Application of snora5al1 as a marker and therapeutic target for non-small cell lung cancer

Abstract

The present invention relates to small nucleolar RNAs (snoRNAs) useful as diagnostic and therapeutic targets for non-small cell lung cancer (NSCLC). In particular, the present invention discloses Snora5AL1 underexpressed in NSCLC cells, which underexpression is able to promote cancer cell proliferation. Snora5AL1 overexpression leads to NSCLC cell growth inhibition and significant size reduction of NSCLC patient-derived organoids, thus targeting Snora5AL1 represent a new strategy for the treatment of NSCLC.

Description

Technical Field

[0001] This invention relates to the field of biomedicine. More specifically, this invention relates to... Snora5AL1 Its application as a biomarker and therapeutic target for NSCLC. Background Technology

[0002] Lung cancer is the most commonly diagnosed malignant tumor worldwide and the leading single cause of cancer death. Approximately 85% of cases are classified as non-small cell lung cancer (NSCLC), an aggressive disease that causes the majority of lung cancer deaths globally. 1 Despite continuous advancements in treatment strategies, the 5-year survival rate for NSCLC remains only ~16%. 2 This is mainly because about two-thirds of patients already have distant metastases at the time of diagnosis. 1 These stark statistics underscore the urgent need to elucidate the molecular basis driving NSCLC progression, discover reliable early detection biomarkers, and develop innovative therapeutic targets.

[0003] Small nucleolar RNAs (snoRNAs) are a diverse class of non-coding RNAs, ranging in length from 60 to 300 nucleotides. They are characterized by evolutionarily conserved primary sequences and complex secondary structures. 3,4 A 2016 census combining specialized databases with de novo prediction pipelines estimated that the human genome contains approximately 600 distinct snoRNA loci. 5 Functionally, these transcripts are divided into three main families: small Cajal body-specific RNAs (scaRNAs), H / ACA box snoRNAs (SNORA), and C / D box snoRNAs (SNORD). 6 The definition of a SNORA member is the presence of an H box (with the shared sequence ANANNA) and a trinucleotide ACA motif, which together constitute the characteristic "hairpin-hinge-hairpin-tail" structure. 7 As a component of the non-coding RNA spectrum, snoRNAs are primarily located in the nucleolus, where they coordinate key post-transcriptional modifications of ribosomal RNAs, messenger RNAs, and specific non-coding RNAs. 8 Although their biogenesis and typical molecular functions have been rigorously characterized since their first discovery in the 1960s. 9 However, it wasn't until the last decade that these transcripts emerged as regulators in tumor biology.

[0004] Mounting evidence suggests that snoRNAs are aberrantly expressed in various malignant tumors and exert pleiotropic effects on tumor growth and spread. Depending on the cellular environment, individual snoRNAs can manifest as dominant oncogenes or true tumor suppressors. 10,11 . SNORD88C By guiding NSCLC 28S rRNA 2'-O-methylation modulates SCD1 translational activity. 12 In lung cancer, SNORA38B It has been shown to have potent carcinogenic activity in vitro and in vivo, at least in part through direct interaction with E2F1 and subsequent activation of the GAB2 / AKT / mTOR signaling axis. 13 Conversely, sister loci SNORD50A / B Suppressing malignant progression may be achieved by interfering with KRas activation. 14 Importantly, snoRNAs are highly stable in biological fluids, including plasma, serum, and urine, which allows for easy quantification using conventional nucleic acid-based detection methods. This stability supports their emergence as minimally invasive biomarkers for early cancer detection and disease monitoring. For example, snoRNAs... SNORD33 , SNORD66 and SNORD76 The composition of plasma characteristics has been validated for use in the non-invasive diagnosis of lung cancer. 15 . Summary of the Invention

[0005] The inventors identified a substance with presumed tumor-suppressive activity in NSCLC. Snora5AL1 Functional studies have shown that ectopic recovery Snora5AL1 It can reduce proliferation, migration and invasion in vitro, and inhibit the growth of primary tumors in vivo.

[0006] According to one aspect of the invention, a detection method is provided. Snora5AL1 The application of reagents for detecting the expression level in the preparation of diagnostic agents or kits for non-small cell lung cancer (NSCLC). Snora5AL1 Expression levels can be measured by detecting their DNA or RNA levels.

[0007] In one embodiment, the reagent is Snora5AL1 Specific probes, gene chips, or PCR primers.

[0008] In one implementation, the Snora5AL1 The nucleotide sequence is shown in SEQ ID No. 1 (GenBank:LN847697.1).

[0009] tgcagctgtgtcaaatttggtgcctgccctgcctgtgtaggcactgacccagaaggctgccacagaaacactgactcatgggccctgttcctgtgtctcgggctcagggataaatttggttacagatacca (SEQ ID No. 1) In one embodiment, the reagent detects cells from the (lung cancer) subject. Snora5AL1 The level of expression.

[0010] In one implementation, the cells are derived from the plasma, serum, or urine of a (lung cancer) subject.

