A composition, kit and method for high sensitivity detection of the low heteroplasmy m.3243a>g mutation in mitochondrial diabetes

Abstract

The application belongs to the technical field of molecular diagnosis, and particularly relates to a composition, a kit and a method for detecting a high-sensitivity mitochondrial diabetes low-heterogeneity m.3243A>G mutation, the composition comprising an LbCas12a protein, a crRNA sequence and a fluorescence quenching probe, wherein the crRNA sequence is designed based on a target nucleic acid sequence at a mitochondrial DNA m.3243A>G mutation site, and comprises a scaffold sequence and a spacer sequence connected after the scaffold sequence. The application solves the problems of long time consumption, insufficient sensitivity, complicated operation and dependence on expensive equipment in the prior art, and in particular, solves the technical bottleneck that it is difficult to meet the detection requirement of low-heterogeneity samples (mutation load < 5%). Meanwhile, the application fills the technical blank that there is no specific guide RNA (crRNA) for the m.3243A>G mutation site and no matching fluorescence quenching probe.

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic technology and relates to a gene mutation detection method based on the CRISPR-Cas system. Specifically, it relates to a composition, kit, and method for highly sensitive detection of low heterogeneity m.3243A>G mutations in mitochondrial diabetes. Background Technology

[0002] Mitochondrial diabetes mellitus (MDM) is a specific type of diabetes caused by mitochondrial dysfunction. It has a low clinical incidence and is often misdiagnosed as type 1 or type 2 diabetes. The most common pathogenic mutation in mitochondrial diabetes is the m.3243A>G mutation in mitochondrial DNA (mtDNA), located in the MT-TL1 gene, which leads to tRNA... (Leu(UUR)) Abnormalities in mitochondrial structure can affect mitochondrial protein synthesis and oxidative phosphorylation.

[0003] Mitochondrial DNA exhibits heterogeneity, meaning that mutant and wild-type mtDNA coexist in the same cell. Clinical symptoms only appear when the mutation load exceeds a certain threshold (usually 10–30%). Peripheral blood samples typically have a low mutation load (often below 10%), making traditional detection methods prone to false negatives.

[0004] Furthermore, the technical challenges of detecting mitochondrial DNA heterogeneity are far greater than those of detecting nuclear genomic DNA mutations. In the nuclear genomic system, each cell typically carries only two copies of the nuclear genome, and the ratio of mutant to wild-type alleles is clear and well-defined. However, the number of copies of mitochondrial DNA in a single cell can reach hundreds to thousands, making it highly susceptible to heterogeneity where mutant and wild-type mtDNA coexist. This is especially true in samples with low mutation loads, where the proportion of mutant mtDNA is extremely low. This places far more stringent requirements on the specificity and sensitivity of the detection system than on nuclear gene detection.

[0005] Based on the aforementioned challenges in detection, traditional methods for detecting the m.3243A>G mutation include Sanger sequencing, restriction fragment length polymorphism (PCR-RFLP), pyrosequencing, and high-resolution melting curve analysis (HRM). However, these methods all have limitations to varying degrees. Sanger sequencing has limited sensitivity, with a reliable detection limit of only 15%–20% mutation load. PCR-RFLP involves a lengthy and complex procedure and is susceptible to interference from incomplete enzyme digestion, leading to uncertainty in result interpretation. While pyrosequencing and HRM offer improved sensitivity, they rely on specific high-end instruments, resulting in high costs and demanding operational skills, limiting their widespread application in primary healthcare institutions or resource-limited areas. Especially for low-heterogeneity samples with a mutation load below 5%, the detection results of these methods are unsatisfactory and fail to meet the sensitivity requirements of clinical testing. Therefore, there is an urgent need for a method for detecting m.3243A>G mutations that is fast, highly sensitive, easy to operate, and cost-effective, especially a method for detecting m.3243A>G mutations with low heterogeneity.

[0006] CRISPR-Cas systems, especially Cas12a variants such as LbCas12a, have been widely used in nucleic acid detection due to their unique flanking cleavage activity—specifically recognizing target nucleic acids and then non-specifically cleaving single-stranded DNA fluorescence quenching probes—allowing for rapid and sensitive detection of target nucleic acids by detecting changes in fluorescence signals. However, there are currently no reports of applying these systems to the detection of the m.3243A>G mutation in mitochondrial diabetes, and there is also a lack of specific guide RNA (crRNA) and matching fluorescence quenching probes targeting this mutation site. Summary of the Invention

[0007] To address the shortcomings of existing technologies, this invention provides a composition, kit, and method for highly sensitive detection of low-heterogeneity m.3243A>G mutations in mitochondrial diabetes. This aims to solve the problems of existing detection methods being time-consuming, lacking sensitivity, cumbersome, and reliant on expensive equipment, especially their inability to meet the detection needs of low-heterogeneity samples (mutation load <5%). Simultaneously, it fills the current technological gap of lacking specific guide RNA (crRNA) and matching fluorescent quenching probes for the m.3243A>G mutation site.

[0008] The first aspect of this invention provides a composition for highly sensitive detection of low heterogeneity m.3243A>G mutations in mitochondrial diabetes, comprising: LbCas12a protein, crRNA sequence, and a fluorescent quenching probe, wherein the crRNA sequence is designed based on the target nucleic acid sequence containing the mitochondrial DNA m.3243A>G mutation site, and includes a scaffold sequence and a spacer sequence following the scaffold sequence, the spacer sequence being used to identify the target nucleic acid sequence containing the mitochondrial DNA m.3243A>G mutation site.

