Application of ADAMTS19-AS1 as a breast cancer tamoxifen drug resistance marker and a sensitization target

CN122521850APending Publication Date: 2026-08-07PEOPLES HOSPITAL OF HENAN PROV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
PEOPLES HOSPITAL OF HENAN PROV
Filing Date
2026-04-30
Publication Date
2026-08-07

AI Technical Summary

Technical Problem

针对现有技术中乳腺癌他莫昔芬耐药相关分子标志物缺乏、现有候选标志物稳定性和应用针对性不足、兼具耐药评估价值与增敏干预价值的同一分子靶点缺乏等缺陷和不足,本发明旨在提供ADAMTS19-AS1作为乳腺癌他莫昔芬耐药标志物及增敏靶标的应用

Benefits of technology

(1)本发明基于ADAMTS19-AS1在他莫昔芬耐药细胞中表达升高的技术事实,构建了面向ER阳性乳腺癌样本的体外评估技术方案,并进一步落实为引物对、检测试剂盒及离体样本体外评估方法,使耐药相关分子信息能够通过可实施的核酸检测方式获得,从而为ER阳性乳腺癌样本的他莫昔芬耐药倾向评估提供了明确、可操作的分子依据。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122521850A_ABST
    Figure CN122521850A_ABST
Patent Text Reader

Abstract

The application relates to application of ADAMTS19-AS1 as a breast cancer tamoxifen drug resistance marker and a sensitization target, and belongs to the field of tumor molecular biology and biological medicine technology. The application comprises the following aspects: application of ADAMTS19-AS1 in preparation of a product for in-vitro evaluation of ER-positive breast cancer sample tamoxifen drug resistance, the in-vitro evaluation is based on the expression level of ADAMTS19-AS1 in the ER-positive breast cancer sample; the application also comprises application of small interfering RNA for inhibiting ADAMTS19-AS1 expression in preparation of a product for enhancing the sensitivity of ER-positive breast cancer cells to tamoxifen, and the application is combined with tamoxifen. Further, corresponding primer pairs, detection kits and in-vitro evaluation methods are provided. The application can realize in-vitro evaluation of the tamoxifen drug resistance tendency of ER-positive breast cancer, and improve the sensitivity of ER-positive breast cancer cells to tamoxifen.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of tumor molecular biology and biomedicine, and relates to the identification of molecular markers related to endocrine drug resistance in breast cancer and the regulation of drug sensitivity, specifically the application of ADAMTS19-AS1 as a marker of tamoxifen resistance in breast cancer and a target for enhancing sensitivity. Background Technology

[0002] Breast cancer is one of the most common malignant tumors in women, with estrogen receptor-positive (ER+) breast cancer being a prevalent molecular subtype in clinical practice. Endocrine therapy is a crucial long-term treatment for this type of tumor, and tamoxifen, as a typical selective estrogen receptor modulator, has broad application value in inhibiting estrogen receptor signaling, delaying tumor progression, and reducing the risk of recurrence. However, during continuous treatment, some patients gradually develop primary or acquired resistance, leading to decreased drug sensitivity, exacerbated tumor biological behavior, and limited benefits from subsequent treatments. Therefore, research into the mechanisms of tamoxifen resistance and its molecular markers remains an important direction in the field of precision medicine for breast cancer.

[0003] Existing research indicates that endocrine resistance in breast cancer is not caused by a single gene abnormality, but is related to multiple factors, including abnormal activation of receptor signaling, epigenetic regulatory imbalance, cell cycle dysregulation, enhanced invasion and migration, and tumor cell state remodeling. In particular, enhancer remodeling and alterations in the transcriptional regulatory network at the epigenetic level are considered to play a crucial role in the formation and maintenance of resistance. Superenhancers (SEs) are high-density transcriptional regulatory complexes formed by the aggregation of multiple enhancers, and their activity is typically identified by markers such as histone modifications (e.g., H3K27 acetylation, H3K27ac). Compared to ordinary enhancers, SEs can more strongly recruit regulatory elements such as transcription factors, coactivators, and RNA polymerases, thereby driving sustained high-level expression of key genes and non-coding transcripts related to cell fate maintenance, tumor progression, and drug response. Their abnormal activation is often accompanied by enhanced malignant phenotypes in tumor cells. Meanwhile, long non-coding RNAs (lncRNAs) play important roles in chromatin regulation, transcriptional regulation, post-transcriptional processing, and cell fate maintenance. Some lncRNAs have been shown to be involved in endocrine drug resistance, prognostic stratification, and differential drug response in breast cancer. With the continuous development of related research, super enhancer lncRNAs (SE-lncRNAs) have gradually attracted attention. These molecules usually originate from or are significantly regulated by SE regions and can significantly influence tumor cell growth, invasion, drug resistance, and poor prognosis by participating in processes such as chromatin state regulation, maintenance of transcriptional activity, and post-transcriptional expression control.

[0004] However, existing technologies still have significant shortcomings. On the one hand, there is a lack of nucleic acid biomarkers that possess the characteristics of detection feasibility, expression stability, drug resistance relevance, and clinical translational potential in molecular assessment systems for tamoxifen resistance in breast cancer. Existing candidate molecules generally suffer from insufficient specificity, limited repeatability, or limited applicability. On the other hand, although some studies have suggested that certain lncRNAs and SE-lncRNAs are associated with breast cancer malignant progression and abnormal drug response, there is still a lack of systematic and clear technical understanding regarding their specific roles in tamoxifen resistance, their application value as drug resistance biomarkers, and their feasibility as sensitization intervention targets.

[0005] In summary, the formation of tamoxifen resistance in breast cancer involves complex epigenetic regulatory abnormalities and imbalances in non-coding transcriptional regulation. Therefore, how to screen and identify key molecules suitable for in vitro assessment of tamoxifen resistance in ER-positive breast cancer and that can serve as sensitization intervention targets is an urgent technical problem to be solved. Summary of the Invention

[0006] (a) Purpose of the invention To address the shortcomings and deficiencies of existing technologies, such as the lack of molecular biomarkers related to tamoxifen resistance in breast cancer, insufficient stability and specificity of existing candidate biomarkers, and the lack of a single molecular target with both resistance assessment and sensitization intervention value, this invention aims to provide ADAMTS19-AS1 as a biomarker and sensitization target for tamoxifen resistance in breast cancer. By clarifying the correspondence between the expression level of ADAMTS19-AS1 and tamoxifen resistance tendency in ER-positive breast cancer samples, and establishing in vitro assessment products, detection kits, in vitro sample assessment methods, small interfering RNA sensitization applications, and combined application schemes with tamoxifen based on this molecule, this invention achieves in vitro assessment of tamoxifen resistance tendency in ER-positive breast cancer and molecular-level enhancement of tamoxifen sensitivity.