[0011] In one implementation, relative to a control (healthy or normal sample). Snora5AL1 Low or no expression in a subject's sample (e.g., lung cell sample) indicates a (high) risk of the subject having NSCLC or that the subject has NSCLC.

[0012] In one embodiment, the subtypes of NSCLC may include lung adenocarcinoma, lung squamous cell carcinoma, large cell carcinoma, adenosquamous carcinoma, and sarcomatoid carcinoma. Preferably, the NSCLC may include lung adenocarcinoma, lung squamous cell carcinoma, and large cell carcinoma, with lung adenocarcinoma being the most preferred.

[0013] According to another aspect of the invention, enhanced or ectopic recovery is provided. Snora5AL1 The application of the expressed reagent in the preparation of drugs for the treatment of non-small cell lung cancer (NSCLC).

[0014] Enhanced or ectopic recovery Snora5AL1 The nature of the expressed reagent is not important to this invention, as long as it enhances... Snora5AL1 Simply express your opinion.

[0015] In one implementation, the enhancement or ectopic recovery Snora5AL1 The expression reagents include expression (preferably overexpression). Snora5AL1 The carrier.

[0016] In one embodiment, the vector is selected from: lentiviral vectors, transposon vectors, retroviral vectors, plasmids, adenovirus vectors, adeno-associated virus vectors, and the CRISPR / Cas9 system.

[0017] In one implementation, the Snora5AL1 The nucleotide sequence is shown in SEQ ID No. 1.

[0018] In one embodiment, the drug further comprises additional agents for treating NSCLC, including agents that enhance SCARNA20 expression. The agents enhancing SCARNA20 expression include vectors that express or overexpress SCARNA20. Similarly, vector types include lentiviral vectors, transposon vectors, retroviral vectors, plasmids, adenovirus vectors, adeno-associated virus vectors, and the CRISPR / Cas9 system. Expression or overexpression Snora5AL1 The vectors used for SCARNA20 can be the same or different types of vectors, and expression can occur on the same or different vectors. SCARNA20 is another small nucleolar RNA (snoRNA). Overexpression of SCARNA20 has been reported to significantly inhibit NSCLC cell proliferation, colony formation, migration, and invasion in vitro, and to inhibit tumor growth in vivo (see Yuanhao Li et al., "SCARNA20 influences the occurrence and development of lung cancer by inhibiting tumor cell proliferation, migration, and invasion"). J Thorac Dis 2026; 18(2):142 | https: / / dx.doi.org / 10.21037 / jtd-2025-2010).

[0019] In one embodiment, the subtypes of NSCLC may include lung adenocarcinoma, lung squamous cell carcinoma, large cell carcinoma, adenosquamous carcinoma, and sarcomatoid carcinoma. Preferably, the NSCLC may include lung adenocarcinoma, lung squamous cell carcinoma, and large cell carcinoma, with lung adenocarcinoma being the most preferred.

[0020] According to another aspect of the present invention, a method for screening drugs for treating non-small cell lung cancer (NSCLC) is provided, the method comprising the following steps: 1) Identify NSCLC cells Snora5AL1 The level of expression; 2) Contact the candidate compound with the cells from step 1); 3) Determine the cells after step 2). Snora5AL1 The level of expression; and 4) Compare the values ​​determined in steps 1) and 3). Snora5AL1 The level of expression, among which Snora5AL1 Increased expression levels indicate that the candidate compound has anticancer potential.

[0021] In one embodiment, the candidate compound may include extracts, proteins, oligopeptides, small organic or inorganic molecules, polysaccharides, polynucleotides, and molecules of various compounds.

[0022] In one embodiment, the subtypes of NSCLC may include lung adenocarcinoma, lung squamous cell carcinoma, large cell carcinoma, adenosquamous carcinoma, and sarcomatoid carcinoma. Preferably, the NSCLC may include lung adenocarcinoma, lung squamous cell carcinoma, and large cell carcinoma, with lung adenocarcinoma being the most preferred.

[0023] This invention discloses Snora5AL1 It is expressed at low levels in NSCLC cells, and this low expression can promote cancer cell proliferation. Snora5AL1 Overexpression leads to inhibition of NSCLC cell growth and a significant reduction in the size of organoids derived from NSCLC patients; therefore, targeting... Snora5AL1 This represents a new strategy for the treatment of NSCLC. Attached Figure Description