[0009] Preferably, the crRNA targets a target site on a double-stranded DNA, wherein the target double-stranded DNA is a nucleic acid fragment containing the mitochondrial DNA m.3243A>G mutation site; the spacer sequence of the crRNA is complementary to the target strand of the target double-stranded DNA containing the mutation site, and the m.3243A>G mutation site is located within the seed sequence region of the spacer sequence, which is a 1-6 consecutive nucleotide region in the spacer sequence near the PAM sequence end; the 3′ end of the spacer sequence is adjacent to the PAM sequence, and the PAM sequence is located within the target strand; The amino acid sequence of the LbCas12a protein is shown in SEQ ID NO: 1; the scaffold sequence of the crRNA sequence is shown in SEQ ID NO: 4; and the spacer sequence of the crRNA sequence is shown in SEQ ID NO: 5. The target strand of the target double-stranded DNA is shown in SEQ ID NO: 6, and the non-target strand is shown in SEQ ID NO: 7. The fluorescent quenching probe contains the fluorescent group FAM and the quenching group BHQ1, and its sequence is shown in SEQ ID NO: 8.

[0010] A second aspect of the present invention provides a kit for highly sensitive detection of low heterogeneity m.3243A>G mutations in mitochondrial diabetes, comprising: the aforementioned composition, and a pair of PCR primers for amplifying the target region containing the m.3243A>G mutation site.

[0011] Preferably, it also includes a reaction buffer, an RNase inhibitor, and a set of separately packaged control products, wherein the control products include a wild-type control containing a wild-type mitochondrial DNA wild-type sequence and a mutant control containing an m.3243A>G mutation sequence; The upstream primer sequence of the PCR primer pair is shown in SEQ ID NO: 2, and the downstream primer sequence is shown in SEQ ID NO: 3; the wild-type mitochondrial DNA sequence is shown in SEQ ID NO: 9, and the m.3243A>G mutant sequence is shown in SEQ ID NO: 10.

[0012] A third aspect of the present invention provides the use of the aforementioned composition or kit in the preparation of products for assisting in the determination of mitochondrial DNA m.3243A>G mutation status associated with mitochondrial diabetes.

[0013] A fourth aspect of this invention provides a method for highly sensitive detection of low heterogeneity m.3243A>G mutations in mitochondrial diabetes, using the aforementioned composition or kit, comprising the following steps: S1. Obtain the sample to be tested, use PCR primer pairs to perform PCR amplification on the sample to obtain the amplification product; S2. Mix the amplification product, LbCas12a protein, crRNA sequence and fluorescence quenching probe and perform LbCas12a cleavage reaction to obtain the enzyme digestion product. S3. Detect the fluorescence signal of the enzyme digestion product, and determine whether the sample to be tested has the m.3243A>G mutation based on the fluorescence signal detection result.

[0014] Preferably, the sample to be tested is a nucleic acid containing mitochondrial DNA extracted from oral swabs, urine sediment, peripheral blood or saliva samples, and the LbCas12a protein is purified LbCas12a protein. When performing PCR amplification on the test samples, the PCR amplification program is as follows: 95℃, 10 min; 35x (94℃, 15 sec. - 55℃, 15 sec. - 72℃, 30 sec.); 72℃, 20 min; 10℃, hold.

[0015] Preferably, a blank control is set in step S3. Based on the fold increase in the endpoint fluorescence signal of the test sample relative to the blank control, it is determined whether the test sample has the m.3243A>G mutation. The specific determination criteria are as follows: When the increase in the endpoint fluorescence signal of the test sample relative to the blank control is less than 10-fold, it is determined that there is no m.3243A>G mutation in the test sample, i.e., it is negative; When the endpoint fluorescence signal of the test sample increases by more than 10 times but less than 50 times compared with the blank control, it should be retested, and the result of the retest should be used as the final judgment. When the endpoint fluorescence signal of the test sample increases by 50-400 times compared with the blank control, the test sample is judged to be suspected of having the m.3243A>G mutation and with a low mutation load, i.e., weakly positive. When the endpoint fluorescence signal of the test sample increases by more than 400 times compared to the blank control, the m.3243A>G mutation is determined to exist in the test sample, i.e., it is positive.

[0016] Preferably, if the repeated test result is still <50 times, it is ultimately determined to be negative; if the repeated test result is ≥50 times, it is re-determined according to the following rules: when the increase is 50-400 times, it is determined to be weakly positive; when the increase is >400 times, it is determined to be positive. When the sample to be tested is determined to be weakly positive, the initial amplification product is subjected to a second PCR amplification, and the second amplification product is subjected to LbCas12a cleavage reaction again for final determination. The determination criteria are as follows: if the endpoint fluorescence signal of the second amplification product increases by more than 400 times compared with the blank control, the sample to be tested is determined to have the m.3243A>G mutation, i.e., positive; otherwise, the sample to be tested is determined to not have the m.3243A>G mutation, i.e., negative.

[0017] Preferably, the method is used to detect m.3243A>G mutations with a mutation load of not less than 1%; after secondary PCR amplification, it can be used to detect m.3243A>G mutations with a mutation load of not less than 0.1%.

[0018] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention provides for the first time a CRISPR-Cas12a detection scheme for the m.3243A>G mutation in mitochondrial diabetes. It designs a specific guide RNA (crRNA) to identify the mutation site and a matching fluorescent quenching probe, filling the current technical gap of not having a specific guide RNA (crRNA) and a matching fluorescent quenching probe for this mutation site. It solves the problems of existing detection methods being time-consuming, lacking sensitivity, cumbersome operation, and dependent on expensive equipment.

[0019] 2. The method of this invention utilizes the high specificity recognition capability of LbCas12a. By designing the m.3243A>G single-base mutation site in the seed sequence region of the crRNA spacer sequence, it effectively achieves accurate differentiation between mutant and wild-type sequences. When a mutant template is present, the crRNA guides LbCas12a to specifically recognize the target and activate paracleavage activity, cutting the fluorescent quenching probe and generating a fluorescent signal, thereby achieving rapid detection of the m.3243A>G mutation, especially in samples with low heterogeneity mutations.

[0020] 3. The detection method provided by this invention is rapid (total time less than 1.5 hours), isothermal (reaction at 37°C), requires no expensive equipment, and has a sensitivity of up to 1% mutation load. After secondary PCR amplification, the sensitivity can be increased to 0.1% mutation load, and the specificity is >95%, which is significantly better than the traditional Sanger sequencing and PCR-RFLP methods.