[0007] (II) Technical Solution To achieve the objective of this invention and solve its technical problems, the present invention adopts the following technical solution: In a first aspect, the present invention provides the use of ADAMTS19-AS1 as a tamoxifen resistance marker in breast cancer in the preparation of a product for in vitro assessment of tamoxifen resistance in ER-positive breast cancer samples, wherein the in vitro assessment is based on the expression level of ADAMTS19-AS1 in the sample.

[0008] Preferably, the in vitro assessment includes comparing the expression level of ADAMTS19-AS1 in the ER-positive breast cancer sample to be tested with the expression level of ADAMTS19-AS1 in the ER-positive breast cancer tamoxifen-sensitive control sample; when the expression level of ADAMTS19-AS1 in the test sample is elevated, it indicates that the test sample has a high tendency to resist tamoxifen.

[0009] Preferably, the expression level of ADAMTS19-AS1 is the mRNA expression level, and the mRNA expression level is obtained by quantitative real-time PCR detection.

[0010] Preferably, the ER-positive breast cancer sample is an in vitro breast cancer tissue sample, an in vitro breast cancer cell sample, or an RNA sample derived from an in vitro sample or a cDNA sample obtained by reverse transcription thereof.

[0011] Preferably, the product contains a primer pair for detecting the expression level of ADAMTS19-AS1, with the following nucleotide sequences: upstream primer: 5′-GACCCCTTAACCTGCACCTC-3′; downstream primer: 5′-GCCTCGGAAACTCATCTGCT-3′.

[0012] Secondly, the present invention provides a detection kit for in vitro assessment of tamoxifen resistance in ER-positive breast cancer samples. The detection kit comprises the primer pairs described above for detecting ADAMTS19-AS1 expression levels, primer pairs for detecting the internal control 18S, and reaction reagents for performing quantitative real-time PCR detection. The nucleotide sequences of the 18S primer pairs are as follows: Upstream primer: 5′-GTAACCCGTTGAACCCCATT-3′; Downstream primer: 5′-CCATCCAATCGGTAGTAGCG-3′.

[0013] Thirdly, the present invention provides the use of small interfering RNA for inhibiting ADAMTS19-AS1 expression in the preparation of a product for enhancing the sensitivity of ER-positive breast cancer cells to tamoxifen, wherein the enhancement is to reduce the tamoxifen resistance-related survival of ER-positive breast cancer cells.

[0014] Preferably, the small interfering RNA for inhibiting ADAMTS19-AS1 expression is selected from any of the following: si-1, whose positive chain sequence is 5′-GGAAAGGAAGCGAGAAAGUCATT-3′, and whose negative chain sequence is 5′-UGACUUUCUCGCUUCCUUUCCUU-3′; si-2 has a positive chain sequence of 5′-CAGGCAGAGGACUGCCCGGCUU-3′ and an antisense chain sequence of 5′-GCCGGGCAGUCCUCUGCCUGUU-3′.

[0015] Fourthly, the present invention provides a composition for enhancing the sensitivity of ER-positive breast cancer cells to tamoxifen, the composition comprising tamoxifen and a small interfering RNA for inhibiting ADAMTS19-AS1 expression, the small interfering RNA being used to downregulate the expression level of ADAMTS19-AS1.

[0016] Preferably, the small interfering RNA is si-1 and / or si-2 designed for ADAMTS19-AS1 as described above, and tamoxifen and the small interfering RNA are used in combination.

[0017] Fifthly, the present invention also provides a method for in vitro assessment of tamoxifen resistance tendency in isolated ER-positive breast cancer cell samples, comprising: SS1. Sample Nucleic Acid Preparation: Total RNA was extracted from the isolated ER-positive breast cancer cell samples to be tested and reverse transcribed to obtain cDNA; SS2. Target molecule detection: The expression level of ADAMTS19-AS1 in cDNA was detected by real-time quantitative PCR and corrected by the internal reference gene 18S. SS3. Drug resistance tendency assessment: The expression level of ADAMTS19-AS1 in the test sample and the tamoxifen-sensitive control cell sample of ER positive breast cancer was compared. When the expression level of ADAMTS19-AS1 was increased, the test sample was determined to have a high tamoxifen resistance tendency.

[0018] (III) Technical Effects Compared with the prior art, the application of ADAMTS19-AS1 of the present invention as a tamoxifen resistance marker and sensitizing target in breast cancer has the following beneficial and significant technical effects: (1) Based on the technical fact that ADAMTS19-AS1 is expressed in tamoxifen-resistant cells, this invention constructs an in vitro assessment technology scheme for ER-positive breast cancer samples, and further implements it as primer pairs, detection kits and in vitro sample assessment methods, so that drug resistance-related molecular information can be obtained through feasible nucleic acid detection methods, thereby providing clear and operable molecular basis for the assessment of tamoxifen resistance tendency of ER-positive breast cancer samples.

[0019] (2) This invention not only confirms that ADAMTS19-AS1 has the value of a drug resistance marker, but also further clarifies that it can be used as a sensitization intervention target. By using small interfering RNA targeting ADAMTS19-AS1 and combining it with tamoxifen, the drug resistance-related survival ability of ER positive breast cancer cells can be reduced, and the invasive ability and cell cycle activity can be inhibited. Thus, the front-end drug resistance recognition and the back-end sensitivity enhancement are unified in the same molecular object, forming a complete application scheme for the tamoxifen resistance scenario of ER positive breast cancer. Attached Figure Description

[0020] Figure 1 The diagram shows the difference in activity of H3K27ac-labeled enhancer and superenhancer regions between sensitive and drug-resistant cells. In the diagram: A is the distribution of chromatin binding of H3K27ac in MCF7 / WT and MCF7 / TamR cells; B is a comparison of binding peaks of H3K27ac in the global region, enhancer region, and superenhancer region; in the diagram, TSS represents the transcription start site, TES represents the transcription termination site, WT represents sensitive cells MCF7 / WT, and TamR represents drug-resistant cells MCF7 / TamR.

[0021] Figure 2The diagram shows the differential expression profiles of lncRNAs and related functional enrichment analysis between sensitive and drug-resistant cells. In this diagram: A is a volcano plot of differential lncRNA expression, where the horizontal axis log2FoldChange represents the logarithmic value of the fold change in differential expression (base 2), and the vertical axis -log10(padj) represents the negative logarithmic value of the corrected P-value. Up indicates upregulated lncRNAs, and down indicates downregulated lncRNAs. B is a heatmap of differential lncRNA expression. C-E are point plots of differential gene functional cluster analysis.