[0024] The above features and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the accompanying drawings, wherein: Figure 1 . Snora5AL1 Downregulated expression in clinical NSCLC samples. (A) Heatmap of snoRNA expression profiles from sequencing analysis. (B) qPCR validation of the top six downregulated snoRNAs in clinical NSCLC tissues (n=10). ***p<0.001. (C) Compared with the normal bronchial epithelial cell line BEAS-2B, snoRNA expression was downregulated in five NSCLC cell lines (A549, H1299, H1975, H1473, and PC9). Snora5AL1 Expression levels. ***p<0.001. (D) In ​​human NSCLC organoids and matched adjacent non-tumor organoids Snora5AL1 Representative fluorescence in situ hybridization (FISH) images. Scale bar = 50 μm. (E) Detection of A549 and H1299 cells by FISH. Snora5AL1 Subcellular localization. Scale bar = 25 μm. (F) Nucleocytoplasmic fractionation assay confirmed by qPCR analysis. Snora5AL1 Primarily located in the cell nucleus; Figure 2 . Snora5AL1 Inhibits cell progression in NSCLC. (A) Snora5AL1 Representative images and quantitative analysis of NSCLC organoids after knockdown or overexpression. Scale bar = 50 μm. (B, C) Snora5AL1 EdU staining of organoids after knockdown (B) and overexpression (C). Scale bar, 50 µm. (D) Measured by CCK-8 assay. Snora5AL1 Cell proliferation of A549 and H1299 cells overexpressed and knocked down. *p<0.05, **p<0.01, ***p<0.001. (E) Colony formation assay assessment Snora5AL1Colony-forming ability of NSCLC cells after overexpression. ***p<0.001. (F, G) Transwell migration (F) and invasion (G) assays. Snora5AL1 The metastatic ability of A549 and H1299 cells overexpressed and knocked down. ***p<0.001; Figure 3 . Snora5AL1 Inhibit cell progression in NSCLC. (A) and (B): Stable overexpression and knockdown were validated by qPCR. Snora5AL1 A549 and H1299 cells Snora5AL1 (C) Flow cytometry showed that... Snora5AL1 Overexpression induced apoptosis in A549 and H1299 cells, and (D) correspondingly increased Caspase-3 / 7 activity by 2.0-fold and 1.5-fold, respectively. Detailed Implementation

[0025] Unless otherwise stated, the terms used herein have their general technical meanings as understood by those skilled in the art. For definitions and terms in this field, those skilled in the art are particularly recommended to refer to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999).

[0026] In this invention, the singular articles “a” and “the” cover a plurality of indicators unless the context clearly indicates otherwise. All references cited herein are incorporated herein by reference in their entirety.

[0027] The use of "comprising" or "including" in this invention is an open-ended description that includes all specified components or steps described, as well as other specified components or steps that do not materially affect the description.

[0028] The term "and / or" as used in this invention encompasses all combinations of items connected by the term, and should be considered as if each combination had been individually listed herein. For example, "A and / or B" includes "A", "A and B", and "B". As another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C", and "A and B and C".

[0029] the term" Snora5AL1"" refers to the gene with GenBank accession number LN847697.1 and the RNA transcribed from that gene. Since it is a non-protein-coding gene, there is no protein product. In this invention, its sequence can be represented by SEQ ID No. 1. This invention also considers variations in the non-coding exons of the aforementioned gene that may exist; these variations are considered to belong to the corresponding transcript, i.e., unless otherwise stated, the term "" is used. Snora5AL1 "It covers different types of the same kind."

[0030] about Snora5AL1 The expression of refers to its expression at two levels: one is expression at the DNA level; the other is expression at the RNA level.

[0031] The term "expression" can include "overexpression," which refers to the inappropriate "switching off" or high-rate transcription of genes when the tight control of gene expression (transcription) is disrupted. High-rate transcription results in the production of large amounts of RNA. For the present invention… Snora5AL1 In the context of "expression" or "overexpression," it refers to a DNA or RNA expression level that is at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, or 300% higher than the control, or even higher than the control. Snora5AL1 The expression level was 4, 5, 6, 7, 8, 9, or 10 times or more.

[0032] The techniques and reagents used to detect gene expression levels are well known to those skilled in the art. In this invention, the reagent is preferably selected from… Snora5AL1 Specific probes (preferably nucleic acid probes with detection markers, usually complementary to the target gene), gene chips, or PCR primers for PCR-specific amplification reactions.

[0033] In this application, the term "vector" generally refers to a nucleic acid molecule capable of self-replication in a suitable host for transferring inserted nucleic acid molecules into host cells and / or between host cells. The vector may include vectors primarily for inserting DNA or RNA into cells, vectors primarily for replicating DNA or RNA, and expression vectors primarily for transcription and / or translation of DNA or RNA. The vector also includes vectors having multiple of the aforementioned functions. The vector may be a polynucleotide capable of being transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, by culturing suitable host cells containing the vector, the vector can produce the desired expression product.

[0034] In some cases, the vector may include a viral vector, such as an AAV, lentivirus, retrovirus, adenovirus, herpesvirus, and hepatitis virus vector. Methods for generating viral vectors that express the target gene are well known in the art and can be performed by those skilled in the art without extensive experimentation.

[0035] As used in this article, the term "CRISPR / Cas9 system" is a commonly used and highly efficient gene editing technology consisting of the Cas9 endonuclease and sgRNA (guide RNA). The sgRNA specifically recognizes the target gene sequence, guiding Cas9 to cut the DNA double strand, inducing non-homologous end joining (NHEJ) or homologous recombination (HDR) in the cell, thereby achieving gene knockout, insertion, or site-directed mutation.

[0036] The invention is further illustrated in the following examples. These examples are for illustrative purposes only and are not intended to limit the scope of the invention. All chemicals used in the following reactions are commercially available products unless otherwise specified.