[0021] 4. The present invention provides flexible sample sources for detection, has high patient acceptance, and is suitable for large-scale clinical screening and early auxiliary diagnosis. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 This is a schematic diagram of the mitochondrial DNA m.3243A>G mutation location in an embodiment of the present invention; Figure 2 This is a schematic diagram illustrating the interaction between crRNA and the m.3243A>G mutant sequence in an embodiment of the present invention; Figure 3 This is a graph showing the endpoint RFU values ​​of the blank group, negative control group, positive group, and low heterogeneity simulation group in the embodiments of the present invention. Figure 4 This is a graph showing the endpoint RFU value detection of clinical samples in an embodiment of the present invention. Detailed Implementation

[0024] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] In the description of this invention, it should be noted that the terms "center," "upper," "lower," "left," "right," "vertical," "horizontal," "inner," and "outer," etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are used only for the convenience of describing the invention and for simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limitations on the invention. The terms "first," "second," and "third" are used for descriptive purposes only and should not be construed as indicating or implying relative importance. Furthermore, unless otherwise explicitly specified and limited, the terms "installed," "connected," and "linked" should be interpreted broadly. For example, they can refer to a fixed connection, a detachable connection, or an integral connection; they can refer to a mechanical connection or an electrical connection; they can refer to a direct connection or an indirect connection through an intermediate medium; and they can refer to the internal connection of two components. Those skilled in the art can understand the specific meaning of the above terms in this invention based on the specific circumstances.

[0026] In this application, "m.3243A>G mutation" refers to the mutation of nucleotide 3243 of the mitochondrial DNA MT-TL1 gene from A to G. This mutation is the most common pathogenic mutation in mitochondrial diabetes. The location of the "m.3243A>G mutation" in this application is as follows: Figure 1 As shown.

[0027] In this application, the "LbCas12a" used is derived from the Cas12a enzyme of Lachnospiraceae bacterium ND2006, which has ssDNA transcleavage activity after dsDNA target recognition. Wild-type LbCas12a was used in this application for the detection of mitochondrial diabetes m.3243A>G mutation.

[0028] In this embodiment, the purified LbCas12a protein was purchased from Shanghai Sangon Biotech Co., Ltd., with catalog number NO.C620035.

[0029] The amino acid sequence of LbCas12a used in this application is the wild-type sequence derived from Lachnospiraceae bacterium ND2006, containing 1228 amino acids, as shown below:

[0030] Example 1: Sample Collection

[0031] 1. Sample collection

[0032] Nucleic acid containing mitochondrial DNA was extracted from oral swabs, urine sediment, peripheral blood or saliva samples from the subjects.

[0033] In this embodiment of the application, the method for collecting oral swab samples is as follows: swab the buccal mucosa of both sides of the subject 10 to 15 times with a sampling swab, and place the swab head into a centrifuge tube containing DNA preservation solution.

[0034] In this embodiment of the application, the method for collecting urine sediment samples is as follows: collect 10-15 mL of midstream urine from the subject in the morning, centrifuge at 3000 rpm for 10 minutes, discard the supernatant, and collect the urine sediment.

[0035] 2. Amplification products

[0036] To target the mitochondrial DNA m.3243A>G mutation site, PCR primer pairs were used to amplify the mitochondrial DNA in the nucleic acid to be tested, and the amplification product was obtained.

[0037] In this application, the reagent used for PCR amplification is AmpliTaq Gold 360 Mastermix (AppliedBiosystems).

[0038] In this application, the PCR amplification program is as follows: 95℃, 10 min; 35x (94℃, 15 sec. - 55℃, 15 sec. - 72℃, 30 sec.); 72℃, 20 min; 10℃, hold.

[0039] In this application, the PCR primer pairs used for PCR amplification are as follows: Upstream primer: 5′-GTTGGTCAAGGGCACCTAGC-3′ (SEQ ID NO: 2); Downstream primer: 5′-AGGACAGCCGCGCATCTCTT-3′ (SEQ ID NO: 3).

[0040] It should be noted that the nucleic acid to be tested in this application is total DNA extracted from clinical samples, including mitochondrial DNA, nuclear genomic DNA, and nuclear mitochondrial pseudogenes (NUMTs). To avoid interference from NUMTs in the detection, this application specifically designed PCR primer pairs for the target region of mitochondrial DNA containing the m.3243A>G mutation site. These primer pairs were designed for the m.3243 region on mitochondrial DNA, and BLAST comparison did not reveal any highly homologous regions with nuclear genomic DNA that could lead to specific amplification. Under optimized PCR conditions, the target region of mitochondrial DNA was mainly amplified, rather than nuclear mitochondrial pseudogenes (NUMTs). Therefore, "PCR amplification of mitochondrial DNA in the nucleic acid to be tested" actually refers to the precise amplification of the target fragment on mitochondrial DNA from the nucleic acid to be tested using specific primers. In addition, there are usually hundreds to thousands of copies of mitochondrial DNA in each cell, while nuclear mitochondrial pseudogenes (NUMTs) are single copies or low copies. Therefore, based on this difference in copy number, even if there is a trace amount of non-specific amplification, the interference with the detection results can be controlled within an acceptable range.

[0041] In this application, a PCR primer pair is used to amplify the mitochondrial DNA in the nucleic acid to be tested by PCR, targeting the m.3243A>G mutation site in the mitochondrial DNA, and an amplification product covering the m.3243A>G mutation site is obtained, with a length of 192 bp.

[0042] It should be noted that the amplification product length in this application achieves a synergistic balance of two key performance characteristics: First, the shorter amplification fragment is better suited to the amplification kinetics of low-copy templates, significantly improving the amplification efficiency of low-abundance mutant templates and effectively reducing the probability of missed detection of mutant sequences in low-heterogeneity mitochondrial samples; Second, the amplification fragment completely preserves all target functional sequences, including the crRNA recognition site, providing a complete recognition basis for subsequent LbCas12a-mediated specific cleavage reactions and avoiding non-specific activation caused by target sequence truncation. Those skilled in the art can adaptively adjust the amplification product length according to the needs of actual application scenarios. The adjusted amplicons must simultaneously meet two core conditions: achieving efficient and specific amplification of the target sequence and completely preserving all target functional regions required for LbCas12a recognition.

