Method for creating soft podded peas by editing the psCLE42 gene and applications thereof

CN122521773APending Publication Date: 2026-08-07XIANGHU LABORATORY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
XIANGHU LABORATORY
Filing Date
2026-07-09
Publication Date
2026-08-07

AI Technical Summary

Technical Problem

[0005]综上所述,现有技术存在以下不足:第一,未通过基因编辑技术获得PsCLE42基因的稳定敲除突变体,从而明确PsCLE42调控豌豆豆荚软硬的功能;第二,未在任何硬荚型主栽品种中实现硬荚到软荚的定向遗传改造;第三,缺乏基于PsCLE42蛋白功能域结构(信号肽和CLE基序)进行靶点设计的基因组编辑策略

Benefits of technology

(1)首次通过基因组编辑技术获得PsCLE42基因功能丧失的稳定突变体,明确PsCLE42基因的生物学功能;

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122521773A_ABST
    Figure CN122521773A_ABST
Patent Text Reader

Abstract

The application discloses a method for creating soft pod peas by editing PsCLE42 The application discloses a method for creating soft pod peas by editing PsCLE42 The application discloses a method for creating soft pod peas by editing The application discloses a method for creating soft pod peas by editing
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and crop genetic improvement technology, and relates to editing... PsCLE42 Methods and applications for genetically creating soft-podded peas, specifically involving a method of targeted editing of peas using genome editing technology. Pisum sativum L.) PsCLE42 Methods for gene-producing soft-pod peas, and related sgRNA molecules, recombinant expression vectors, and breeding applications. Background Technology

[0002] pea( Pisum sativum Peas (L.) are an important legume food and vegetable crop worldwide. Based on whether or not a leathery layer forms on the inner pericarp of the pod, they can be divided into hard-pod and soft-pod types (also known as edible pods or tender pods). In hard-pod peas, the inner pericarp develops a lignified leathery layer during maturation, resulting in a tough, inedible pod wall; only the seeds can be harvested. In soft-pod peas, the inner pericarp lacks this leathery layer, and the pod wall is tender, allowing the entire pod to be eaten, thus possessing higher nutritional value and economic benefits.

[0003] In Mendel's classical genetics, the hard / soft pod trait in peas is determined by... P Site control: P dominant at locus ( P _) corresponds to the hard-pod phenotype, recessive homozygote ( pp This corresponds to the soft-pod phenotype. The P site is one of the seven classical traits studied by Mendel, but its molecular basis has only recently been elucidated.

[0004] Currently, there are two important literature reports on the identification of P locus genes: (1) Liu et al. (Reference genome sequence and population genomic analysis of peas provide insights into the genetic basis of Mendelian and other agronomic traits. Nature Genetics, 2024, 56(9): 1964-1974.) Through GWAS and BSA-seq analysis, the P locus gene was identified. P The locus was located on chromosome 1, and candidate genes were identified as follows. Pisum01G262600 A homolog of the Arabidopsis thaliana CLE (CLAVATA3 / ESR-related) peptide AtCLE42 was identified and named PsCLE42. Simultaneously, it was found in soft-pod materials... PsCLE42 The Arg79* nonsense mutation exists in soft-pod materials. PsCLE42Expression levels were significantly reduced. (2) Feng et al. (Genomic and genetic insights into Mendel's peagenes. Nature, 2025, 642(8069):980-989.) Similarly, P The locus gene was located on chromosome 1 and named PsCLE41 ( Psat01G0420500 ,and PsCLE42 (They are the same gene). However, the above studies only conducted association analysis and expression level analysis, and did not carry out functional verification experiments.

[0005] In summary, existing technologies have the following shortcomings: First, they do not achieve the desired results through gene editing technology. PsCLE42 Stable knockout mutants of genes, thereby clarifying PsCLE42 First, the function of regulating pea pod firmness is lacking. Second, targeted genetic modification from firm to soft pods has not been achieved in any major hard-pod varieties. Third, there is a lack of genome editing strategies based on the functional domain structure of the PsCLE42 protein (signal peptide and CLE motif) for target design. Therefore, there is an urgent need to develop a genome editing technology to target specific pea pods. PsCLE42 Gene functional domains and efficient methods for preparing soft-podded peas. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a method for targeted editing of peas using genome editing technology. PsCLE42 Methods for gene-producing soft-pod peas, and related sgRNA molecules, recombinant expression vectors, and breeding applications.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides a method for editing [[ID= The method for creating soft-podded peas through gene editing technology involves editing the peas. ​ Genetic targets, ​ Loss of gene function; the targets include T1 targets and / or T2 targets; The T1 target point is located at ​ The nucleotide sequence of the N-terminal signal peptide coding region of the gene is shown in SEQ ID NO.3; The T2 target point is located at ​ The nucleotide sequence of the C-terminal CLE motif coding region of the gene is shown in SEQ ID NO.4.