[0037] Methods and Materials Clinical samples The clinical samples used in this invention were obtained from 100 patients with non-small cell lung cancer who underwent surgical resection and were pathologically confirmed between May 2022 and April 2025. These samples included, but were not limited to, freshly resected tumor tissue, adjacent normal lung tissue matching the tumor tissue, and formalin-fixed paraffin-embedded tissue, hematoxylin-eosin stained pathological sections, and corresponding clinicopathological data retained for testing and verification purposes. All cases were histologically diagnosed and verified by qualified pathologists, and the pathological classification followed the classification criteria for lung tumors in the 5th edition of the World Health Organization's *WHO Classification of Tumors: Thoracic Tumours*. The non-small cell lung cancer samples mainly included lung adenocarcinoma, squamous cell carcinoma, adenosquamous carcinoma, large cell carcinoma, and other rare non-small cell lung cancer pathological subtypes. This classification system is based on histomorphological diagnosis and is combined with immunohistochemistry and necessary molecular pathological test results for comprehensive judgment. It conforms to the principles described in the 2021 WHO Classification of Thoracic Tumors and related lung tumor classification literature (WHO Classification of Tumours Editorial Board. Thoracic Tumours. WHO Classification of Tumours, 5th Edition, Volume 5. IARC, 2021; Nicholson AG, etal. The 2021 WHO Classification of Lung Tumors: Impact of Advances Since 2015. Journal of Thoracic Oncology. 2022;17(3):362-387).

[0038] Real-time quantitative PCR Total RNA was extracted from tissue biopsies or cultured cells using TRIzol reagent (catalog number 15596026, Invitrogen) and reverse transcribed using the PrimeScript RT kit (catalog number K1070, RR037B, Takara). Triple qPCR was performed on a Roche LightCycler 480 using 2×SYBR Green Master Mix (catalog number K1070, APExBIO). Target abundance was normalized to 18SRNA and analyzed using 2... −ΔΔCt Quantification was performed using this method. Primer sequences are shown in Table 1 below.

[0039]

[0040] SnoRNA sequencing Small nucleolar RNA sequencing and subsequent data analysis were performed by Aksomics (Shanghai, China). RNA samples were quantitatively quality-controlled using a NanoDrop ND-1000 spectrophotometer, and RNA integrity was assessed using a Bioanalyzer 2100 or gel electrophoresis. For each sample, 100 ng of total RNA was first dephosphorylated to form 3'-OH ends. The 3'-OH-terminated RNA was then denatured with dimethyl sulfoxide and labeled with Cy3. The labeled RNA was hybridized to an Arraystar Human small RNA Microarray (8x15K, Arraystar) and scanned using an Agilent G2505C scanner.

[0041] The acquired array images were analyzed using Agilent Feature Extraction Software (version 11.0.1.1). Quantile normalization and subsequent data processing were performed using GeneSpringGX v12.1 software (Agilent Technologies). Multiple probes from the same small RNA (miRNA / TsRNA (tRF & tiRNA) / pre-miRNA / tRNA / small nucleolar RNA) were merged into a single RNA level. Differentially expressed small RNAs between the two comparison groups were identified by fold change (FC) and statistical significance (p-value) thresholds.

[0042] RNA fluorescence in situ hybridization (FISH) Fluorescent label Snora5AL1 U6 and 18S RNA-specific probes were purchased from Ribot Biotech (Guangzhou, China). The Ribot Fluorescence In Situ Hybridization Kit (product number C10910, Ribot Biotech) for FISH and dual FISH detection was used for FISH assays. Organoid or lung cancer cells were fixed with 4% paraformaldehyde for 30 minutes, followed by permeabilization with 1% Triton X-100 for 30 minutes. Hybridization was performed overnight at 37°C using FISH probes. Cell nuclei were counterstained with DAPI-containing anti-quenching mounting medium (product number P0131, Beyotime Biotech), and images were acquired using a Leica LCS-SP8-STED confocal microscope.

[0043] Nucleus-cytoplasm separation A549 cells were treated with a nuclear and cytoplasmic extraction kit purchased from CWBIO (Jiangsu, China, product number CW0199S) to obtain nuclear and cytoplasmic fractions. RNA was extracted from each fraction using TRIzol and qPCR was performed to quantify GAPDH (cytoplasmic control), U6 (nuclear control), and... Snora5AL1 Primer sequences are shown in Table 1.

[0044] Cell culture Human non-small cell lung cancer cell lines (A549, H1299, H1975, H1473, and PC9) and normal epithelial cell line (BEAS-2B) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The cell lines were cultured at 37°C in a humidified incubator with 5% CO2 in RPMI 1640 medium (Gibco, Long Island, New York, USA) supplemented with 10% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 μg / mL streptomycin (Biological Industries, Beit Haemek, Israel).