[0022] Figure 3 The diagram shows the screening of ADAMTS19-AS1 and its correlation with patient outcomes. A is a trend diagram of H3K27ac transcriptional regulation function, where static (background) represents the static background gene set, upregulate (5.88e-06) represents the upregulated gene set, and downregulate (0.995) represents the downregulated gene set. B is a trend diagram of H3K27ac super-enhancers. C is an intersection analysis diagram of super-enhancer SEs-related lncRNAs and upregulated lncRNAs in drug-resistant cells, where WT_H3K27ac_SEs and TamR_H3K27ac_SEs are the sets of H3K27ac-labeled super-enhancer-related lncRNAs in MCF7 / WT and MCF7 / TamR cells, respectively, and WT / TamR_up_SEs is the set of lncRNAs upregulated in drug-resistant cells compared to sensitive cells. D is an analysis diagram of the correlation between ADAMTS19-AS1 and the survival of breast cancer patients undergoing endocrine therapy.

[0023] Figure 4 The diagram shows the validation of high expression of ADAMTS19-AS1 in tamoxifen-resistant cells. In the diagram: A is the cell response curve of MCF7 / WT cells and MCF7 / TamR cells under different concentrations of tamoxifen treatment; B is the comparison of the expression level of ADAMTS19-AS1 in MCF7 / WT cells and MCF7 / TamR cells.

[0024] Figure 5The diagram shows the effect of ADAMTS19-AS1 expression changes on cellular tamoxifen response. Specifically: A is the expression validation diagram after ADAMTS19-AS1 overexpression; B is the change in cellular tamoxifen response after ADAMTS19-AS1 overexpression; C is the expression validation diagram after ADAMTS19-AS1 knockdown; and D is the change in cellular tamoxifen response after ADAMTS19-AS1 knockdown. In the diagram, Vector represents the empty vector control group, OE-lnc represents the ADAMTS19-AS1 overexpression group, Si-NC represents the negative control small interfering RNA group, Si-1 represents the first small interfering RNA group targeting ADAMTS19-AS1, and Si-2 represents the second small interfering RNA group targeting ADAMTS19-AS1.

[0025] Figure 6 The images show the effects of overexpression or knockdown of ADAMTS19-AS1 on the tamoxifen resistance phenotype of MCF7 / TamR cells. In the images, A shows the cell phenotype after ADAMTS19-AS1 overexpression, and B shows the cell phenotype after ADAMTS19-AS1 knockdown.

[0026] Figure 7 The figure shown is a detection graph of the effect of ADAMTS19-AS1 on the invasive ability of MCF7 / TamR cells, where: A is the cell invasion graph after ADAMTS19-AS1 overexpression; B is the cell invasion graph after ADAMTS19-AS1 knockdown.

[0027] Figure 8 The diagram shows the effect of ADAMTS19-AS1 on the cell cycle status of MCF7 / TamR cells. In the diagram: A is the cell cycle analysis after ADAMTS19-AS1 overexpression; B is the cell cycle analysis after ADAMTS19-AS1 knockdown. Detailed Implementation

[0028] This invention aims to provide the application of ADAMTS19-AS1 as a biomarker and sensitizing target for tamoxifen resistance in breast cancer. To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be described in more detail below with reference to the accompanying drawings. The described embodiments are some, but not all, embodiments of this invention, and are exemplary and intended to explain the invention, not to limit it. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0029] It should be noted that experimental materials, reagents, culture conditions, analytical software, and instruments not specifically described in this invention can all be implemented using conditions conventionally available in the field. ER-positive breast cancer samples can be isolated breast cancer tissue samples, isolated breast cancer cell samples, or RNA samples derived from the aforementioned isolated samples and cDNA samples obtained from their reverse transcription. ADAMTS19-AS1 is a target long non-coding RNA obtained through H3K27ac-labeled super-enhancer-related screening and experimentally verified in this invention. It can be used to assess the resistance tendency of ER-positive breast cancer samples to tamoxifen in vitro and can serve as a molecular intervention target for improving the sensitivity of ER-positive breast cancer cells to tamoxifen.

[0030] To facilitate standardized description of nucleic acid sequences, the nucleotide sequence corresponding to ADAMTS19-AS1, the primer sequences for detecting ADAMTS19-AS1, the primer sequences for detecting the internal control 18S, and the small interfering RNA sequences for downregulating ADAMTS19-AS1 expression are all numbered and recorded in the sequence listing. Specifically, the nucleotide sequence corresponding to ADAMTS19-AS1 is recorded as SEQ ID NO.1; the forward and reverse primers for detecting ADAMTS19-AS1 are recorded as SEQ ID NO.2 and SEQ ID NO.3, respectively; the forward and reverse primers for detecting the internal control 18S are recorded as SEQ ID NO.4 and SEQ ID NO.5, respectively; the sense and antisense strands of si-1 are recorded as SEQ ID NO.6 and SEQ ID NO.7, respectively; and the sense and antisense strands of si-2 are recorded as SEQ ID NO.8 and SEQ ID NO.9, respectively. The aforementioned sequence listings correspond to the target molecule description in Example 1, the in vitro evaluation and detection in Example 2, and the small interfering RNA sensitization implementation method in Example 3, respectively.

[0031] Example 1: Screening and Identification of Target Molecules This embodiment is used to illustrate the basis of ADAMTS19-AS1 as a screening source for the target molecule of this invention and its association with tamoxifen resistance.

[0032] 1.1 ChIP-seq Data Analysis GSE113092 data was downloaded from the GEO database to obtain raw sra format sequencing data. The sra data was converted to FASTQ data using sratoolkit. FASTQC was used for quality control of the FASTQ data. TrimGalore was used to filter the FASTQ data. Bowtie2 was used to align the filtered FASTQ data to the human hg38 reference genome. SAMtools was used to filter and sort the aligned SAM data to generate BAM data. ROSE software was used to analyze and identify enhancers and superenhancers. Deeptools was used for enrichment peak visualization. MACS2 was used to identify enriched peaks in the BAM data. ChIPseeker was used to annotate the enriched peaks. Finally, IGV (Integrative Genomics Viewer) and UCSC genome browser were used to visualize the genome enriched peaks.

[0033] Combination Figure 1 It can be seen that the chromatin regulatory region marked with H3K27ac exhibits more active epigenetic features in tamoxifen-resistant cells. Specifically, Figure 1 A shows the distribution of H3K27ac binding sites relative to different genomic regions near transcription start sites, indicating that in MCF7 / WT cells (tamoxifen-sensitive ER-positive breast cancer cells) and MCF7 / TamR cells (tamoxifen-resistant ER-positive breast cancer cells), H3K27ac signals are mainly distributed near transcription start sites and their upstream and downstream regulatory regions, suggesting the presence of active transcriptional regulatory elements in both cell types. Figure 1 B reflects the differences in binding peaks within the overall region, enhanced sub-regions, and super-enhanced sub-regions. Figure 1 As shown in Figure B, the H3K27ac enrichment signal in MCF7 / TamR cells was generally higher or stronger than that in MCF7 / WT cells within the overall chromatin region, enhancer region, and superenhancer region. Particularly in the superenhancer region, the H3K27ac signal enhancement was more pronounced in drug-resistant cells, indicating that the superenhancer region, associated with key transcriptional regulation, is at a higher activation level under drug resistance. These results suggest that ER-positive breast cancer cells acquire tamoxifen resistance accompanied by enhancer landscape remodeling and abnormal activation of superenhancers, providing an epigenetic basis for subsequent screening of drug resistance-related target molecules from superenhancer-related lncRNAs.