[0008] In some preferred embodiments, the gene editing technology is the CRISPR / Cas9 system.

[0009] ​Loss of gene function causes defects in the development of the endocarp leather layer in hard-pod pea varieties, resulting in soft-pod peas that can be eaten whole.

[0010] Preferably, the ​ Loss of gene function is achieved by introducing mutations at the T1 and / or T2 target sites, which result in the inactivation of the N-terminal signal peptide and / or C-terminal CLE motif of the PsCLE42 protein.

[0011] In some preferred embodiments, the present invention employs a dual-target strategy using the CRISPR / Cas9 system to simultaneously target the N-terminal signal peptide coding region and the C-terminal CLE motif coding region, thereby blocking the PsCLE42 signaling pathway from both the protein secretion and processing and ligand activity levels.

[0012] In some preferred embodiments, the method of introducing mutations involves using the Cas9 protein to cleave the DNA double strand at both the T1 and T2 target sites. When cells repair broken DNA using non-homologous end joining (NHEJ), different mutations are randomly introduced, which may lead to... ​ Loss of gene function.

[0013] In some preferred embodiments, the ​ Loss of gene function is achieved through any of the following methods: (1) targeting ​ (2) Frameshift mutations occur in the coding region of the gene; ​ (2) Introducing premature stop codons into the gene coding region to cause nonsense mutations; (3) Directed deletion of the N-terminal signal peptide coding region; (4) Directed deletion of the C-terminal CLE motif coding region.

[0014] In method (3) or (4), sgRNA is designed at the 5' and 3' ends of the functional domain to be deleted, and double-strand breaks are generated at the two target sites simultaneously using the CRISPR / Cas9 system. The coding sequence of the functional domain is deleted as a whole by non-homologous end ligation repair.

[0015] Preferably, the mutation is a frameshift mutation; the frameshift mutation is a 1 bp deletion or a 4 bp deletion.

[0016] Preferably, the recombinant expression vector of the gene editing technology uses pCAMBIA1300 as its backbone and comprises: 1) A dual sgRNA expression cassette targeting T1 and T2 targets in tandem; 2) Expression cassette of the Cas9 protein-coding gene; 3) Glyphosate resistance gene CP4gm; The dual sgRNA expression cassette is composed of a first promoter, an sgRNA coding sequence targeting T1, an sgRNA scaffold, a second promoter, an sgRNA coding sequence targeting T2, and an sgRNA scaffold, which are sequentially linked together. The Cas9 protein-encoding gene expression cassette contains dual CaMV 35S promoters.

[0017] In some preferred embodiments, the gene editing technology refers to the CRISPR / Cas9 system.

[0018] Preferably, the sequence of the recombinant expression vector is shown in SEQ ID NO.19.

[0019] Preferably, the primer pairs used to construct the recombinant expression vector include: Primer pair U26Hf / CLE42T1r and primer pair CLE42T1f / Term-ATUr for amplifying sgRNA expression cassettes targeting T1; And primer pairs Term-ATUf / CLE42T2r and CLE42T2f / TermEr for amplifying sgRNA expression cassettes targeting T2.

[0020] In some preferred embodiments, the initial pea plant edited in this invention is a hard-pod pea; the hard-pod pea variety is... P Cultivars that are homozygous for dominant loci.

[0021] In some preferred embodiments, the hard-pod pea variety is ZW6.

[0022] In another aspect, the present invention also provides a targeted editing pea. ​ The sgRNA molecule of the gene, wherein the sgRNA molecule includes sgRNA-T1 and sgRNA-T2; The target sequence of the sgRNA-T1 is shown in SEQ ID NO.3; The target sequence of the sgRNA-T2 is shown in SEQ ID NO.4.

[0023] In another aspect, the present invention also provides a method for obtaining any of the above methods. ​ Plant cells and / or pea plant tissues that have lost gene function.