[0045] organoid culture Primary small cell lung cancer biopsy samples were collected using conical tubes in ice-cold primary tissue preservation solution (product number K601005, bioGenous). Tissue fragments were digested in 15 mL conical tubes at 37°C with 10 mL of tumor tissue digestion solution (product number K601003, bioGenous). Incubation time was variable, ranging from 5 to 30 min. The digestion process was carefully monitored, and the contents of the tube were mixed every 5–10 minutes by vigorous shaking or aspiration. The supernatant was aspirated, and the pellet was resuspended in cancer organoid basal medium (product number B213152, bioGenous) and centrifuged at 250 x g at 4°C for 3 min. The supernatant was aspirated again, and the pellet was resuspended in bioGenous organoid ECM (product number M315066). Cell-containing ECM was added dropwise (~30 μL) around the bottom of each well in a 24-well cell culture plate. Once the ECM droplets have solidified (15–25 minutes), carefully add 500 μL of organoid complete medium to each well. Place the culture plate in a humidity incubator and incubate at 37°C and 5% (v / v) CO2. Every 3–4 days, carefully aspirate the medium from the wells and replace it with fresh, preheated organoid complete medium to change the medium.

[0046] Oligonucleotide and plasmid transfection Infecting overexpressing HiTransGP with HiTransGP Snora5AL1 Lentiviral virus (GV235 vector, GeneChem) of (SEQ ID No. 1) and negative control lentivirus. Stable overexpression was screened using 2 μg / mL puromycin. Snora5AL1 Cells for 72 hours. Specific targeting. Snora5AL1The shRNAs (shRNA-Snora5AL1, 5'-CCTGACTTAATAGAGATGGTT-3') (SEQ ID No. 42) and negative controls (sh-NC, 5'-GGATACGGAGTACTATAGC-3') (SEQ ID No. 43), shRNA-Brd7 (5'-GCAGATGTTTACTGGATGTT-3') (SEQ ID No. 44) and their negative controls (5'-TTCTCCGAACGTGTCACGT-3') (SEQ ID No. 45) were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. The oligonucleotides were transfected into organoids or cells using Lipofectamine 3000 (Invitrogen, Carlsbad, California, USA).

[0047] EdU (5-ethynyl-2'-deoxyuridine) detection For the detection of 5-ethynyl-2'-deoxyuridine (EdU) incorporation, Snora5AL1 Overexpression ( Snora5AL1 oe) or knock down ( shSnora5AL1 A549 and H1975 cells were seeded on sterile coverslips in 24-well plates. After 12 hours, 50 μM EdU (EdU Apollo 488 Cell Proliferation Detection Kit, Product No. C10310-3, RiBoBio) was added and incubated for 2 hours. Cells were fixed with 4% paraformaldehyde (20 min), permeabilized with 0.5% Triton X-100 (10 min), and incubated in 1xApollo reaction mixture in the dark for 30 min. After washing three times each with 0.5% Triton X-100 and PBS, the cells were mounted with an anti-fluorescence quencher containing DAPI (Product No. P0131, Beyotime). EdU-positive cell nuclei were imaged under an Olympus fluorescence microscope; quantitative analysis was performed on ten random fields of view under each condition using Image-Pro Plus.

[0048] Cell viability assay For cell viability assays, a Cell Counting Kit-8 (CCK8, product number C0041, Beyotime, China) was used. Briefly, 1 x 10⁶ cells per well. 3 Cells were seeded in 96-well plates. At specified time intervals, 10% CCK-8 reagent was added and incubated for 3 h, and the absorbance at 450 nm was recorded on a SpectraMax iD5 microplate reader (Molecular Devices).

[0049] Colony formation detection For settlement formation analysis, 1x10 3 Cells were seeded in 12-well plates and cultured for 10-14 days. They were fixed with 4% paraformaldehyde and stained with 1% crystal violet (Biosharp). Colonies (>50 cells) were counted.

[0050] Apoptosis detection For flow cytometry, trypsin is used to collect knockdown or overexpression samples. Snora5AL1 A549 and H1975 cells were washed twice in ice-cold PBS and resuspended in 1×Annexin V binding buffer (Catalog No. 420201, Bio Legend). After adding 5 μL of FITC-Annexin V and 5 μL of propidium iodide (Catalog No. 556547, BD Biosciences), the cells were incubated in the dark at room temperature for 15 minutes and then immediately analyzed on a FACSorter flow cytometer (Applied Biosystems).

[0051] Caspase-3 / 7 activity assay Caspase-3 / 7 activity was quantified using the Caspase-Glo® 3 / 7 chemiluminescence assay kit (catalog number G8093, Promega). Knockdown or overexpression was performed. Snora5AL1 A549 and H1975 cells were seeded in 96-well plates and cultured for 24 h (37°C, 5% CO2). After equilibration to room temperature, 100 µL of Caspase-Glo 3 / 7 reagent was added to each well; the plates were gently mixed and incubated in the dark for 1 h. Emission values ​​were recorded on a Synergy multimode microplate reader (BioTek). Values ​​were normalized to the untreated control and reported as fold changes relative to their respective control groups.