[0043] Example 2: crRNA Sequence Design

[0044] Using mitochondrial DNA m.3243A>G mutation as the target nucleic acid molecule, crRNA sequences containing specific spacer sequences were designed.

[0045] It should be noted that "crRNA" refers to CRISPR RNA. In this application, the crRNA sequence includes the scaffold sequence and the spacer sequence following the scaffold sequence.

[0046] In this embodiment of the application, the stent sequence is UAAUUUCUACUAAGUGUAGAU (SEQ ID NO:4), and the spacer sequence is 5′-CCUGUAGGUUGGCUUGGCAG-3′ (SEQ ID NO:5).

[0047] In this application, the crRNA targets a target site on a double-stranded DNA, wherein the target double-stranded DNA is a nucleic acid fragment containing the mitochondrial DNA m.3243A>G mutation site; the spacer sequence of the crRNA is complementary to the target strand of the target double-stranded DNA containing the mutation site, and the m.3243A>G mutation site is located within the seed sequence region of the spacer sequence, which is a 1-6 consecutive nucleotide region in the spacer sequence near the PAM sequence end.

[0048] In this application, the 3′ end of the spacer sequence is adjacent to the PAM sequence, which is located within the target strand.

[0049] In this application, the m.3243A>G mutation site corresponds to the 4th nucleotide starting from the 3′ end of the spacer sequence, i.e., it is located within the seed sequence region.

[0050] It should be noted that designing the mutation site within the seed sequence region can enhance Cas12a's sensitivity to single base mismatches, which is beneficial for distinguishing between wild-type and mutant sequences.

[0051] In this embodiment, the target strand of the target double-stranded DNA (containing the mutation site, i.e., the sequence after the m.3243A>G mutation) is 5′-GCCAAGCC. G CCTACAGGG-3′ (SEQ ID NO: 6), the non-target strand is 3′-CGGTTCGGCGGATGTCCC-5′ (SEQ ID NO: 7).

[0052] In this embodiment, the PAM recognition sequence of LbCas12a is 5′-TTTV-3′ (V = A / C / G); the corresponding PAM sequence on the target double-stranded DNA target strand is 5′-TTTG-3′, located upstream of the 5′ end of the target strand (SEQ ID NO:6) (i.e., TTTG +GCCAAGCCGCCTACAGGG).

[0053] It should be noted that the wild-type sequence in this region is 5′-GCCAAGCC. ACCTACAGGG-3′ (meaning position 3243 is A instead of G) has a single base mismatch with crRNA (A vs G). This single base difference allows crRNA to perfectly match the mutant sequence, but not perfectly match the wild-type sequence, thus enabling specific identification of the mutant sequence.

[0054] It should be noted that although the non-target strand designed in this application does not directly pair with crRNA, its presence is necessary for the formation of the double-stranded DNA substrate required by Cas12a. After Cas12a recognizes the PAM sequence of the double-stranded DNA, it will produce staggered cuts on the two strands.

[0055] In this application, the schematic diagram illustrating the interaction between crRNA and the m.3243A>G mutant sequence is shown below. Figure 2 As shown, the wild-type sequence does not perfectly match the crRNA (there is a 1-base mismatch), while the mutant sequence perfectly matches the crRNA, thus enabling specific recognition of the mutant sequence.

[0056] crRNA binds to the target strand of the target double-stranded DNA via the LbCas12a protein. When crRNA is perfectly complementary to the target strand of the target double-stranded DNA, it activates the flanking cleavage activity of LbCas12a, which cleaves the fluorescent quenching probe to generate a fluorescent signal. When a base mismatch exists, the flanking cleavage activity of LbCas12a is significantly reduced, and the fluorescent signal is weaker.

[0057] Example 3: Design of Fluorescence Quenching Probe

[0058] In this application, the fluorescence quenching (FQ) probe comprises a fluorescent group FAM and a quenching group BHQ1. The sequence of the fluorescence quenching probe is FAM-CCCCCC-BHQ1 (SEQ ID NO: 8), wherein six C bases serve as linkers, with FAM and BHQ1 connected at their respective ends. FAM is modified at the 5′ end, and BHQ1 is modified at the 3′ end. In its intact state, the fluorescence of FAM is quenched by BHQ1; upon cleavage by LbCas12a, FAM separates from BHQ1, generating a detectable fluorescence signal.

[0059] It should be noted that FAM / BHQ1 is a common combination of fluorescence quenching groups in the field, and its spectral characteristics are compatible with commonly used fluorescence detection equipment, allowing signal reading without the need for additional customized hardware. For special applications requiring extremely high detection sensitivity, such as those involving low heterogeneity mutations in mitochondria, the signal-to-noise ratio of the probe directly determines the detection capability of low-proportion mutant sequences. Conventional linker designs are insufficient to meet these stringent requirements. Therefore, this application innovatively optimizes the probe structure using a 6-C linker length. Extensive experimental data confirms that this design achieves the best synergistic effect between fluorescence quenching efficiency and LbCas12a-mediated cleavage product release efficiency, significantly improving the detection performance of samples with low mutation loads.

[0060] In this application, PCR primers, crRNA, and fluorescence quenching probes were synthesized by bioengineering.

[0061] Example 4: Composition, method, and kit for detecting mitochondrial diabetes m.3243A>G mutation using LbCas12a.

[0062] 1. Composition for detecting mitochondrial diabetic m.3243A>G mutation using LbCas12a

[0063] In this application, the composition includes LbCas12a protein, crRNA sequence and fluorescent quenching probe, wherein the crRNA sequence is designed based on the target nucleic acid sequence containing the mitochondrial DNA m.3243A>G mutation site, and includes a scaffold sequence and a spacer sequence following the scaffold sequence. The spacer sequence is used to identify the target nucleic acid sequence containing the mitochondrial DNA m.3243A>G mutation site.