[0024] Finally, this invention also provides a breeding method for soft-podded peas, in which pea plants prepared by the above method are used as donor parents and hybridized or backcrossed with target pea varieties to obtain soft-podded pea offspring.

[0025] Preferably, the offspring of the hybridization or backcross carry ​ Individuals with loss-of-function alleles were screened using molecular marker-assisted selection; the molecular markers were InDel markers designed based on a 1 bp deletion of the T1 target or a 4 bp deletion of the T2 target.

[0026] Based on in-depth analysis of the functional domain structure of the PsCLE42 protein, this invention reveals that PsCLE42 encodes a secretory CLE peptide with an N-terminus containing a signal peptide (approximately 1-30 aa) mediating transmembrane secretion; and a C-terminus containing a highly conserved CLE motif (EVPSGPNPISNR, 98-109 aa), which is the core ligand domain for receptor binding. Based on this, this invention proposes a targeted… ​ Gene editing strategies targeting gene functional domains: By targeting the N-terminal signal peptide coding region and / or the C-terminal CLE motif coding region, ​ Loss of gene function blocks the differentiation of leathery cells at the level of protein secretion and processing and / or ligand activity, resulting in developmental defects of the leathery layer of the inner pod and producing soft-pod peas.

[0027] The ​ Loss of gene function can be achieved through any of the following methods: (1) Targeting ​ (2) Frameshift mutations occur in the coding region of the gene, such as the deletion of 1 bp or 4 bp bases; ​ Introducing an early stop codon into the gene coding region leads to nonsense mutations, resulting in truncated peptides; (3) targeted deletion of the N-terminal signal peptide coding region causes the protein to lose its secretory function; (4) targeted deletion of the C-terminal CLE motif coding region causes the protein to lose its ligand activity. The above methods (3) and (4) can be achieved by designing sgRNAs at the 5' and 3' ends of the functional domain to be deleted, respectively, and using the CRISPR / Cas9 system to generate double-strand breaks at both target sites simultaneously, and then using non-homologous end ligation repair to completely delete the coding sequence of the functional domain.

[0028] This invention employs a CRISPR / Cas9 dual-target editing strategy, simultaneously targeting... ​ The N-terminal signal peptide coding region (T1 target) and the C-terminal CLE motif coding region (T2 target) of the gene are used to block the PsCLE42 signaling pathway from both the protein secretion and ligand activity levels, ensuring the complete loss of gene function.

[0029] The beneficial effects of this invention are as follows: (1) First time obtained through genome editing technology ​ Stable mutants of gene loss of function, clearly ​ Biological functions of genes; (2) Based on the functional domain structure of PsCLE42 protein, a dual-domain targeting strategy of signal peptide coding region and CLE motif coding region is proposed, which has high editing efficiency and thorough inactivation. (3) For the first time, the directional genetic modification from hard pods to soft pods was achieved in the main hard-pod cultivar, pea 6, providing an efficient gene editing tool for breeding peas to improve their edible quality; (4) The loss of function covers a variety of strategies such as frameshift mutation, nonsense mutation and functional domain targeted deletion, providing flexible technical solutions for different varieties and editing scenarios; (5) The breeding method provided can quickly introduce the soft-pod trait into any hard-pod pea variety, and has a wide range of applications. Attached Figure Description

[0030] ​ This section presents sequence alignments and phylogenetic analyses of the PsCLE42 protein and its Arabidopsis homologs. Section A shows the sequence alignments of PsCLE42 with AtCLV3, AtCLE41, and AtCLE42, while section B shows the phylogenetic analysis of PsCLE42 and the Arabidopsis CLE peptide.

[0031] ​ for ​ Results of gene editing target and mutant sequence analysis. Where A represents the two sgRNA targets, T1 and T2. ​ Comparison of gDNA location and mutant sequence, B is the comparison of whole plant phenotype between wild type and mutant, C is the comparison of pod morphology and phenotype, and D is the comparison of cross-sectional tissue sections of pod. Detailed Implementation

[0032] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments, but the implementation of the present invention is not limited thereto.

