family members are involved in tomato drought resistance and using CRISPR technology to perform gene editing breeding of tomato plants to obtain drought-resistant plants without introducing exogenous genes has important theoretical and practical application value. Summary of the Invention

[0007] The purpose of this invention is to discover genes in the tomato genome that are involved in regulating the tomato's resistance to drought stress, and to improve the drought resistance of tomatoes through gene modification, so as to provide a basis for breeding drought-resistant tomato germplasm.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides PLATZ18 The application of genes in improving drought resistance in tomatoes includes: using biological techniques to induce the growth of certain genes in tomato plants. PLATZ18 The gene function is lost, thereby increasing the resistance of tomato plants to drought stress.

[0009] The PLATZ18 The CDS sequence of the gene is shown in SEQ ID NO.1, with a length of 687 bp, and the whole gene DNA sequence is shown in SEQ ID NO.6.

[0010] The PLATZ18 The protein encoded by the gene is the PLATZ transcription factor, which consists of 228 amino acids, and its amino acid sequence is shown in SEQ ID NO.2.

[0011] This invention has found that by eliminating tomatoes PLATZ18 The gene function can significantly improve the resistance of tomato plants to drought stress, and the loss of this gene function does not affect the normal growth of the plant, so it can be applied to the breeding of drought-resistant plants.

[0012] Furthermore, the application includes: using CRISPR / Cas9 gene editing technology to knock out the tomato PLATZ18 gene to obtain transgenic tomato plants with enhanced drought resistance.

[0013] Mechanism studies of this invention show that tomatoes PLATZ18 Genes regulate the resistance of tomatoes to drought stress by influencing the opening and closing of stomata on the leaf epidermis. Specifically, in tomato plants... PLATZ18 Loss of gene function promotes the opening and closing of stomata on plant leaf epidermis, alters the plant's water utilization, thereby reducing drought damage to cells and improving the resistance of tomato plants to drought stress.

[0014] This invention also provides a cultivation method for improving the drought resistance of tomatoes, comprising the following steps: (1) In tomatoes PLATZ18 The protein-coding region of the gene was selected to target a fragment containing a PAM structure. Primers were designed based on the first 20 bases of the PAM structure in the target fragment to construct a CRISPR / Cas9 vector; the tomato... PLATZ18 The nucleotide sequence of the gene protein coding region is shown in SEQ ID NO.1; (2) Construct Agrobacterium genetically engineered bacteria containing the CRISPR / Cas9 vector described in step (1); (3) Transform the genetically engineered bacteria described in step (2) into tomato cotyledons and cultivate a stable genetically homozygous mutant strain with a mutated target sequence and no exogenous Cas9 protein.

[0015] In the above method, sequence analysis was performed on the transcription factor PLATZ18 (gene ID: Solyc08g076860, SolGenomicsNetwork) to identify the PAM sequence. The PAM sequence is NGG, where N represents any base. The 20 bp sequence preceding the NGG is defined as sgRNA, and highly specific sgRNA sequences located in the gene's protein-coding region are selected. Targeted editing is then constructed. PLATZ18 CRISPR / Cas9 vectors for genes are obtained through gene editing and tissue culture techniques. PLATZ18 Genetically stable homozygous mutant lines that lack gene function and do not contain exogenous Cas9 protein.

[0016] Furthermore, the nucleotide sequence of the first 20 bases of the target fragment PAM structure is shown in SEQ ID NO.3.

[0017] Furthermore, the nucleotide sequences of the primers used to construct the CRISPR / Cas9 vector are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0018] Furthermore, the tomato variety can be, but is not limited to, Condine Red.

[0019] Furthermore, in step (2), the host bacteria for constructing the genetically engineered bacteria can be, but is not limited to, Agrobacterium GV3101.

[0020] The beneficial effects of this invention are as follows: This invention provides a method for deleting genes using gene editing technology. PLATZ18 This invention relates to a method for improving the drought resistance of tomato plants by incorporating gene function, thereby obtaining drought-resistant plants without introducing exogenous genes. This provides a basis for the creation and breeding of drought-resistant tomato varieties. Attached Figure Description

[0021] Figure 1 This shows the gene editing site of the T1 generation mutant plant obtained in Example 2. Compared with the unedited normal tomato, the gene-edited mutant has a base deletion at the sgRNA position. The unedited normal tomato is referred to as the control below. platz18 #4 is missing eight bases compared to the control. platz18#12, compared to the control, lacks twenty-two bases, all of which prematurely formed stop codons in the translation region, causing premature termination of translation.