[0034] 1.2 RNA-seq data analysis GSE106681 data was downloaded from the GEO database to obtain raw sequencing data in sra format. The sra format data was converted to fastq format using sratoolkit software. Fastqc was used for quality control of the fastq format data. TrimGalore software was used to filter the fastq data, and HISAT2 software was used to align the filtered fastq data to the human hg38 reference genome. SAM tools were used to filter and sort the aligned SAM data to generate BAM data. HTseq software was used to calculate gene counts from the BAM data. DEseq2 was used to perform differential count analysis between the control and treatment groups. ClusterProfiler was used for functional enrichment analysis of differentially expressed genes. BETA software was used to perform joint analysis of ChIP-seq and RNA-seq data.

[0035] Combination Figure 2 It can be seen that there are significant differential lncRNA expression profiles and corresponding functional remodeling characteristics between MCF7 / WT cells and MCF7 / TamR cells. Specifically, Figure 2 A volcano plot showed a greater number of upregulated and downregulated lncRNAs compared to sensitive cells, indicating that tamoxifen resistance is accompanied by extensive transcriptional reprogramming. Figure 2 The heatmap further shows that differentially expressed lncRNAs can effectively distinguish between MCF7 / WT cells and MCF7 / TamR cells, indicating that drug-resistant cells have a relatively stable and identifiable lncRNA expression pattern. Figure 2 C to Figure 2 GO functional clustering results of E showed that differentially expressed genes mainly involved remodeling at three levels: biological processes, molecular functions, and cellular components. These included signal release, exocytosis, ion transport regulation, lipid localization, chromatin remodeling, DNA-related complex assembly, ion channel activity, extracellular matrix structural components, and cell junction and adhesion-related structures. This suggests that during the acquisition of tamoxifen resistance, ER-positive breast cancer cells not only underwent changes at the lncRNA expression level, but also experienced systemic alterations in transcriptional regulation, membrane receptor signaling, cellular structural composition, and microenvironment-related functions. This provides transcriptomics evidence for subsequently identifying ADAMTS19-AS1 as a drug resistance-related target molecule.

[0036] 1.3 Joint screening and target molecule identification The super-enhancer-related lncRNAs obtained from ChIP-seq analysis were cross-screened with differentially expressed lncRNAs upregulated in drug-resistant cells. Combined with... Figure 3The analysis of H3K27ac-related transcriptional regulation and the results of super-enhancer screening indicate that a more active super-enhancer regulatory background exists in drug-resistant cells, which can further narrow down the screening range of drug resistance-related target molecules. Specifically, Figure 3 A shows that after sorting genes based on regulatory potential scores, the cumulative curves corresponding to the upregulated gene set are generally above the static background curve, while the cumulative curves corresponding to the downregulated gene set are generally below the background curve, indicating that the H3K27ac enrichment signal is significantly associated with transcriptional activation under drug resistance. Figure 3 B further showed that as enhancer sequencing progressed, the H3K27ac normalized signal in MCF7 / TamR cells exhibited a more prominent enrichment leap in the superenhancer region, suggesting that the activation level of superenhancers was enhanced in drug-resistant cells. Figure 3 C conducted an intersection analysis on super-enhancer-related lncRNAs in MCF7 / WT and MCF7 / TamR cells, as well as upregulated lncRNAs in drug-resistant strains, and screened out ADAMTS19-AS1, indicating that this molecule possesses both super-enhancer-related properties and drug resistance-related upregulated expression characteristics. Figure 3 D further indicated that in breast cancer patients undergoing endocrine therapy, the survival rate was lower in the ADAMTS19-AS1 high-expression group than in the low-expression group, suggesting that high ADAMTS19-AS1 expression is associated with poorer prognosis. These results collectively demonstrate that ADAMTS19-AS1 not only originates from the drug resistance-related super-enhancer selection process but also possesses dual characteristics of transcriptional upregulation and association with adverse clinical outcomes, making it a key target molecule for tamoxifen resistance in breast cancer.

[0037] Further integration Figure 4 It is known that ADAMTS19-AS1 is stably highly expressed in tamoxifen-resistant cells and corresponds consistently with the drug resistance phenotype. Specifically, Figure 4 A shows that under different concentrations of tamoxifen treatment, the overall drug response curve of MCF7 / TamR cells was higher than that of MCF7 / WT cells, indicating that the drug-resistant cells showed stronger tolerance to tamoxifen under the same drug concentration, suggesting that they have a higher level of drug resistance. Figure 4 B further showed that the relative expression level of ADAMTS19-AS1 in MCF7 / TamR cells was significantly higher than that in MCF7 / WT cells, indicating that this molecule is upregulated in drug-resistant cells. These results suggest that high expression of ADAMTS19-AS1 is closely related to the tamoxifen resistance phenotype in ER-positive breast cancer cells, and can serve as the target molecular basis for subsequent in vitro assessment and sensitization intervention protocols.