[0033] Example 1: ​ Gene identification and functional domain analysis Based on reports by Liu et al. (2024, Nature Genetics) and Feng et al. (2025, Nature), P The locus gene encodes a CLE family signaling peptide, which is named in peas as follows: ​ and ​ (For the same gene). This invention uses the name... ​ Through in-depth analysis of this gene and its encoded protein, the following key information was obtained: Among hard-podded pea materials such as Zhewan No. 1 and Zhongwan No. 6... ​ Gene( ​ / ​Located on chromosome 1, it is a single exon gene with a full-length genome sequence (gDNA) of 694 bp, including a 5'UTR (135 bp), a coding region (CDS, 330 bp), and a 3'UTR (229 bp). ​ The CDS sequence of the gene is shown in SEQ ID NO.1, encoding a protein of 109 amino acids, the amino acid sequence of which is shown in SEQ ID NO.2.

[0034] The structural features of the PsCLE42 protein are as follows: (1) N-terminal signal peptide (1-30 aa): containing a hydrophobic core region (6-25 aa, sequence LFFSLLLAFHFTMAVQEHTLTSS), which mediates transmembrane secretion and is a necessary prerequisite for the CLE polypeptide to perform signaling function as an extracellular ligand; (2) C-terminal CLE motif (98-109 aa, sequence EVPSGPNPISNR, as shown in SEQ ID NO.5) is the active region of the protein, which is recognized by receptor kinases and is highly conserved in peas and Arabidopsis thaliana (AtCLV3 / AtCLE41 / AtCLE42). ​ Phylogenetic analysis showed that PsCLE42 is most closely related to Arabidopsis thaliana AtCLE42 (A). ​ (B in the middle).

[0035] Based on the above functional domain analysis, this invention identifies the signal peptide coding region and the CLE motif coding region as... ​ Gene editing target regions. Disrupting signal peptides can block protein secretion, inactivating the protein at the post-translational processing level; disrupting the CLE motif can eliminate ligand activity, inactivating the protein at the signal recognition level. A dual-domain targeting strategy can ensure... ​ Complete loss of gene function.

[0036] Example 2: CRISPR / Cas9 sgRNA target design Based on the functional domain analysis results of Example 1, ​ sgRNA targets were designed for the signal peptide coding region and the CLE motif coding region of the gene CDS, respectively. T1 target: Located at nucleotides 26-45 of the CDS (corresponding to 9-15 amino acids, the hydrophobic core region of the signal peptide), the target sequence is CTATTATTACTTGCATGACC (SEQ ID NO.3), encoding the amino acid SIITCMT. This target is located within the hydrophobic core coding region of the signal peptide. The hydrophobic amino acid sequence encoded in this region is a key structure for signal peptide recognition and transmembrane transport. Introducing a frameshift mutation here can disrupt the function of the signal peptide, preventing the PsCLE42 protein from being properly secreted extracellularly.

[0037] T2 target: Located at nucleotides 301-320 of the CDS (corresponding to 101-107 aa, within the CLE motif), the target sequence is AGTGGTCCAAACCCCATTTC (SEQ ID NO.4), encoding the amino acid SGPNPIS. This target is located within the highly conserved CLE motif (EVPSGPNPISNR) coding region. Introducing a frameshift mutation here can disrupt the integrity of the CLE motif, causing the PsCLE42 protein to lose its ability to bind to the receptor.

[0038] The aforementioned T1 and T2 targets are located in the coding regions of two key functional domains of the PsCLE42 protein. Simultaneous editing using a dual-target strategy can block the PsCLE42 signaling pathway at both the protein secretion and ligand activity levels, ensuring complete loss of gene function. Furthermore, domain-based targeting strategies can also be applied to targeted deletion: by designing an sgRNA flanking the signal peptide coding region or the CLE motif coding region, and using CRISPR / Cas9 double-cleavage to delete the entire functional domain coding sequence, more thorough functional inactivation can be achieved.

[0039] Example 3: Construction of CRISPR / Cas9 expression vector The vector pUC57-pAtU26-FAD2sgRNA1 used in this invention is an intermediate sgRNA cloning vector with pUC57 as the backbone, containing the Arabidopsis U6 promoter (pAtU26) and the sgRNA scaffold sequence, and can be constructed using conventional molecular biology methods. The sequence of pUC57-pAtU26-FAD2sgRNA1 is shown in SEQ ID NO.6.