[0052] Cell invasion and migration detection For cell invasion experiments, 1 × 10 5 A549 cells were seeded in 200 µL of serum-free medium into 8 µm Transwell chambers (BD Biosciences) lined with Matrigel, placed in 24-well plates; 600 µL of medium with 10% fetal bovine serum was used as a chemotactic agent. After 24 hours, uninvaded cells were wiped off, the membrane was fixed (4% paraformaldehyde), stained with 1% crystal violet, and invaded cells were counted under an inverted microscope (×100). The migration assay was performed using the same method, except that Matrigel was not used. Each experiment was repeated three times.

[0053] Western blot for protein immunoblotting Cells were lysed and proteins were quantified using a BCA kit (Thermo Fisher). 20 μg aliquots were separated on 10% SDS-PAGE, transferred to PVDF, and blocked with 5% skim milk for 1 hour. The membrane was incubated overnight at 4°C with primary antibodies against Brd7 (catalog number 20874-1-AP, Proteintech), anti-AMIGO2 (catalog number 22018, Proteintech), or anti-GAPDH (catalog number AP0063, Proteintech), and then incubated at room temperature for 1 hour with IRDye 800CW anti-rabbit IgG (catalog number 926-32211, Odyssey). Signals were captured on a LI-COR Odyssey infrared scanner.

[0054] RNA sequencing RNA sequencing was performed on three independent A549 cultures overexpressing Brd7 and three vector controls. Total RNA was extracted using the RNeasyMini kit (Qiagen). Strand-specific, paired-end libraries were prepared using the TruSeq RNA Sample Prep kit (Illumina): mRNA was fragmented (94 °C, 8 min), reverse transcribed into first-strand cDNA, converted to double-stranded cDNA, end-repaired, A-tailed, ligated with index adapters, and amplified by PCR. The size and concentration of the library inserts were examined using an Agilent 2100 bioanalyzer and a Qubit 2.0 fluorometer. Samples were diluted to 10 pM, clustered on cBot, and sequenced (2 × 150 bp) by Aksomics (Shanghai, China) on an Illumina NovaSeq 6000.

[0055] Pseudouridine-RIP sequencing The Ψ-RIP Seq service was provided by CloudSeq (Shanghai, China). Total RNA was immunoprecipitated using the GenSeq® Ψ-RIP Kit (GenSeq) according to the manufacturer's instructions. Briefly, RNA was randomly fragmented into approximately 200 nt fragments using an RNA fragmentation reagent. Protein A / G magnetic beads were conjugated to Ψ antibodies and rotated at room temperature for 1 h. The RNA fragments were incubated with the bead-conjugated antibody and rotated at 4°C for 4 h. After incubation, the RNA / antibody complex was washed several times, and the captured RNA was eluted from the complex and purified. RNA libraries containing the IP and input samples were then constructed using the GenSeq® Low Input Whole RNA Library Preparation Kit (GenSeq) according to the manufacturer's instructions. The libraries were quality-assessed using an Agilent 2100 Bioanalyzer (Agilent) and then sequenced.

[0056] Chromatin Immunoprecipitation (ChIP)-PCR Chromatin from Brd7 knockdown or control A549 cells was cross-linked with 1% formaldehyde, sheared into 100-500 bp fragments by sonication, and pre-cleaned. Immunoprecipitation was performed overnight at 4°C with anti-H3K27Ac antibody (CST, catalog number C3742) or control rabbit IgG (CST, catalog number 2729S), followed by incubation with Protein A / G magnetic beads for 2 hours. Cross-linking was reversed overnight at 65°C with 5 M NaCl, and DNA was purified using an Omega gel extraction kit (Omega, catalog number D2500). The occupancy of Brd7 at the AMIGO2 promoter was quantified by qPCR.

[0057] CMC treatment with [N-cyclohexyl-N'-(2-morpholinoethyl)carbodiimide] use shSnora5AL1 , Snora5AL1 oh or △ Snora5AL1 Total RNA was extracted from transfected A549 cells after 48 hours of culture. 5 µg of total RNA (maximum volume 12 µL) was treated with CMC in 40 µL of TEU buffer at 30 °C for 16 h / 18 h. A negative control without CMC was used in the reaction. Briefly, the reaction consisted of 12 µL RNA (maximum volume) + 24 µL TEU buffer + / − 4 µL CMC buffer in 0.7× TEU buffer. After CMC treatment, RNA was purified by phenol / chloroform to remove excess CMC. To reverse the reaction, RNA was incubated in 40 µL of reverse reaction buffer at 37 °C for 6 h. The RNA was then resuspended in 6.5 µL H2O after purification again using phenol / chloroform.

[0058] Northern Imprinting From use Snora5AL1Total RNA (3 μg) isolated from A549 cells transfected with the control vector was mixed with 2×RNA loading dye (NEB #B0363S), heated at 95°C for 5 min, and separated on a 15% urea-polyacrylamide gel containing 1×TBE buffer (Cat# B540024-0001, Invitrogen). After electrophoresis, the RNA was visualized with SYBR Gold staining agent (Invitrogen) and transferred to a positively charged nylon membrane (Cat# 11417240001, Roche). The RNA was cross-linked to the membrane by UV irradiation and then hybridized overnight at 42°C with DIG-labeled oligonucleotide probes targeting Brd7 or 18S rRNA (Shanghai Sangon Biotech Co., Ltd.). After rigorous washing, the membrane was incubated with an anti-DIG-AP Fab fragment (Roche #11093274910), and the chemiluminescent signal was captured using a Bio-Rad imaging system.