[0022] Figure 2 In Example 3 platz18 Plant height measurement data of mutant and wild-type tomato plants after natural growth.

[0023] Figure 3 In Example 4 platz18 Phenotypic images of mutant and wild-type tomato plants after 9 days of natural drought treatment. Higher leaf wilting indicates more severe drought stress damage.

[0024] Figure 4 In Example 5 platz18 Bar graphs showing the relative electrical conductivity of leaves from mutant and wild-type tomato plants after 9 days of natural drought treatment. The more severe the drought stress, the higher the relative electrical conductivity value. The relative electrical conductivity of leaves from control plants was significantly higher than that of mutant plants. Lowercase letters a, b, and c indicate significant differences in relative electrical conductivity values ​​among different plants at the 5% level.

[0025] Figure 5 In Example 6 platz18 Changes in leaf epidermal stomata of mutant and wild-type tomato plants after treatment with stomatal buffer containing 10 μM ABA for 15 min, including stomatal phenotypic diagrams and changes in stomatal conductance. Where A represents... platz18 Stomatal phenotypes of mutant and wild-type tomatoes after treatment. The closer the distance between guard cells, the lower the stomatal conductance, indicating a higher degree of stomatal closure; B represents statistical results. platz18 Changes in stomatal conductance in mutant and wild-type tomatoes after treatment: the more sensitive the plant is to the ABA response, the smaller the stomatal conductance value; lowercase letters a, b, and c indicate that the stomatal conductance values ​​of different plants are significantly different at the 5% level. Detailed Implementation

[0026] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0028] The tomato variety used in the following examples is the conventional tomato variety Condine Red, and unedited ordinary tomatoes are used as a control.

[0029] The nucleotide sequence runs from the 5' end to the 3' end from left to right.

[0030] Example 1: Construction of a CRISPR / Cas9 vector containing specific sgRNA The DNA sequence of the PLATZ18 (Solyc08g076860) gene was found on the Sol Genomics Network website. The sequence is shown in SEQ ID NO.6. Using the CRIAPR-P2.0 tool, a 20 bp base sequence before the PAM structure in the protein coding region with a high onscore score and GC content >40% was identified: AAGATAATAGATGGCCACCG (SEQ ID NO.3).

[0031] Design CRISPR primers as follows: CRISPR preprime: gcGGTCTCTATTGaacaaagcaccagtggtctagtg (SEQ ID NO.4); CRISPR back primer: gcGGTCTCTAAACCGGTGGCCATCTATTATCTTtgcaccagccgggaatcg (SEQ ID NO.5); The above primers were used as templates for PCR amplification with pBAtC-tRNA plasmid. After the products were purified by a DNA purification kit, the amplified fragments were ligated to the pHEE401 plasmid with BsaI enzyme. The products were transformed into E. coli at 42°C and then plated on a medium containing kanamycin for screening.

[0032] Single colonies were selected and verified by PCR using the universal front primer M13-F: TGTAAAACGACGGCCAGT (SEQ ID NO.7) and the universal back primer M13-R: GGTATTGGTTTATCTCATCGGAACTGCA (SEQ ID NO.8) for the pHEE401 vector.

[0033] The bacterial culture with the correct band size was sent to a sequencing company for sequencing. The sequencing results showed that the vector contained one sgRNA sequence. After plasmid extraction, it was electroporated into Agrobacterium GV3101 competent cells. After two days of incubation at 28°C, positive clones were picked for PCR verification, and Agrobacterium strains that can be used to construct CRISPR / Cas9 gene editing materials were obtained.

[0034] Example 2: platz18 Preparation and identification of mutant materials Sterilized tomato seeds were sown in a sowing medium, and the cotyledons were cut off after 7 days. The final plasmid prepared in Example 1 was transformed into the cotyledons using the Agrobacterium infection method, and the T0 generation gene-edited tomatoes were obtained by utilizing the totipotency of plant cells.

[0035] Detection of T0 generation gene-edited tomato seedlings: Genomic DNA was extracted from T0 generation plants using the CTAB method and used as a template. Primers were designed approximately 150-200 bp before and after the DNA sequence containing sgRNA, and PCR amplification and sequencing were performed for verification. Pre-seedling primer: ACAAGTAGCCTTATATTTCTCACACCGCCTCC (SEQ ID NO.9); Primer after seedling inspection: TGGCGGAAAACTGAAATCGGAATCGAAAAGAATCA (SEQ ID NO.10); The obtained PCR products were sent to a sequencing company for sequencing. The sequencing results were compared with the original gene sequence using Snapgene software. Plants with base deletions in the sgRNA sequence and single-peak sequencing were selected for self-pollination to obtain seeds of generation T0.