[0040] The target vector 1300-pTSF1-CP4gm-tpinII-pAu-CAS9-T18.1 is a plant expression vector modified and preserved based on the pCAMBIA1300 binary vector backbone. It contains a Cas9 expression cassette driven by dual CaMV 35S promoters, using the glyphosate resistance gene (CP4gm) as a plant transformation selection marker. The sequence of 1300-pTSF1-CP4gm-tpinII-pAu-CAS9-T18.1 is shown in SEQ ID NO.7.

[0041] The sgRNA-T1 shown in SEQ ID NO.3 and the sgRNA-T2 shown in SEQ ID NO.4 were cloned into plant CRISPR / Cas9 expression vectors to construct recombinant vectors containing dual sgRNA expression cassettes. The specific construction method is as follows: Using the pUC57-pAtU26-FAD2sgRNA1 vector as a template, the pATU26-T1gRNA fragment (with the T1 target introduced at the 3' end) was amplified using primers U26Hf and CLE42T1r, and the T1gRNA-scaffold fragment (with the T1 target introduced at the 5' end) was amplified using primers CLE42T1f and Term-ATUr. The two fragments were mixed, and overlap extension PCR was performed using primers U26Hf and Term-ATUr to splice the two small fragments into a larger fragment. Similarly, using the pUC57-pAtU26-FAD2sgRNA1 vector as a template, the pATU26-T2gRNA fragment (with the T2 target introduced at the 3' end) was amplified using primers Term-ATUf and CLE42T2r, and the T2gRNA-scaffold fragment (with the T2 target introduced at the 5' end) was amplified using primers CLE42T2f and TermEr. The two fragments were mixed, and overlap extension PCR was performed using Term-ATUf and TermEr to splice the two smaller fragments into a larger fragment. Finally, the two larger fragments containing T1 and T2 targets were mixed, and overlap extension PCR was performed using primers 712F2 and 712R2 to obtain the expression cassette fused with both the T1 and T2 targets: pATU26-T1gRNA-scaffold-pATU26-T2gRNA-scaffold (SEQ ID NO.18). The relevant primer sequences are shown in Table 1.

[0042] The target vector 1300-pTSF1-CP4gm-tpinII-pAu-CAS9-T18.1 was linearized by single enzyme digestion with HindIII restriction endonuclease. The double sgRNA expression cassette was then cloned into the HindIII site of the linearized vector via homologous recombination (ClonExpress II One Step Cloning Kit, Novizan). The recombination reaction was performed according to the kit instructions, yielding the recombinant expression vector (SEQ ID NO. 19). The recombinant expression vector was transformed into *E. coli* DH5α competent cells, plated on LB agar containing kanamycin (50 mg / L), and incubated overnight at 37°C. Single clones were then picked for colony PCR identification, and positive clones were sent for sequencing to verify sequence correctness.

[0043] Table 1 Primers for CRISPR / Cas9 vector construction Example 4: Pea genetic transformation and mutant screening Using the hard-pod pea variety Zhongwan 6 (ZW6, purchased from the market) (Sun Yunyue, Miao Lihong, Li Guie, Du Zhigui, Shi Jianyao, Yuan Shiwu. Breeding of new pea varieties Zhongwan 5 and 6. Beijing, Institute of Animal Husbandry, Chinese Academy of Agricultural Sciences, 2005-01-01.) as the recipient material, and referring to Soulard et al. (Efficient and heritable geneediting through CRISPR-Cas9 in ​ . Plant Biotechnology Journal, 2025, 23(8): 3398-400.) and Li et al. (Development of an ​ -mediatedCRISPR / Cas9 system in pea ( ​ The method described in *The Crop Journal*, 2023, 11(1):132-139, utilizes *Agrobacterium tumefaciens* (L.). ​ The CRISPR / Cas9 expression vector constructed in Example 3 was introduced into peas using the EHA105 strain-mediated transformation method. The specific transformation process is as follows: Mature seeds of *Vallisneria natans* 'Zhongwan 6' were soaked overnight to absorb swelling, the cotyledons were removed, and the hypocotyl was isolated as an explant. The hypocotyl was infected with *Agrobacterium tumefaciens* 'EHA105' carrying the target vector (OD600=0.5-0.8), and cultured in the dark at 28°C for 3 days. Then, it was transferred to a shoot induction medium containing glyphosate for regeneration culture. Due to the difficulty in rooting of regenerated pea plants and the chimerism of T-DNA insertion in the transformed tissue, the transgenic regenerated shoots obtained by screening were grafted onto wild-type *Vallisneria natans* 'Zhongwan 6' rootstock according to the grafting strategy reported by Soulard et al. (2025). The grafted plants were placed in a high-humidity environment for 3-5 days to recover before being transplanted to a greenhouse and cultured under long-day conditions (16 h light / 8 h dark, 22-25°C) until flowering and fruiting. The grafting survival rate was about 90%. In this experiment, approximately 600 hypocotyl explants were transformed. Eight transgenic regenerated plants were obtained through glyphosate screening and PCR identification, and seven T0 generation plants were obtained through grafting.