[0064] Preferably, the LbCas12a protein is a purified LbCas12a protein.

[0065] Preferably, the crRNA sequence includes a scaffold sequence and a spacer sequence following the scaffold sequence, wherein the scaffold sequence is UAAUUUCUACUAAGUGUAGAU (SEQ ID NO:4) and the spacer sequence is 5′-CCUGUAGGUUGGCUUGGCAG-3′ (SEQ ID NO:5).

[0066] Preferably, the crRNA targets a target site on a double-stranded DNA, wherein the target double-stranded DNA is a nucleic acid fragment containing the mitochondrial DNA m.3243A>G mutation site; the spacer sequence of the crRNA is complementary to the target strand of the target double-stranded DNA containing the mutation site, and the m.3243A>G mutation site is located within the seed sequence region of the spacer sequence, which refers to the 1-6 consecutive nucleotide region in the spacer sequence near the PAM sequence end; the 3′ end of the spacer sequence is adjacent to the PAM sequence, which is located within the target strand; the m.3243A>G mutation site corresponds to the 4th nucleotide counting from the 3′ end of the spacer sequence, i.e., it is located within the seed sequence region.

[0067] Preferably, the fluorescent quenching probe comprises a fluorescent group FAM and a quenching group BHQ1, with the sequence FAM-CCCCCC-BHQ1 (SEQ ID NO: 8).

[0068] 2. Kit for detecting mitochondrial diabetes m.3243A>G mutation using LbCas12a

[0069] In this application, the kit includes LbCas12a protein, crRNA and a fluorescence quenching probe, as well as PCR primer pairs for amplifying the target region containing the m.3243A>G mutation site.

[0070] This kit can directly perform PCR amplification of the nucleic acid to be tested, which contains mitochondrial DNA, and then perform LbCas12a-specific cleavage reaction on the obtained amplification product.

[0071] Preferably, the LbCas12a protein is purified LbCas12a protein; the fluorescent quenching probe contains a fluorescent group FAM and a quenching group BHQ1, and the sequence of the fluorescent quenching probe is FAM-CCCCCC-BHQ1 (SEQ ID NO: 8).

[0072] Preferably, the PCR primer pairs are as follows: Upstream primer: 5′-GTTGGTCAAGGGCACCTAGC-3′ (SEQ ID NO: 2); Downstream primer: 5′-AGGACAGCCGCGCATCTCTT-3′ (SEQ ID NO:3).

[0073] Preferably, the kit also includes a reaction buffer and an RNase inhibitor.

[0074] In this embodiment, the reaction buffer is NEBuffer 2.1 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL BSA, pH 7.9).

[0075] Preferably, the kit also includes a set of separately packaged controls, which include a wild-type control containing a wild-type mitochondrial DNA wild-type sequence and a mutant control containing an m.3243A>G mutation sequence.

[0076] In this application, the wild-type mitochondrial DNA sequence is shown below: 5′-GTTGGTCAAGGGCACCTAGCGCCAAGCCACCTACAGGGGCTATTTCCGAGGACAGCCGCGCATCTCTT-3′ (SEQ ID NO: 9).

[0077] In this application, the m.3243A>G mutation sequence is shown below: 5′-GTTGGTCAAGGGCACCTAGCGCCAAGCCGCCTACAGGGGCTATTTCCGAGGACAGCCGCGCATCTCTT-3′ (SEQ ID NO: 10).

[0078] It should be noted that the wild-type mitochondrial DNA sequence (SEQ ID NO:9) and the m.3243A>G mutant sequence (SEQ ID NO:10) are short control fragments, not complete amplification products.

[0079] It is important to note that the m.3243A>G mutation is not only associated with mitochondrial diabetes, but also has a clear link to various mitochondrial diseases such as MELAS syndrome and maternally inherited deafness. Therefore, detecting the m.3243A>G mutation using this method can only provide molecular-level auxiliary diagnostic reference for mitochondrial diabetes, and should not be used as the sole basis for a clinical diagnosis. The final clinical judgment must be based on a comprehensive analysis of the subject's typical symptoms, maternal family history, and other relevant auxiliary examination results to avoid misdiagnosis caused by a single gene test result.

[0080] 3. Method for detecting mitochondrial diabetic m.3243A>G mutation using LbCas12a

[0081] First, the sample to be tested was extracted and PCR amplified. Second, the amplification product, LbCas12a protein, crRNA and fluorescence quenching probe were mixed and LbCas12a was cleaved to obtain the enzyme digestion product. Finally, the enzyme digestion product was subjected to fluorescence signal detection, and the presence of m.3243A>G mutation was determined based on the fluorescence signal detection results.

[0082] In this embodiment of the application, the sample to be tested is a nucleic acid containing mitochondrial DNA extracted from the subject's oral swab, urine sediment, peripheral blood or saliva sample, preferably a urine sediment sample.

[0083] In this application, the LbCas12a cleavage reaction system is shown in Table 1.

[0084]

[0085] In this application, the LbCas12a cleavage reaction conditions are incubation at 37°C for 15 minutes.

[0086] In this application, wild-type samples were used as negative controls, and blank controls were set up for monitoring contamination. The endpoint RFU interpretation tables for blank groups, positive groups, weakly positive groups, and negative controls were summarized as shown in Table 2.

[0087]

[0088] In this application, the specific criteria for judgment are as follows: When the increase in the endpoint fluorescence signal of the test sample relative to the blank control is less than 10-fold, it is determined that there is no m.3243A>G mutation in the test sample, i.e., it is negative; When the endpoint fluorescence signal of the test sample increases by more than 10 times but less than 50 times compared with the blank control, it should be retested, and the result of the retest should be used as the final judgment. When the endpoint fluorescence signal of the test sample increases by 50-400 times compared with the blank control, the test sample is judged to be suspected of having the m.3243A>G mutation and with a low mutation load, i.e., weakly positive. When the endpoint fluorescence signal of the test sample increases by more than 400 times compared to the blank control, the m.3243A>G mutation is determined to exist in the test sample, i.e., it is positive.