[0036] The T0 generation seeds were planted in a growth chamber to obtain T1 generation plants. The sgRNA sequence editing status of the T1 generation plants was detected using the same method as described above. Simultaneously, PCR amplification of the DNA of the T1 generation plants was performed using Cas9 gene primers to detect the presence of the Cas9 sequence. Two lines of T1 generation plants with mutated sgRNA and lacking Cas9 protein were selected as gene-edited plants and named [names omitted]. platz18 #4 and platz18 #12, its gene editing site is as follows Figure 1 As shown.

[0037] platz18 #4 plants lack eight base pairs compared to the control plants. platz18 #12 plants lacked 22 base pairs compared to the control plants. After sowing seeds of the T1 generation from the above two lines, stable T2 generation plants without the exogenous Cas9 gene and with sgRNA mutations were obtained.

[0038] The following examples all use T2 generation plants of the two homozygous lines mentioned above as materials for the experiment.

[0039] Example 3: platz18 Plant height measurement of mutants The two homozygous lines obtained in Example 2 platz18 #4 and platz18#12 tomato seeds were soaked in 55℃ warm water for 15 minutes, then germinated at 28℃ and 200 rpm in a shaker for 2-3 days, with the water changed every 12 hours. Once the seeds showed signs of germination, they were sown in 72-cell trays and cultured in an artificial climate chamber. The artificial climate chamber temperature was 25 / 20℃ (day / night), the photoperiod was 12 hours of light / 12 hours of darkness, and the light intensity was 200 μmol·m⁻¹. -2 ·s -1 When the tomato seedlings have developed a true leaf, transplant them into planting pots and water them with an appropriate amount of Hoagland nutrient solution every 3 days. When the tomato seedlings reach six weeks of age, measure the length from the root-stem junction to the highest growth point and record it as the plant height.

[0040] The results are as follows Figure 2 As shown, under normal growth conditions, the two homozygous lines platz18 #4 and platz18 The plant height of #12 was not significantly different from that of the wild-type WT.

[0041] Example 4: platz18 Study on drought resistance of mutants The two homozygous lines obtained in Example 2 platz18 #4 and platz18 #12 tomato seeds were soaked in 55℃ warm water for 15 minutes, then germinated at 28℃ and 200 rpm in a shaker for 2-3 days, with the water changed every 12 hours. Once the seeds showed signs of germination, they were sown in 72-cell trays and cultured in an artificial climate chamber. The artificial climate chamber temperature was 25 / 20℃ (day / night), the photoperiod was 12 hours of light / 12 hours of darkness, and the light intensity was 200 μmol·m⁻¹. -2 ·s -1 When the tomato seedlings have grown a true leaf, transplant them into planting pots and water them with an appropriate amount of Hoagland nutrient solution every 3 days.

[0042] When tomato seedlings reached the stage of four leaves and one bud, healthy plants of similar size were selected and randomly divided into two groups. The control group was watered with an appropriate amount of Hoagland nutrient solution as usual; the experimental group had excess nutrient solution removed from the trays containing the planting pots, and the plants were subjected to natural drought treatment with water control. After 9 days of treatment in an artificial climate chamber, the drought damage of the plants was observed.

[0043] The results are as follows Figure 3 As shown, after the same amount of drought treatment, the two homozygous lines... platz18 #4 and platz18 #12 exhibits a more drought-tolerant phenotype than the wild-type WT, and its leaves wilt less than the wild-type WT.

[0044] Example 5: platz18 Determination of relative electrical conductivity of leaves in mutant and wild-type tomatoes Referring to Example 4, platz18 After natural drought treatment for 9 days, leaves from the same leaf position in both mutant and control tomatoes were collected, mixed thoroughly, cut into uniform strips, and 0.2 g of each strip was placed in a 50 mL centrifuge tube containing 20 mL ddH2O. The leaves were then completely submerged in ultrapure water. Four replicates were taken for each treatment. The samples were placed in a shaker at 28℃ and shaken at 200 rpm for 1-2 h. The EC1 value was measured using a digital conductivity meter (DDS-11A digital conductivity meter, Hangzhou Aolilong Instrument Co., Ltd.). The samples were then placed in a water bath at 95℃ for 15-20 min. After cooling to room temperature, the total conductivity value EC2 was measured. The relative conductivity was calculated using the following formula: REL (%) = EC1 / EC2 × 100%.