[0044] For T0 generation transformed plants ​ PCR amplification and Sanger sequencing were performed on the gene target region, and frameshift mutants were obtained by screening at the T1 and T2 target sites, respectively. ​(A) It should be noted that although this invention uses a dual-target vector containing both T1 and T2 sgRNA expression cassettes for transformation, the editing events at the two target sites in the CRISPR / Cas9 system occur independently in different transformed plants, and the editing efficiency varies between different target sites. In the obtained T0 generation transgenic plants, some plants underwent editing at the T1 target site, and some plants underwent editing at the T2 target site, thus obtaining T1 target editing mutants and T2 target editing mutants, respectively. This phenomenon is consistent with the reported differences in editing efficiency between different sgRNA target sites in the literature.

[0045] The following is a detailed description of the edit mutants that occurred at the two target sites: ​ -CR-1 mutant: A 1 bp deletion (frameshift mutation) occurs at the T1 target site, resulting in a frameshift starting from the 9th amino acid and the generation of a stop codon at the 14th amino acid. The translation product is a truncated peptide containing only 13 amino acids (MACDATFPLLLLA*). The signal peptide function is completely lost, and the new protein generated by the frameshift cannot be secreted extracellularly.

[0046] ​ -CR-2 mutant: A 4 bp deletion (frameshift mutation) occurs at the T2 target site, resulting in a frameshift starting from the 101st amino acid, which completely replaces the C-terminal CLE motif (EVPSGPNPISNR) with an abnormal sequence (VPVQTPFQTG), and the CLE ligand activity is lost.

[0047] Both of the above mutants lead to ​ Loss of gene function. In addition to frameshift mutations, the loss of function described in this invention also includes: introducing an early stop codon (nonsense mutation) into the coding region, targeted deletion of the signal peptide coding region (double sgRNA strategy), targeted deletion of the CLE motif coding region (double sgRNA strategy), etc.

[0048] Example 5: ​ Phenotypic identification of gene-edited mutants right ​ -CR-1 and ​ -Systematic phenotypic identification of CR-2 mutants ( ​ (BD in the middle) (1) Plant phenotype: Compared with the wild type Zhongwan 6, the mutant plants have normal vegetative growth and no significant differences in vegetative traits such as plant height and number of branches; during the reproductive growth stage, the mutant pods are obviously wrinkled and softened.

[0049] (2) Pod morphology: Overall, mutant pods are longer than wild-type pods. Wild-type pods have a smooth appearance after maturity, with hard pod walls and highly fibrous endocarps that cannot be broken; mutant pods have a wrinkled and curved appearance, with soft pod walls and no hard fibers in the endocarps that can be easily broken, consistent with classic soft-pod peas.

[0050] (3) Histological identification: Histological examination of cross-sections of the pods revealed a clear leathery layer in the pericarp of the wild-type pods, with highly lignified cell walls; the mutant pods completely lacked the leathery layer in the pericarp, and no lignified cells were observed. This result indicates that... ​ Loss of gene function directly leads to developmental defects in the endocarp leather layer of the bean pod, confirming... ​ Genes control the hard / soft pod trait in peas by regulating the development of endocarp fiber cells.

[0051] The phenotypic identification results described above are consistent with those reported by Liu et al. (2024) and Feng et al. (2025), but this invention is the first to obtain stably inherited [phenotypes] using genome editing technology. ​ Loss-of-function mutants provide more direct and comprehensive evidence for functional validation than association analysis.