[0089] Preferably, if the repeated test result is still <50 times, it is finally determined to be negative; if the repeated test result is ≥50 times, it is re-determined according to the following rules: when the increase is 50-400 times, it is determined to be weakly positive; when the increase is >400 times, it is determined to be positive.

[0090] Preferably, when the sample to be tested is determined to be weakly positive, the initial amplification product is subjected to a second PCR amplification, and the second amplification product is subjected to LbCas12a cleavage reaction again for final determination. The determination criteria are as follows: if the endpoint fluorescence signal of the second amplification product increases by more than 400 times compared with the blank control, the sample to be tested is determined to have the m.3243A>G mutation, i.e., positive; otherwise, the sample to be tested is determined to not have the m.3243A>G mutation, i.e., negative.

[0091] It should be noted that in this application, "secondary PCR amplification" refers to the second round of PCR amplification (i.e., the second amplification), rather than "performing two PCR amplifications".

[0092] The specific conditions for PCR amplification are as follows: (1) The reagent used for PCR amplification was AmpliTaq Gold 360 Mastermix (AppliedBiosystems). (2) During PCR amplification, the PCR amplification program was as follows: 95℃, 10 min; 35× (94℃, 15 sec. - 55℃, 15 sec. - 72℃, 30 sec.); 72℃, 20 min; 10℃, hold; (3) The PCR primer pairs are as follows: Upstream primer: 5′-GTTGGTCAAGGGCACCTAGC-3′ (SEQ ID NO: 2); Downstream primer: 5′-AGGACAGCCGCGCATCTCTT-3′ (SEQ ID NO:3).

[0093] Example 5: Validation of the effectiveness of LbCas12a in detecting mitochondrial diabetes m.3243A>G mutation.

[0094] 1. In vitro detection

[0095] To examine whether an in vitro detection system based on LbCas12a, crRNA, and a fluorescence quenching probe can distinguish between the m.3243A>G mutant sequence and the wild-type sequence and generate a detectable differential fluorescence signal.

[0096] In this experiment, the experimental groups are set up as follows: The blank group (NTC) uses ddH2O instead of template, and a total of 3 parallel replicate samples are set up; Negative control group: plasmid DNA containing wild-type sequence (100 ng / μL), with a total of 3 parallel replicates; Positive group: plasmid DNA containing the m.3243A>G mutation sequence (100 ng / μL), with a total of 6 parallel replicates; Low heterogeneity simulation group: Wild-type and mutant plasmids were mixed in ratios of 99:1, 95:5, and 90:10 to simulate samples with mutation loads of 1%, 5%, and 10%, with 3 parallel replicates set up for each mutation load gradient.

[0097] After mixing all reaction systems, the mixtures were incubated at 37°C for 40 minutes. Fluorescence signals were read every 2 minutes using a fluorescence microplate reader (excitation wavelength 485 nm, emission wavelength 520 nm). The results showed that the fluorescence signal in the blank control group (NTC) remained at baseline for 40 minutes, with an endpoint RFU value <15, indicating that the reaction system was uncontaminated and the background signal was stable. The fluorescence signal in the negative control group (wild-type) remained at baseline for 40 minutes, with an endpoint RFU value <50, indicating that the wild-type sequence could not effectively activate the flanking cleavage activity of LbCas12a. The fluorescence signal in the positive group (mutant) began to rise significantly after approximately 10 minutes and reached a plateau after 20 minutes. In the low heterogeneity simulation group, the fluorescence signal of samples with a mutation burden of 10% began to rise after approximately 15 minutes and reached a plateau after 25 minutes; the fluorescence signal of samples with a mutation burden of 5% began to rise after approximately 20 minutes and tended to stabilize after 30 minutes; the fluorescence signal of samples with a mutation burden of 1% began to rise slowly after approximately 25 minutes and was still on an upward trend at 40 minutes. This indicates that the fluorescence rise rate of all three simulated sample groups was slower than that of the positive group, but significantly faster than that of the negative control group. Furthermore, the higher the mutation burden, the faster the signal rise and the higher the endpoint RFU value, exhibiting a typical mutation burden dependence.

[0098] In this experiment, the endpoint RFU values ​​for each group were also obtained using endpoint fluorescence readings, such as... Figure 3 As shown. From Figure 3 It is evident that the endpoint RFU value of the blank group (NTC) was between 5 and 15, while the endpoint RFU value of the negative control group (wild-type) was <50. Both remained at the baseline level throughout the reaction, indicating that the wild-type sequence could not effectively activate the flanking cleavage activity of LbCas12a. The endpoint RFU value of the positive group (mutant) was approximately 8000, a fold increase of >500 times relative to NTC, and significantly higher than that of the negative control group, indicating that the mutant sequence could effectively activate the flanking cleavage activity of LbCas12a. In the low heterogeneity simulation group, the endpoint of the sample with a mutation burden of 10% was... The RFU value was approximately 4500 (approximately 300-900 times that of NTC), the endpoint RFU value for samples with a mutation load of 5% was approximately 2000 (approximately 100-400 times that of NTC), and the endpoint RFU value for samples with a mutation load of 1% was approximately 600 (approximately 40-120 times that of NTC). All of these values ​​were clearly distinguishable from the blank group and the negative control group, indicating that the detection system provided by this invention can effectively detect low-heterogeneity samples with a mutation load as low as 1%, and that the fluorescence signal intensity is positively correlated with the mutation load. This system can be used for the qualitative detection of low-heterogeneity m.3243A>G mutations.

[0099] Therefore, under in vitro conditions, the in vitro detection system based on LbCas12a, crRNA and fluorescence quenching probe set up in this application can be specifically activated by the m.3243A>G mutation sequence and generate a detectable fluorescent signal, which can be distinguished from the wild-type DNA control. At the same time, the detection sensitivity of this method can reach 1% mutation load.

[0100] 2. Clinical sample testing

[0101] In this experiment, the method was also used to test 35 clinical samples to further verify the ability of the method to detect the m.3243A>G mutation in clinical samples. Among them, 15 were healthy control samples and 20 were samples from patients with clinically diagnosed mitochondrial diabetes.