[0038] 1.4 Description of the nucleotide sequence of the target molecule To illustrate the target molecule obtained by screening in this embodiment at the molecular level, the corresponding nucleotide sequence of ADAMTS19-AS1 used in the present invention is as follows, corresponding to SEQ ID NO.1 in the sequence list: TATTCCACATACGGTTAAAACGAGGCCGGCAGAAGTGTGCTTCATTTCCGAACTTGACCCCTTAACCTGCACCTCAAGCTCATTTTTATTGCTACCCACTGAGCCCTGCTCTCCACGCACCGGTTGCACCAGCCCTGCCGACCCGTACGTTCGCGGTCTCCGCTGGGATGGCTGGAAAGGAAGCGAGAAAGTCACGGAAGAACTTACCTGAAACGATCCCATTCGACAGGAACCCCAGCTGGTAAAGGAGGCAGCAGCAGCAGATGAGTTTCCGAGGCCGAGCAGGCTAGTGCTGGAGCCCCACAAGACAGACCCACAGCCAGCCGAGAGCCGGGAGTGCTGCCTCTGGACAGGCAGAGGACTGCCCGGCGCGGGCAGGAGAGCTGTGGTGTCCGAGCCGAGGCTCGCCGCCTGCACCCGCGCGGAACGGGCGGAGGCTGGTGTCACAGTCTCAGCAACTTGGTGTGCCAAGCTCCGCACACTCCTCACGCTCCTTAGGACGCACCGCTGAAGGCTCTCACCCGCAGCGGCGCGGGAGGGAATGAGTAGGGAGATGGGAAGACACGACTAGAGAGGTGGGTTGTAGAGCAGAAAAGAATCAAGCACATCTGACCAGAAAAAGGGACCAAGGGGTGCCCGCCAAGCGTGACTTTGCGGGACAAAGGTCCCAGAACACCGTGCACGTGCTCAAACGCCGGTTGGGATGGGGTGGGGACCCAAAATCCCTCACCTGACTATTGATTGGCCACTCGGGAAGGCCTGATTTGCATCCATCCCCTGCCCCCG Based on the above nucleotide sequence, primer pairs for detecting ADAMTS19-AS1 expression levels and small interfering RNAs for downregulating ADAMTS19-AS1 expression can be further designed. The ADAMTS19-AS1-specific primer pairs used in Example 2, and si-1 and si-2 used in Example 3, are all based on the corresponding nucleotide sequence of the target molecule, thus ensuring consistency in the screening, detection, and intervention of the target molecule at the molecular level.

[0039] Example 2: In vitro assessment based on ADAMTS19-AS1 Following the identification of ADAMTS19-AS1 as a target molecule associated with tamoxifen resistance in Example 1 through H3K27ac-related super enhancer screening and transcriptome analysis, this example focuses on the detection and interpretation of ADAMTS19-AS1 in ER-positive breast cancer samples. It specifically provides the sample nucleic acid extraction, genomic DNA removal, reverse transcription, quantitative real-time PCR detection, and drug resistance tendency interpretation process, thereby forming an in vitro assessment implementation method based on ADAMTS19-AS1 expression level.

[0040] 2.1 RNA extraction Take the ER-positive breast cancer cell sample to be tested, add 1 mL of TRIzol to each well, lyse at 4°C for 10 min, and then transfer to an RNase-free centrifuge tube. Add 200 μL of chloroform to each 1 mL of TRIzol, vortex thoroughly to mix, incubate at room temperature for 10 min, and then centrifuge at 4°C and 12000×g for 15 min. Transfer approximately 400-500 μL of the supernatant to a new RNase-free centrifuge tube, add 500 μL of isopropanol to each 1 mL of TRIzol, incubate at room temperature for 10 min, and then centrifuge at 4°C and 12000×g for 10 min. Discard the supernatant, wash once with 1 mL of 75% ethanol, and centrifuge at 4°C and 7500×g for 5 min. After air-drying the RNA precipitate, it was gently dissolved by pipetting with an appropriate amount of RNase-free water, and the RNA concentration, OD260 / OD280, and OD260 / OD230 were determined using a one-drop OD1000 to obtain the total RNA sample required for subsequent detection.

[0041] 2.2 RNA degenomicization and reverse transcription To reduce the interference of residual genomic DNA on subsequent quantitative real-time PCR results, the total RNA extracted above was first treated to remove genomic DNA. Specifically, the reaction solution was prepared according to the DNase I Kit instructions: 1 μg of total RNA was added to 4 μL of 4× gDNA wiper Mix, and RNase-free water was added to a final volume of 16 μL. After gently mixing with a pipette, the mixture was briefly centrifuged using a handheld centrifuge to concentrate the reaction solution at the bottom of the tube. The tube was then placed in a PCR instrument and incubated at 42°C for 2 min. The treated reaction solution was used for subsequent reverse transcription.

[0042] After genomic DNA removal, reverse transcription was performed according to the HiScript II 1st Strand cDNA Synthesis Kit instructions. Specifically, 4 μL of 5× HiScript III qRT SuperMix was added to the reaction solution to bring the total reaction volume to 20 μL. After gently mixing with a pipette, the mixture was briefly centrifuged using a handheld centrifuge and then placed in a PCR instrument for the following sequence: 37°C for 15 min to complete first-strand cDNA synthesis; 85°C for 5 s to terminate the reaction; and then incubated at 4°C. After the program was completed, the resulting cDNA was stored at -20°C for subsequent quantitative PCR detection.

[0043] 2.3 Quantitative Real-Time PCR Detection The expression level of ADAMTS19-AS1 in the samples was detected by real-time PCR, and the results were corrected using the internal reference gene 18S. The reaction solution was prepared according to the SYBR Green Master Mix kit instructions. Each reaction system contained 5 μL of SYBR Green Master Mix, 0.4 μL of Primer mix (10 μM), 3.6 μL of sterile deionized water, and 1 μL of cDNA. The cDNA was diluted 1:10 with sterile deionized water before use. After mixing all components, the mixture was gently pipetted to ensure homogeneity, and then added to the real-time PCR plate for amplification and detection. The real-time PCR program included: a pre-denaturation stage at 95°C for 30 s; an amplification stage consisting of 45 cycles, each cycle including 10 s at 95°C and 30 s at 60°C; and a melting curve analysis stage, consisting of 15 s at 95°C, 60 s at 60°C, and 15 s at 95°C. Melting curve analysis can further determine the specificity of the amplified products, thus ensuring the reliability of the target molecule detection results.

[0044] The primer sequences used for detecting ADAMTS19-AS1 are as follows, corresponding to SEQ ID NO.2 and SEQ ID NO.3 in the sequence listing, respectively: Forward primer: 5′-GACCCCTTAACCTGCACCTC-3′; Reverse primer: 5′-GCCTCGGAAACTCATCTGCT-3′.

[0045] The primer sequences used to detect the internal reference gene 18S are as follows, corresponding to SEQ ID NO.4 and SEQ ID NO.5 in the sequence listing, respectively: Forward primer: 5′-GTAACCCGTTGAACCCCATT-3′; Reverse primer: 5′-CCATCCAATCGGTAGTAGCG-3′.

[0046] After amplification, the results of real-time PCR detection of ADAMTS19-AS1 and 18S were obtained, and the detection results of ADAMTS19-AS1 were corrected using the internal reference gene 18S to obtain the relative expression level of ADAMTS19-AS1 in the test sample. The relative expression level of ADAMTS19-AS1 in the test sample was compared with the relative expression level of ADAMTS19-AS1 in the tamoxifen-sensitive control sample of ER-positive breast cancer; when the relative expression level of ADAMTS19-AS1 in the test sample increased, the test sample was determined to have a high tendency for tamoxifen resistance. This detection step is similar to... Figure 4 The results shown in Figure B, indicating high expression of ADAMTS19-AS1 in MCF7 / TamR cells, correspond to this finding and can serve as the basis for the in vitro evaluation method and detection kit of this invention.