[0052] Example 6: Breeding Applications of Soft-Podded Peas Obtained in Examples 4-5 ​ Loss-of-gene soft-pod pea mutant ( ​ -CR-1 or ​ -CR-2) was used as the donor parent and crossed with the target hard-pod pea variety. After self-pollination in the F1 generation, the fertilized egg was used... ​ InDel molecular markers at mutation sites (specific amplification primers designed based on a 1 bp deletion at the T1 target or a 4 bp deletion at the T2 target) were used to identify the genotype of the F2 generation population (using polyacrylamide gel electrophoresis or first-generation sequencing) to screen for carriers. ​ Individuals with loss-of-function alleles; or backcrossing with the target variety as the recurrent parent, using the aforementioned molecular markers for selection in each generation starting from generation BC1. ​ Loss-of-function allele individuals, combined with foreground and background selection based on the agronomic traits of the target variety (plant type, flowering time, yield, etc.), were backcrossed for 3-5 generations and then purified through self-pollination to obtain individuals with a genetic background recovery rate of not less than 93.75% (after 4 backcrosses). ​ A new homozygous soft-podded pea variety with loss of function.

[0053] This method can be applied to any P The locus is dominant homozygous ( ​ The modification of hard-pod pea varieties to produce soft-pod peas is not limited to Zhongwan 6. ​The gene is a single exon gene, and loss-of-function alleles are easy to detect and track using molecular markers, which is conducive to the efficient implementation of molecular marker-assisted breeding.

Claims

1. A method of editing PsCLE42 The method for genetically creating soft-podded peas is characterized by, Editing peas using gene editing technology PsCLE42 Genetic targets, PsCLE42 Loss of gene function; the targets include T1 targets and / or T2 targets; The T1 target point is located at PsCLE42 The nucleotide sequence of the N-terminal signal peptide coding region of the gene is shown in SEQ ID NO.3; The T2 target point is located at PsCLE42 The nucleotide sequence of the C-terminal CLE motif coding region of the gene is shown in SEQ ID NO.

4.

2. The method according to claim 1, characterized in that, The PsCLE42 Loss of gene function is achieved by introducing mutations at the T1 and / or T2 target sites, which result in the inactivation of the N-terminal signal peptide and / or C-terminal CLE motif of the PsCLE42 protein.

3. The method according to claim 2, characterized in that, The mutation is a frameshift mutation; the frameshift mutation is a 1 bp deletion or a 4 bp deletion.

4. The method according to claim 1, characterized in that, The recombinant expression vector of the gene editing technology uses pCAMBIA1300 as its backbone and includes: 1) A dual sgRNA expression cassette targeting T1 and T2 targets in tandem; 2) Expression cassette of the Cas9 protein-coding gene; 3) Glyphosate resistance gene CP4gm; The dual sgRNA expression cassette is composed of a first promoter, an sgRNA coding sequence targeting T1, an sgRNA scaffold, a second promoter, an sgRNA coding sequence targeting T2, and an sgRNA scaffold, connected in series. The Cas9 protein-encoding gene expression cassette contains dual CaMV 35S promoters.

5. The method according to claim 4, characterized in that, The sequence of the recombinant expression vector is shown in SEQ ID NO.

19.

6. The method according to claim 5, characterized in that, The primer pairs for constructing the recombinant expression vector include: Primer pair U26Hf / CLE42T1r and primer pair CLE42T1f / Term-ATUr for amplifying sgRNA expression cassettes targeting T1; And primer pairs Term-ATUf / CLE42T2r and CLE42T2f / TermEr for amplifying sgRNA expression cassettes targeting T2.

7. A method for targeted editing of peas PsCLE42 The sgRNA molecule of a gene is characterized by, The sgRNA molecules include sgRNA-T1 and sgRNA-T2; The target sequence of the sgRNA-T1 is shown in SEQ ID NO.3; The target sequence of the sgRNA-T2 is shown in SEQ ID NO.

4.

8. A method for obtaining according to any one of claims 1-3 PsCLE42 Pea plant cells and / or pea plant tissues that have lost gene function.

9. A breeding method for soft-podded peas, characterized in that, The pea plants prepared by the method described in claim 1 are used as donor parents and hybridized or backcrossed with the target pea variety to obtain soft-podded pea offspring.

10. The breeding method according to claim 9, characterized in that, The offspring of the hybridization or backcross carry PsCLE42 Individuals with loss-of-function alleles were screened using molecular marker-assisted selection; the molecular markers were InDel markers designed based on a 1 bp deletion of the T1 target or a 4 bp deletion of the T2 target.