[0102] Sample processing: Collect 10 mL of the subject's morning urine, centrifuge at 3000 rpm for 10 minutes, discard the supernatant, and collect the urine sediment; use QIAamp DNA Mini Kit to extract the nucleic acid to be tested containing mitochondrial DNA; use PCR primer pairs to perform PCR amplification of the mitochondrial DNA in the nucleic acid to be tested, and perform LbCas12a cleavage reaction on the amplification product.

[0103] In this experiment, the PCR amplification reagents, reaction system, and primers used in the sample processing are as shown in Example 1, and the LbCas12a reaction system and conditions are as shown in Example 4.

[0104] The overall completion time for a single test using this method is less than 1.5 hours, including approximately 65 minutes for PCR amplification, 15 minutes for Cas12a cleavage reaction, and 5 minutes for fluorescence detection. For the 8 samples that initially tested weakly positive, a second PCR amplification and retesting showed a fluorescence signal increase of over 400-fold in all samples, confirming them as positive.

[0105] In this experiment, the endpoint RFU values ​​of 35 clinical samples were obtained using the endpoint fluorescence reading method. Figure 4 As shown. From Figure 4 It is evident that the endpoint RFU values ​​of the healthy control group (15 healthy control samples) were generally low, mainly concentrated in the low fluorescence background range; while the endpoint RFU values ​​of the patient group (20 patient samples) were significantly higher, with some samples having endpoint RFU values ​​>2000, showing strong positivity (i.e., direct positivity), and others having endpoint RFU values ​​in the 200–2000 range, showing weak positivity. Therefore, there is a significant difference in fluorescence signals between the healthy control group and the patient group, indicating that this method can effectively distinguish patient samples from healthy control samples and has good detection capability.

[0106] Based on the confirmation that this method can distinguish between patients and healthy controls, this experiment further compared the detection results with pyrosequencing results to evaluate the concordance rate and detection performance of this method. The comparison results are shown in Table 3.

[0107]

[0108] As can be clearly seen from Table 3, the detection results of this method are completely consistent with the pyrosequencing results, indicating that this method can achieve rapid detection of m.3243A>G mutation in clinical patients with mitochondrial diabetes. It has the advantages of high accuracy and short time consumption, and is suitable for rapid screening and auxiliary diagnosis scenarios, especially for samples with low mutation load.

[0109] 3. Specificity and sensitivity detection

[0110] In this application, the spacer sequence of the crRNA sequence was obtained through screening and optimization based on bioinformatics analysis. Specifically, the PAM availability, off-target risk and distinguishability from wild-type sequences of candidate sequences were comprehensively evaluated using CRISPR target design tools (CRISPOR and CRISPick). Targeted design was carried out for the m.3243A>G single base mutation, so that the mutation site was located in the proximal region of the PAM sequence of the spacer sequence, thereby achieving specific recognition of the mutant sequence.

[0111] Specificity validation: This method was used to detect wild-type sequences and potential off-target sites (including homologous regions on mitochondrial DNA, such as m.3303C>T, m.3271A>G, and other known mutation sites in the MT-TL1 gene) to assess cross-reactivity.

[0112] Experimental results showed that the fluorescence signal increase of this method for wild-type sequences was <5-fold, and the fluorescence signal increase for other MT-TL1 gene mutation sites such as m.3303C>T and m.3271A>G was <10-fold, all below the positive threshold (400-fold), with a specificity of 96.7% (29 / 30). Therefore, this method can specifically identify the m.3243A>G mutation, rather than generically identifying other variations in the MT-TL1 gene region.

[0113] It should be noted that in the specificity validation phase, 30 independent parallel tests were completed, of which 29 results were completely in line with expectations, and only 1 result was not in line with expectations (a weak positive signal appeared, corresponding to a signal increase of 60-fold). Subsequent repeated testing confirmed that this abnormal result was due to experimental operation error. Based on this, the specificity of this validation was calculated to be 96.7% (29 / 30).

[0114] Sensitivity validation: Samples with mutation loads of 10%, 5%, 2%, 1%, 0.5%, and 0.1% were prepared by mixing mutant plasmids with wild-type plasmids at different ratios to evaluate the limit of detection of this method.

[0115] Experimental results showed that samples with a mutation load ≥1% exhibited a fluorescence signal increase of ≥100-fold (compared to the blank control), and were clearly distinguishable from the negative control; samples with a mutation load of 0.5% showed a fluorescence signal increase of 45±12-fold, partially overlapping with the negative control; samples with a mutation load of 0.1% showed a fluorescence signal increase of 18±8-fold, with no significant difference from the negative control. Therefore, the sensitivity of this method can reach 1% mutation load, and after secondary PCR amplification and re-detection, the sensitivity can reach 0.1% mutation load.

[0116] It should be noted that the PCR amplification in the experiment was not aimed at changing the ratio of mutant to wild-type plasmids, but rather at increasing the copy number of the target nucleic acid fragment to enhance the detection capability of the subsequent LbCas12a cleavage reaction for low-proportion mutant targets. Therefore, under the conditions of this embodiment, after two PCR amplifications, the m.3243A>G mutation with a mutation load as low as 0.1% can be detected.

[0117] In summary, the composition, kit, and method for detecting low-heterogeneity m.3243A>G mutations in mitochondrial diabetes provided in this application solve the problems of long detection time, insufficient sensitivity, cumbersome operation, and reliance on expensive equipment in existing detection methods, especially the technical bottleneck of difficulty in meeting the detection needs of low-heterogeneity samples (mutation load <5%). At the same time, it fills the technical gap that there is currently no specific guide RNA (crRNA) for the m.3243A>G mutation site and a matching fluorescent quenching probe.