[0047] 2.4 Interpretation Logic The relative expression level of ADAMTS19-AS1 in the tested ER-positive breast cancer cell samples was compared with the relative expression level of ADAMTS19-AS1 in ER-positive breast cancer tamoxifen-sensitive control cell samples. When the relative expression level of ADAMTS19-AS1 in the tested sample increased, the sample was considered to have a high tendency for tamoxifen resistance. Figure 4 A and Figure 4 As shown in B, MCF7 / TamR cells exhibit stronger tamoxifen tolerance than MCF7 / WT cells, and ADAMTS19-AS1 expression levels are significantly elevated. Therefore, the above interpretation logic can provide molecular evidence for the in vitro assessment of tamoxifen resistance tendency in ER-positive breast cancer samples.

[0048] Based on the above detection process, this invention also provides a detection kit for in vitro assessment of tamoxifen resistance in ER-positive breast cancer samples, comprising: primer pairs for detecting ADAMTS19-AS1 expression levels, primer pairs for detecting internal control 18S expression levels, reverse transcription reaction reagents, and real-time PCR reaction reagents. The primer pairs for detecting ADAMTS19-AS1 expression levels include a forward primer 5′-GACCCCTTAACCTGCACCTC-3′ and a reverse primer 5′-GCCTCGGAAACTCATCTGCT-3′; the primer pairs for detecting the internal control 18S expression levels include a forward primer 5′-GTAACCCGTTGAACCCCATT-3′ and a reverse primer 5′-CCATCCAATCGGTAGTAGCG-3′. The ADAMTS19-AS1 primer pair and the 18S primer pair in the detection kit correspond to SEQ ID NO.2 to SEQ ID NO.5 in the sequence listing, respectively. In this procedure, total RNA is first extracted from the sample and reverse transcribed to obtain cDNA. Then, quantitative real-time PCR is performed using ADAMTS19-AS1 and 18S primer pairs. Finally, in vitro drug resistance propensity is assessed based on the relative expression level of ADAMTS19-AS1 after 18S correction. Example 2 thus provides the in vitro assessment process based on ADAMTS19-AS1 expression levels and outlines the components of the detection kit used to perform this assessment.

[0049] Example 3: Small interfering RNA sensitization based on ADAMTS19-AS1 expression inhibition After establishing an in vitro evaluation implementation method based on ADAMTS19-AS1 expression level in Example 2, this example further focuses on the construction and application of small interfering RNA for ADAMTS19-AS1 expression inhibition. It specifically describes the small interfering RNA sequence for ADAMTS19-AS1, the cell transfection process, and the sensitization verification path after transfection combined with tamoxifen treatment, forming an implementation method for tamoxifen sensitization of ER-positive breast cancer cells based on ADAMTS19-AS1 inhibition.

[0050] 3.1 Small interfering RNA sequences Small interfering RNAs were designed and used for ADAMTS19-AS1. The sense and antisense strands of si-1 correspond to SEQ ID NO.6 and SEQ ID NO.7 in the sequence listing, respectively, and the sense and antisense strands of si-2 correspond to SEQ ID NO.8 and SEQ ID NO.9 in the sequence listing, respectively. si-1 Justice Chain: 5′-GGAAAGGAAGCGAGAAAGUCATT-3′; si-1 antisense chain: 5′-UGACUUUCUCGCUUCCUUUCCUU-3′; Si-2 Justice Chain: 5′-CAGGCAGAGGACUGCCCGGCUU-3′; si-2 antisense chain: 5′-GCCGGGCAGUCCUCUGCCUGUU-3′.

[0051] Both si-1 and si-2 are small interfering RNAs designed based on the corresponding nucleotide sequence of ADAMTS19-AS1. They can be used to downregulate the expression level of ADAMTS19-AS1 to verify its functional role in the tamoxifen resistance-related phenotype of ER-positive breast cancer cells.

[0052] 3.2 Cell transfection Press 3×10 5 Cells were seeded into 6-well plates at 1 / well ratio. The medium was replaced with basal medium the following day, followed by an 8-hour starvation treatment. Plasmids and siRNA were transfected using Lipofectamine 3000. A first mixture was prepared by adding 5 μL siRNA to 120 μL OPTI-MEM, resulting in a final siRNA concentration of 5 nM. A second mixture was prepared by adding 5 μL Lipofectamine 3000 to 120 μL OPTI-MEM. The first mixture was added to the second mixture and gently pipetted to mix. After standing for 5 min, the mixture was added dropwise to the 6-well plates. After 8 hours, the medium was replaced with complete medium, and the cells were cultured for another 48 hours. Cells were then collected for subsequent drug sensitivity testing, invasion analysis, and cell cycle analysis.

[0053] 3.3 Tamoxifen Sensitivity Verification After siRNA transfection, cells were treated with tamoxifen, and cell viability was used to evaluate the changes in drug response after inhibition of ADAMTS19-AS1 expression. Specifically, after digestion, cells were centrifuged at 2000 rpm for 3 min, the supernatant was discarded, and the cells were resuspended in 1 mL of complete culture medium and counted. Cells were seeded at 3000 cells / well in 96-well plates, with six replicates per group. Sterile water was added to the peripheral wells of the 96-well plates. The next day, cells were treated with gradient concentrations of tamoxifen. After 72 h of treatment, 10 μL of CCK8 reagent was added to each well, and the cells were incubated in a cell culture incubator for another 4 h. OD450 was measured using a microplate reader, and cell proliferation or survival curves were plotted.

[0054] Combination Figure 5 and Figure 6 It can be seen that changes in ADAMTS19-AS1 expression correspond consistently with the tamoxifen resistance phenotype in MCF7 / TamR cells. Specifically, Figure 5A showed that the relative expression level of ADAMTS19-AS1 increased significantly after overexpression treatment; Figure 5 B further showed that, under different concentrations of tamoxifen treatment, the overall drug response curve of cells overexpressing ADAMTS19-AS1 was higher than that of the vector control group, indicating that the cells had enhanced tolerance to tamoxifen. Figure 5 C showed that the relative expression level of ADAMTS19-AS1 decreased significantly after si-1 or si-2 intervention; Figure 5 D further indicated that after knocking down ADAMTS19-AS1, the overall drug response curves of cells treated with different concentrations of tamoxifen were lower than those of the negative control group, indicating that the cells' tolerance to tamoxifen was weakened. Figure 6 Cellular phenotype observations showed that overexpression of ADAMTS19-AS1 maintained strong drug resistance in MCF7 / TamR cells, while knockdown of ADAMTS19-AS1 reduced drug resistance in MCF7 / TamR cells. These results collectively indicate that ADAMTS19-AS1 promotes tamoxifen resistance in ER-positive breast cancer cells, and downregulating ADAMTS19-AS1 expression with small interfering RNA reduces resistance-related survival, thereby enhancing cellular sensitivity to tamoxifen.