[0045] The results are as follows Figure 4 As shown, under normal circumstances, platz18 The relative electrical conductivity of the mutant plants was not significantly different from that of the wild-type WT. After treatment under the same drought conditions, platz18 The relative conductivity of both mutant and wild-type WT was significantly increased, and platz18 The relative conductivity of the mutant was significantly lower than that of the wild-type WT.

[0046] This invention, through measuring the relative electrical conductivity of tomato leaves, found that under the same drought conditions, platz18 The relative electrical conductivity in the mutant plants was significantly reduced, indicating that the damage to the plants was significantly weakened.

[0047] Example 6: platz18 Determination of stomatal conductance in leaf epidermis of mutant and wild-type tomatoes Prepare a stomatal buffer solution: 30 mM KCl, 10 mM MES, pH=6.15.

[0048] Normally cultured in an artificial climate chamber platz18 For both mutant and control tomatoes, leaves from the same leaf position were taken. The epidermis on the underside of the leaves was peeled off with tweezers and floated in stomatal buffer at 200 μmol·m⁻¹. -2 ·s -1 Incubation at the specified light intensity for 1 h allowed stomata to fully open. The leaf epidermis was then randomly divided into two groups, transferred to stomatal buffer containing 10 μM abscisic acid (ABA) and ABA-free buffer, respectively, and incubated at 200 μmol·m⁻²·min⁻¹. -2 ·s -1 Incubate under light intensity for 15 min. Then measure the final stomatal conductance using an optical microscope (Leica, Wetzlar, Germany) equipped with a digital camera and the image analysis software ImageJ.

[0049] The results are as follows Figure 5As shown, under the same light intensity, platz18 The stomatal aperture of the mutant plants was consistent with that of the wild-type WT, but after treatment with the same concentration of abscisic acid (ABA), platz18 The mutant plants have a greater degree of stomatal closure.

[0050] The above description is merely a specific embodiment of the present invention, intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly, and should not be construed as limiting the scope of protection of the present invention. All equivalent modifications or substitutions made based on the essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. PLATZ18 The application of genes in improving drought resistance in tomatoes is characterized by, The applications include: using biological techniques to induce [something] in tomato plants. PLATZ18 The gene function is lost, thereby increasing the resistance of tomato plants to drought stress; PLATZ18 The CDS sequence of the gene is shown in SEQ ID NO.

1.

2. The application as described in claim 1, characterized in that, The applications include: using CRISPR / Cas9 gene editing technology to knock out tomatoes. PLATZ18 Genes were used to obtain transgenic tomato plants with enhanced drought resistance.

3. The application as described in claim 1, characterized in that, In tomato plants PLATZ18 Loss of gene function promotes the opening and closing of stomata on the leaf epidermis, thereby increasing the resistance of tomato plants to drought stress.

4. The application as described in claim 1, characterized in that, The PLATZ18 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

5. A cultivation method for improving the drought resistance of tomatoes, characterized in that, Includes the following steps: (1) In tomatoes PLATZ18 The protein-coding region of the gene was selected to target a fragment containing a PAM structure. Primers were designed based on the first 20 bases of the PAM structure in the target fragment to construct a CRISPR / Cas9 vector; the tomato... PLATZ18 The nucleotide sequence of the gene protein coding region is shown in SEQ ID NO.1; (2) Construct Agrobacterium genetically engineered bacteria containing the CRISPR / Cas9 vector described in step (1); (3) Transform the genetically engineered bacteria described in step (2) into tomato cotyledons and cultivate a stable genetically homozygous mutant strain with a mutated target sequence and no exogenous Cas9 protein.

6. The cultivation method as described in claim 5, characterized in that, In step (1), the nucleotide sequence of the first 20 bases of the target fragment PAM structure is shown in SEQ ID NO.

3.

7. The cultivation method as described in claim 6, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO.4 and SEQ ID NO.

5.

8. The cultivation method as described in claim 5, characterized in that, The tomato variety mentioned is Condine Red.

9. The cultivation method as described in claim 5, characterized in that, In step (2), the host bacterium for constructing the genetically engineered bacteria is Agrobacterium GV3101.

Images