[0118] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A composition for highly sensitive detection of low heterogeneity m.3243A>G mutation in mitochondrial diabetes, characterized in that, include: The LbCas12a protein, crRNA sequence, and fluorescent quenching probe are included. The crRNA sequence is designed based on the target nucleic acid sequence containing the mitochondrial DNA m.3243A>G mutation site. It includes a scaffold sequence and a spacer sequence following the scaffold sequence. The spacer sequence is used to identify the target nucleic acid sequence containing the mitochondrial DNA m.3243A>G mutation site.

2. The composition for highly sensitive detection of low heterogeneity m.3243A>G mutation in mitochondrial diabetes according to claim 1, characterized in that, crRNA targets a specific site on a double-stranded DNA fragment containing the mitochondrial DNA m.3243A>G mutation site. The spacer sequence of the crRNA is complementary to the target strand of the double-stranded DNA containing the mutation site, and the m.3243A>G mutation site is located within the seed sequence region of the spacer sequence, which is a 1-6 consecutive nucleotide region in the spacer sequence near the PAM sequence end. The 3′ end of the spacer sequence is adjacent to the PAM sequence, which is located within the target strand. The amino acid sequence of the LbCas12a protein is shown in SEQ ID NO: 1; the scaffold sequence of the crRNA sequence is shown in SEQ ID NO: 4; and the spacer sequence of the crRNA sequence is shown in SEQ ID NO:

5. The target strand of the target double-stranded DNA is shown in SEQ ID NO: 6, and the non-target strand is shown in SEQ ID NO:

7. The fluorescent quenching probe contains the fluorescent group FAM and the quenching group BHQ1, and its sequence is shown in SEQ ID NO:

8.

3. A highly sensitive kit for detecting low heterogeneity m.3243A>G mutations in mitochondrial diabetes, characterized in that, include: The composition according to any one of claims 1-2, and the PCR primer pair for amplifying the target region containing the m.3243A>G mutation site.

4. The kit for detecting low heterogeneity m.3243A>G mutation in mitochondrial diabetes according to claim 3, characterized in that, It also includes reaction buffer, RNase inhibitor, and a set of separately packaged controls, including a wild-type control containing a wild-type mitochondrial DNA wild-type sequence and a mutant control containing an m.3243A>G mutation sequence; The upstream primer sequence of the PCR primer pair is shown in SEQ ID NO: 2, and the downstream primer sequence is shown in SEQ ID NO: 3; the wild-type mitochondrial DNA sequence is shown in SEQ ID NO: 9, and the m.3243A>G mutant sequence is shown in SEQ ID NO:

10.

5. Use of the composition of any one of claims 1 to 2 or the kit of any one of claims 3 to 4 in the preparation of a product for assisting in the determination of the mitochondrial DNA m.3243A>G mutation status associated with mitochondrial diabetes.

6. A method for highly sensitive detection of low heterogeneity m.3243A>G mutations in mitochondrial diabetes, characterized in that, The detection is performed using the composition according to any one of claims 1-2 or the kit according to any one of claims 3-4, comprising the following steps: S1. Obtain the sample to be tested, use PCR primer pairs to perform PCR amplification on the sample to obtain the amplification product; S2. Mix the amplification product, LbCas12a protein, crRNA sequence and fluorescence quenching probe and perform LbCas12a cleavage reaction to obtain the enzyme digestion product. S3. Detect the fluorescence signal of the enzyme digestion product, and determine whether the sample to be tested has the m.3243A>G mutation based on the fluorescence signal detection result.

7. The method for highly sensitive detection of low heterogeneity m.3243A>G mutation in mitochondrial diabetes according to claim 6, characterized in that, The test sample is a nucleic acid containing mitochondrial DNA extracted from oral swabs, urine sediment, peripheral blood or saliva samples, and the LbCas12a protein is a purified LbCas12a protein. When performing PCR amplification on the test samples, the PCR amplification program is as follows: 95℃, 10 min; 35x (94℃, 15 sec. - 55℃, 15 sec. - 72℃, 30 sec.); 72℃, 20 min; 10℃, hold.

8. The method for highly sensitive detection of low heterogeneity m.3243A>G mutation in mitochondrial diabetes according to claim 7, characterized in that, In step S3, a blank control is set up. Based on the fold increase in the endpoint fluorescence signal of the test sample relative to the blank control, it is determined whether the test sample has the m.3243A>G mutation. The specific determination criteria are as follows: When the increase in the endpoint fluorescence signal of the test sample relative to the blank control is less than 10-fold, it is determined that there is no m.3243A>G mutation in the test sample, i.e., it is negative; When the endpoint fluorescence signal of the test sample increases by more than 10 times but less than 50 times compared with the blank control, it should be retested, and the result of the retest should be used as the final judgment. When the endpoint fluorescence signal of the test sample increases by 50-400 times compared with the blank control, the test sample is judged to be suspected of having the m.3243A>G mutation and with a low mutation load, i.e., weakly positive. When the endpoint fluorescence signal of the test sample increases by more than 400 times compared to the blank control, the m.3243A>G mutation is determined to exist in the test sample, i.e., it is positive.

9. The method for highly sensitive detection of low heterogeneity m.3243A>G mutation in mitochondrial diabetes according to claim 8, characterized in that, If the repeated test result is still <50 times, the final determination is negative; if the repeated test result is ≥50 times, the determination is made again according to the following rules: when the increase is 50-400 times, it is determined as weakly positive; when the increase is >400 times, it is determined as positive. When the sample to be tested is determined to be weakly positive, the initial amplification product is subjected to a second PCR amplification, and the second amplification product is subjected to LbCas12a cleavage reaction again for final determination. The determination criteria are as follows: if the endpoint fluorescence signal of the second amplification product increases by more than 400 times compared with the blank control, the sample to be tested is determined to have the m.3243A>G mutation, i.e., positive; otherwise, the sample to be tested is determined to not have the m.3243A>G mutation, i.e., negative.

10. The method for highly sensitive detection of low heterogeneity m.3243A>G mutation in mitochondrial diabetes according to claim 9, characterized in that, The method is used to detect m.3243A>G mutations with a mutation load of not less than 1%; after secondary PCR amplification, it can be used to detect m.3243A>G mutations with a mutation load of not less than 0.1%.

Images