[0059] RNA stability assay A549 or H1299 cells were treated with 5 µg / ml actinomycin D (Beijing Biosharp) for 0, 15, 30, 60, and 120 minutes. Simultaneously, 2 μg of total RNA was incubated with 8 U RNase R (Sigma-Aldrich, St. Louis, Missouri) at 37 °C for 30 min to eliminate linear RNA. Residual RNA levels were quantified by qPCR and normalized to the 0-minute time point.

[0060] Dual-luciferase assay The 3' UTR sequence (wild-type) and mutant versions of Brd7 were cloned downstream of the firefly luciferase gene in the pmirGLO vector (Promega). A549 and H1299 cells were then coupled with each reporter plasmid and... Snora5AL1 Plasmid co-transfection was performed. The Renilla luciferase plasmid was used as an internal control. After 48 hours, luciferase activity was quantified using a dual-luciferase reader; the firefly luciferase value was normalized to the Renilla luciferase value and expressed as relative luciferase activity.

[0061] Statistical analysis Statistical analysis was performed using SPSS 21.0 (IBM, Armonk, NY). Differences between groups were assessed using one-way ANOVA, two-tailed Student's t-test, or Mann-Whitney U test, as appropriate. A two-tailed p-value ≤ 0.05 was considered statistically significant.

[0062] Example 1: Snora5AL1 Downgrade in NSCLC To identify small nucleolar RNAs (snoRNAs) involved in the progression of non-small cell lung cancer (NSCLC), we performed a transcriptome analysis of tumor-normal tissues using high-throughput SnoRNA sequencing. Patients with ≥2-fold changes were screened. p Nine cancer-associated snoRNAs were identified from transcripts <0.05, with three upregulated and six downregulated in NSCLC tumors compared to matched normal tissues. Among them, the one located at chr3:123814077-123814207... Snora5AL1 Significantly lower in tumor samples compared to normal controls ( Figure 1 A). Validated by qPCR in an independent cohort (n = 10 pairs), confirming Snora5AL1 Significantly downregulated in lung cancer tissues ( Figure 1 Consistent with this, compared to the immortalized bronchial epithelial cell line BEAS-2B (n = 3), Snora5AL1 Expression was significantly reduced in several NSCLC cell lines (PC9, A549, H1473, and H1299). Figure 1 (C). Fluorescence in situ hybridization (FISH) of patient-derived organoids further supports these findings, showing that cancer organoids... Snora5AL1 The signal was weaker than that in adjacent non-tumor tissues. Figure 1 (D). Because snoRNAs are typically located in the nucleolus to promote rRNA maturation and modification. 6 We evaluated Snora5AL1 Subcellular distribution. FISH analysis confirmed that it was mainly located in the nucleus (>85%) in A549 and H1299 cells. Figure 1 Subcellular grading analysis further validated these observations, and we observed... Snora5AL1 Mainly located in the cell nucleus ( Figure 1 In summary, these results indicate that... Snora5AL1 is A nuclear-enriched snoRNA whose expression is specifically lost in human NSCLC.

[0063] Example 2: Snora5AL1 Inhibiting cell progression in NSCLC In order to study Snora5AL1 Functional role in NSCLC: We generated organoids from NSCLC cancer patients. Snora5AL1 Knock down ( shSnora5AL1 ) and overexpression ( Snora5AL1 oe). We observed Snora5AL1 Overexpression significantly reduced the size of organoids, while lentivirus-mediated... Snora5AL1 Knockdown enhanced organoid formation. Figure 2EdU analysis supports these observations, showing Snora5AL1 DNA synthesis increases after deletion, but significantly decreases after overexpression. Figure 2 (B and C). We generated stable overexpression and knockdown. Snora5AL1 The expression of A549 and H1299 cells was verified by qPCR. Figure 3 Functional analysis using CCK-8 analysis shows that, Snora5AL1 oe inhibits cell proliferation ( Figure 2 (D), and reduces clone formation survival rate by more than 60% ( Figure 2 Flow cytometry showed that, Snora5AL1 Overexpression induces apoptosis in A549 and H1299 cells ( Figure 3 (C), consistent with increases in Caspase-3 / 7 activity of 2.0-fold and 1.5-fold, respectively. Figure 3 (D). Transwell analysis shows that, Snora5AL1 Overexpression significantly inhibited the migration and invasion of both cell lines, while Snora5AL1 Knockdown increased the migration and invasion of A549 and H1299 cells. Figure 2 (F and G). In summary, these studies on functional gain and loss indicate that... Snora5AL1 It plays a tumor-suppressive role in NSCLC.