[0055] 3.4 Combined use of tamoxifen In ER-positive drug-resistant breast cancer cells, transfection with si-1 or si-2 as described in this example was performed to inhibit the expression of ADAMTS19-AS1. Forty-eight hours after transfection, tamoxifen was administered, and cell viability changes were detected according to the method described in 3.3. The results showed that under ADAMTS19-AS1 inhibition, the cell response to tamoxifen was enhanced, manifested as increased cell death and decreased drug resistance. This indicates that small interfering RNA (MIRNA) can be used in combination with tamoxifen to inhibit ADAMTS19-AS1 expression and enhance the sensitivity of ER-positive breast cancer cells to tamoxifen.

[0056] Example 4: Validation of the accompanying phenotype after ADAMTS19-AS1 expression inhibition Building upon Example 3, which demonstrated that inhibiting ADAMTS19-AS1 expression with small interfering RNA enhanced the sensitivity of ER-positive breast cancer cells to tamoxifen, this example further validates the accompanying phenotypic changes following ADAMTS19-AS1 expression inhibition, specifically including invasiveness assays and cell cycle assays, to illustrate the impact of expression inhibition on drug resistance-related malignant phenotypes.

[0057] 4.1 Transwell invasion experiment Cells were digested 48 hours after drug treatment, centrifuged at 2000 rpm for 3 min, the supernatant was discarded, and the cells were resuspended in 1 mL of complete culture medium and counted. Transwell chambers with a pore size of 8.0 μm and coated with matrix gel were used. 600 μL of medium containing 10% FBS was added to the lower chamber, and 200 μL of basal medium was added to the upper chamber to resuspend 20,000 cells. After culturing for 48 h, the medium was discarded, and the chambers were washed twice with PBS. The cells were fixed with 4% paraformaldehyde for 30 min, washed twice more with PBS, and then stained with 0.1% crystal violet for 1 h. After wiping the cells in the upper chamber with a cotton swab, excess dye was washed off with water, and the cells were air-dried and photographed under a microscope.

[0058] Combination Figure 7 It can be seen that changes in ADAMTS19-AS1 expression correspond consistently with changes in the invasive ability of MCF7 / TamR cells. Specifically, Figure 7 A showed that under ADAMTS19-AS1 overexpression conditions, the number of MCF7 / TamR cells that invasively crossed the Transwell membrane through the matrix gel was significantly increased, indicating that ADAMTS19-AS1 upregulation can enhance the invasive phenotype of drug-resistant cells. Figure 7 B showed that knocking down ADAMTS19-AS1 with si-1 or si-2 significantly reduced the number of invasive MCF7 / TamR cells, indicating that downregulation of ADAMTS19-AS1 can inhibit the invasive ability of drug-resistant cells. These results suggest that ADAMTS19-AS1 not only participates in the process of tamoxifen resistance in ER-positive breast cancer cells but is also closely related to the maintenance of the resistance-associated invasive phenotype. Downregulating ADAMTS19-AS1 expression with small interfering RNA enhances cellular sensitivity to tamoxifen while reducing resistance-associated invasiveness.

[0059] 4.2 Cell cycle verification Cells were digested after 48 h of drug treatment, centrifuged at 2000 rpm for 3 min, and the supernatant was discarded. The cells were washed once with pre-chilled PBS at 4°C, and then centrifuged again at 2000 rpm for 3 min to pellet the cells. The cells were resuspended in 1 mL of pre-chilled PBS at 4°C, and 4 mL of pre-chilled 95% ethanol at 4°C was added dropwise. The mixture was thoroughly mixed and fixed at 4°C for 2 h. After fixation, the cells were centrifuged at 2000 rpm for 5 min to pellet the cells. 1 mL of pre-chilled PBS at 4°C was added to resuspend the cells, and the mixture was centrifuged again at 2000 rpm for 5 min to pellet the cells. 50 μL of PBS was retained, and the cells were gently tapped at the bottom of the centrifuge tube to disperse them. Then, 400 μL of staining buffer, 15 μL of PI staining solution, and 2 μL of RNase A were added sequentially. The cell pellet was slowly and thoroughly resuspended, and the mixture was incubated at 37°C for 30 min in the dark. Finally, flow cytometry was used for analysis.

[0060] Combination Figure 8 It can be seen that changes in ADAMTS19-AS1 expression correspond consistently with changes in the cell cycle distribution state of MCF7 / TamR cells. Specifically, Figure 8 A showed that under ADAMTS19-AS1 overexpression, the cell cycle progression of MCF7 / TamR cells was more active, with an enhanced trend of cells advancing from G1 phase to S phase and G2 phase, suggesting that ADAMTS19-AS1 upregulation is beneficial to maintaining the proliferative activity of drug-resistant cells. Figure 8 B showed that knocking down ADAMTS19-AS1 with si-1 or si-2 resulted in cell cycle arrest in MCF7 / TamR cells, indicating suppressed cell cycle progression. This suggests that downregulation of ADAMTS19-AS1 is detrimental to the sustained proliferation of drug-resistant cells. These results indicate that ADAMTS19-AS1 is not only involved in the tamoxifen resistance process in ER-positive breast cancer cells but is also closely related to the maintenance of an active cell cycle in drug-resistant cells. Downregulating ADAMTS19-AS1 expression can inhibit drug resistance-related cell cycle progression, thereby helping to enhance the sensitivity of cells to tamoxifen.

[0061] 4.3 Summary of Overall Results Combining the results of Example 3 and this example, it can be seen that ADAMTS19-AS1 is not only associated with enhanced drug tolerance in ER-positive breast cancer tamoxifen-resistant cells, but also with increased invasiveness and maintenance of cell cycle activity. After downregulating ADAMTS19-AS1 expression with small interfering RNA, enhanced tamoxifen sensitivity, decreased invasiveness, and cell cycle arrest can be observed simultaneously, indicating that ADAMTS19-AS1 can serve as a molecular target for tamoxifen sensitization intervention in ER-positive breast cancer.

[0062] Example 5: Prognostic Related Auxiliary Analysis Following Example 1, which identified ADAMTS19-AS1 as a target molecule associated with tamoxifen resistance through H3K27ac-related superenhancer screening and transcriptome analysis, Example 2 further illustrated the high expression of ADAMTS19-AS1 in drug-resistant cells and its interpretability in in vitro evaluation. Examples 3 and 4 demonstrated the functional correspondence between ADAMTS19-AS1 and drug resistance-related phenotypes in ER-positive breast cancer cells through small interfering RNA sensitization verification, changes in invasiveness, and cell cycle changes, respectively. This example further analyzes the application value of ADAMTS19-AS1 from the perspective of patient outcomes, illustrating the association between high ADAMTS19-AS1 expression and poor prognosis in patients undergoing endocrine therapy.