[0064] Those skilled in the art should understand that although the present invention has been specifically described with reference to the above embodiments, the present invention is not limited to these specific embodiments. Based on the methods and technical solutions taught in this invention, those skilled in the art can make appropriate modifications or improvements without departing from the spirit of the present invention, and the equivalent embodiments obtained therefrom are all within the scope of the present invention.

[0065] References 1 Bray, F. et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CACancer J Clin 68, 394-424 (2018). https: / / doi.org / 10.3322 / caac.21492 2 Herbst, R. S., Morgensztern, D.&Boshoff, C. The biology andmanagement of non-small cell lung cancer. Nature 553, 446-454 (2018).https: / / doi.org / 10.1038 / nature25183 3 Liu, B. et al. snoRNA-facilitated protein secretion revealed bytranscriptome-wide snoRNA target identification. Cell 188, 465-483 e422(2025). https: / / doi.org / 10.1016 / j.cell.2024.10.046 4 McCann, K. L., Kavari, S. L., Burkholder, A. B., Phillips, B. T.&Hall, T. M. T. H / ACA snoRNA levels are regulated during stem celldifferentiation. Nucleic Acids Res 48, 8686-8703 (2020). https: / / doi.org / 10.1093 / nar / gkaa612 5 Jorjani, H. et al. An updated human snoRNAome. Nucleic Acids Res44, 5068-5082 (2016). https: / / doi.org / 10.1093 / nar / gkw386 6 Mourksi, N. E., Morin, C., Fenouil, T., Diaz, J. J.&Marcel, V.snoRNAs Offer Novel Insight and Promising Perspectives for Lung CancerUnderstanding and Management. Cells 9 (2020). https: / / doi.org / 10.3390 / cells9030541 7 Balakin, A. G., Smith, L.&Fournier, M. J. The RNA world of thenucleolus: two major families of small RNAs defined by different box elementswith related functions. Cell 86, 823-834 (1996). https: / / doi.org / 10.1016 / s0092-8674(00)80156-7 8 Lafontaine, D. L. Noncoding RNAs in eukaryotic ribosome biogenesisand function. Nat Struct Mol Biol 22, 11-19 (2015). https: / / doi.org / 10.1038 / nsmb.2939 9 Stern, H., Johnston, F. B.&Setterfield, G. Some chemical propertiesof isolated pea nucleoli. J Biophys Biochem Cytol 6, 57-60 (1959). https: / / doi.org / 10.1083 / jcb.6.1.57 10 Kufel, J.&Grzechnik, P. Small Nucleolar RNAs Tell a DifferentTale. Trends Genet 35, 104-117 (2019). https: / / doi.org / 10.1016 / j.tig.2018.11.005 11 Cui, L. et al. Small Nucleolar Noncoding RNA SNORA23, Up-Regulatedin Human Pancreatic Ductal Adenocarcinoma, Regulates Expression of SpectrinRepeat-Containing Nuclear Envelope 2 to Promote Growth and Metastasis ofXenograft Tumors in Mice. Gastroenterology 153, 292-306 e292 (2017). https: / / doi.org / 10.1053 / j.gastro.2017.03.050 12 Wang, K. et al. SNORD88C guided 2'-O-methylation of 28S rRNAregulates SCD1 translation to inhibit autophagy and promote growth andmetastasis in non-small cell lung cancer. Cell Death Differ 30, 341-355(2023). https: / / doi.org / 10.1038 / s41418-022-01087-9 13 Zhuo, Y. et al. Targeting SNORA38B attenuates tumorigenesis andsensitizes immune checkpoint blockade in non-small cell lung cancer byremodeling the tumor microenvironment via regulation of GAB2 / AKT / mTORsignaling pathway. J Immunother Cancer 10 (2022). https: / / doi.org / 10.1136 / jitc-2021-004113 14 Siprashvili, Z. et al. The noncoding RNAs SNORD50A and SNORD50Bbind K-Ras and are recurrently deleted in human cancer. Nat Genet 48, 53-58(2016). https: / / doi.org / 10.1038 / ng.3452 15 Liao, J. et al. Small nucleolar RNA signatures as biomarkers fornon-small-cell lung cancer. Mol Cancer 9, 198 (2010). https: / / doi.org / 10.1186 / 1476-4598-9-198。

Claims

1. Detection Snora5AL1 The application of reagents expressing a certain level in the preparation of diagnostic agents or diagnostic kits for non-small cell lung cancer, characterized by... The Snora5AL1 The nucleotide sequence is shown in SEQ ID No.

1.

2. The application according to claim 1, wherein the reagent is Snora5AL1 Specific probes or PCR primers.

3. The application according to claim 1 or 2, wherein the reagent detects [the substance] from the subject's cells. Snora5AL1 The level of expression.

4. Overexpression Snora5AL1 The application of the reagent in the preparation of drugs for treating non-small cell lung cancer, characterized in that... The Snora5AL1 The nucleotide sequence is shown in SEQ ID No.

1.

5. The application according to claim 4, wherein the overexpression Snora5AL1 The reagents include expression Snora5AL1 The carrier.

6. The application according to claim 5, wherein the vector is a lentiviral vector, an adenovirus vector, or an adeno-associated virus vector.

Images