[0063] Based on data from breast cancer patients undergoing endocrine therapy, we conducted a grouping analysis of ADAMTS19-AS1 expression levels, dividing patients into a high-expression group and a low-expression group. We further compared the changes in survival probability during follow-up between the different expression groups. Figure 3 As shown in Figure D, the survival curves of patients in the ADAMTS19-AS1 high-expression group were generally lower than those in the low-expression group, indicating that patients in the high-expression group had a weaker ability to maintain a high survival probability during follow-up, suggesting that high ADAMTS19-AS1 expression is associated with poorer survival outcomes. The hazard ratio shown in the figure is 1.31, with a 95% confidence interval of 1.09 to 1.59, and the logrank test p-value is 0.0045, further demonstrating that the survival difference between the high-expression and low-expression groups is statistically significant.

[0064] Combining the results of ADAMTS19-AS1 high expression in MCF7 / TamR cells in Example 2, and the experimental results of ADAMTS19-AS1 overexpression promoting drug resistance, knockdown reducing drug resistance-related survival, inhibiting invasion, and inducing cell cycle arrest in Examples 3 and 4, it can be seen that ADAMTS19-AS1 high expression not only corresponds to tamoxifen resistance in ER-positive breast cancer cells, but also has a consistent association with adverse outcomes at the patient level. This indicates that ADAMTS19-AS1, in the technical context of this invention, can not only serve as a biomarker for tamoxifen resistance in breast cancer for in vitro assessment, but also has auxiliary supporting value as a sensitizing intervention target.

[0065] It should be noted that the prognostic correlation analysis shown in this embodiment is mainly used as auxiliary verification to supplement the explanation of the application value of ADAMTS19-AS1 from the perspective of patient outcomes. The results of this analysis are consistent with the results of ADAMTS19-AS1 being highly expressed in drug-resistant cells, promoting the maintenance of drug resistance-related survival, and participating in invasion and cell cycle regulation in the previous embodiment, illustrating the technical significance of ADAMTS19-AS1 in the assessment and sensitization of tamoxifen resistance in ER-positive breast cancer.

[0066] The objectives of this invention have been fully and effectively achieved through the above embodiments. Those skilled in the art will understand that this invention includes, but is not limited to, the contents described in the accompanying drawings and the specific embodiments described above. Although the invention has been described with reference to what is currently considered the most practical and preferred embodiments, it should be understood that the invention is not limited to the disclosed embodiments, and any modifications that do not depart from the functional and structural principles of the invention will be included within the scope of the claims.

Claims

1. The application of ADAMTS19-AS1 as a tamoxifen resistance marker in breast cancer in the preparation of a product for in vitro assessment of tamoxifen resistance in ER-positive breast cancer samples, wherein the in vitro assessment is based on the expression level of ADAMTS19-AS1 in ER-positive breast cancer samples.

2. The application as described in claim 1, characterized in that, The in vitro assessment includes comparing the expression level of ADAMTS19-AS1 in the ER-positive breast cancer sample to be tested with the expression level of ADAMTS19-AS1 in the ER-positive breast cancer tamoxifen-sensitive control sample, wherein an elevated expression level of ADAMTS19-AS1 in the sample to be tested indicates enhanced resistance to tamoxifen in the sample to be tested.

3. The application as described in claim 1, characterized in that, The expression level of ADAMTS19-AS1 was measured as mRNA expression, and the mRNA expression level was obtained by quantitative real-time PCR.

4. The application as described in any one of claims 1 to 3, characterized in that, The ER-positive breast cancer sample is an in vitro ER-positive breast cancer tissue sample, an in vitro ER-positive breast cancer cell sample, or an RNA sample derived from an in vitro sample or a cDNA sample obtained by reverse transcription thereof.

5. The application as described in any one of claims 1 to 3, characterized in that, The product contains a primer pair for detecting ADAMTS19-AS1 expression levels, the nucleotide sequence of which is as follows: Upstream primer: 5′-GACCCCTTAACCTGCACCTC-3′; Downstream primer: 5′-GCCTCGGAAACTCATCTGCT-3′.

6. A detection kit for in vitro assessment of tamoxifen resistance in ER-positive breast cancer samples, characterized in that, The detection kit comprises the primer pair as described in claim 5, a primer pair for detecting the internal control 18S, and reaction reagents for performing quantitative real-time PCR detection, wherein the nucleotide sequence of the 18S primer pair is as follows: Upstream primer: 5′-GTAACCCGTTGAACCCCATT-3′; Downstream primer: 5′-CCATCCAATCGGTAGTAGCG-3′.

7. Application of ADAMTS19-AS1 expression inhibition small interfering RNA in the preparation of products for enhancing the sensitivity of ER-positive breast cancer cells to tamoxifen, wherein the enhancement is to reduce the tamoxifen resistance-related survival of ER-positive breast cancer cells.

8. The application as described in claim 7, characterized in that, The small interfering RNA used to inhibit ADAMTS19-AS1 expression is selected from any of the following: si-1, whose positive chain sequence is 5′-GGAAAGGAAGCGAGAAAGUCATT-3′, and whose negative chain sequence is 5′-UGACUUUCUCGCUUCCUUUCCUU-3′; si-2 has a positive chain sequence of 5′-CAGGCAGAGGACUGCCCGGCUU-3′ and an antisense chain sequence of 5′-GCCGGGCAGUCCUCUGCCUGUU-3′.

9. A composition for enhancing the sensitivity of ER-positive breast cancer cells to tamoxifen, characterized in that, The composition comprises tamoxifen and a small interfering RNA for inhibiting ADAMTS19-AS1 expression, the small interfering RNA being used to downregulate the expression level of ADAMTS19-AS1.

10. The composition according to claim 9, characterized in that, The small interfering RNA is si-1 and / or si-2 as described in claim 8, and tamoxifen and the small interfering RNA are used in combination.

11. A method for in vitro assessment of tamoxifen resistance tendency in ER-positive breast cancer cell samples, characterized in that, At least the following steps are included: SS1. Sample Nucleic Acid Preparation: Total RNA was extracted from the isolated ER-positive breast cancer cell samples to be tested and reverse transcribed to obtain cDNA; SS2. Target molecule detection: The expression level of ADAMTS19-AS1 in cDNA was detected by real-time quantitative PCR and corrected by the internal reference gene 18S. SS3. Drug resistance tendency assessment: The expression level of ADAMTS19-AS1 in the test sample and the tamoxifen-sensitive control cell sample of ER positive breast cancer was compared. When the expression level of ADAMTS19-AS1 was increased, the test sample was determined to have a high tamoxifen resistance tendency.