A detection composition, kit and use

Abstract

The application belongs to the field of molecular biology detection, and particularly belongs to the field of cervical cancer detection. The application provides a detection composition comprising detection reagents for detecting the methylation level of the following gene regions: a region as shown in SEQ ID NO:1 in the ASCL1 gene; a region as shown in SEQ ID NO:2 in the LHX8 gene; and a region as shown in SEQ ID NO:3 in the SOX1 gene. The detection effect of the detection composition of the application on CIN2+ of a urine sample is AUC 0.8387, sensitivity 0.7500, and specificity 0.8700.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology detection, specifically to the field of cervical cancer detection, and more specifically, to the detection of methylation levels of cervical cancer gene markers. Background Technology

[0002] The level of DNA methylation in exfoliated cervical cells is related to the severity of cervical lesions. As cervical intraepithelial neoplasia (CIN) progresses from CIN1 to CIN2, CIN3, and invasive cervical cancer, the degree of DNA methylation gradually increases, a process that can take 5 to 10 years. Since epigenetic variations are reversible, DNA methylation gene testing is expected to become a tool for early screening, triage, follow-up, diagnosis, treatment, and prognostic assessment of cervical cancer in clinical practice.

[0003] There is an urgent need in this field for a non-invasive, rapid, and more accurate cervical cancer screening product to provide technical support for improving the effectiveness of cervical cancer screening. Summary of the Invention

[0004] This application is made in view of the above-mentioned issues, and its purpose is to provide a composition for detecting cervical cancer and high-grade cervical lesions, which can detect patients who are truly at risk of cervical cancer in the early stages of the cancer process with high sensitivity and high specificity.

[0005] To achieve the above objectives, in a first aspect, this application provides a detection composition comprising a detection reagent for detecting methylation levels in the following gene regions: The region in the ASCL1 gene as shown in SEQ ID NO:1; The region of the LHX8 gene as shown in SEQ ID NO:2; and The region in the SOX1 gene as shown in SEQ ID NO:3.

[0006] Using the composition of the present invention, “ASCL1+LHX8+SOX1”, in a clinical sample, the detection effect on urine samples with cervical intraepithelial neoplasia grade 2 and above (CIN2+) was 0.8387, with a sensitivity of 0.7500 and a specificity of 0.8700.

[0007] In some specific implementations, the detection reagent is the same as that used in amplification-sequencing, chip detection, or quantitative PCR for detecting methylation levels.

[0008] In some specific implementations, the detection reagent is any one or more of nucleic acid primers, sequencing tag sequences, methylation chips, and nucleic acid probes.

[0009] In some specific implementations, the nucleic acid primers and nucleic acid probes are: Any one or more sets of nucleic acid primers and probes shown in SEQ ID NO:5~25.

[0010] In some specific implementations, the nucleic acid primers and nucleic acid probes are: Nucleic acid primers and probes shown in SEQ ID NO:5~13.

[0011] In some specific embodiments, the composition further includes an internal standard upstream primer, an internal standard downstream primer, and an internal standard probe for detection.

[0012] In some specific embodiments, the composition further includes a sample release agent for extracting sample nucleic acids, a purifying agent for purifying sample nucleic acids, and one or more of the bisulfite or bisulfite used for conversion.

[0013] Secondly, the present invention provides the use of the detection composition as described above in the preparation of a kit for detecting cervical cancer and high-grade cervical lesions.

[0014] Thirdly, the present invention provides a kit for detecting cervical cancer and high-grade cervical lesions, the kit comprising the detection composition as described above.

[0015] In some specific implementations, the kit also includes dNTPs and Mg. 2+ K + At least one of the following: ammonium ions, ethylenediaminetetraacetic acid, polymerase, PCR buffer, and hot-start enzyme. Attached Figure Description

[0016] Figure 1 Typical PCR amplification curves for urinary DNA methylation in cervical cancer samples (yellow - LHX8, red - ASCL1, blue - SOX1, green - ACTB).

[0017] Figure 2 This is the ROC curve for the training set samples.

[0018] Figure 3 The ROC curves for the validation set samples. Detailed Implementation

[0019] The present invention will be described in detail below with reference to specific implementation schemes and embodiments, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific implementation schemes and embodiments are for illustrative purposes only and are not intended to limit the present invention.

[0020] The "range" disclosed in this application is defined by a lower limit and an upper limit. A given range is defined by selecting a lower limit and an upper limit, which define the boundaries of a particular range. Ranges defined in this way can include or exclude endpoints and can be arbitrarily combined; that is, any lower limit can be combined with any upper limit to form a range. For example, if ranges of 60-120 and 80-110 are listed for a specific parameter, it is expected that ranges of 60-110 and 80-120 are also included. Furthermore, if minimum range values ​​of 1 and 2 are listed, and if maximum range values ​​of 3, 4, and 5 are listed, then the following ranges are all expected: 1-3, 1-4, 1-5, 2-3, 2-4, and 2-5. In this application, unless otherwise stated, the numerical range "ab" represents a shortened representation of any combination of real numbers between a and b, where a and b are real numbers. For example, the numerical range "0-5" indicates that all real numbers between "0-5" have been listed in this article; "0-5" is simply a shortened representation of these numerical combinations. Furthermore, when a parameter is stated as an integer ≥2, it is equivalent to disclosing that the parameter is, for example, an integer such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.

[0021] Unless otherwise specified, all embodiments and optional embodiments of this application may be combined to form new technical solutions.

[0022] Unless otherwise specified, all technical features and optional technical features of this application may be combined to form new technical solutions.

[0023] Unless otherwise specified, all steps in this application may be performed sequentially or randomly, preferably sequentially. For example, the method includes steps (a) and (b), indicating that the method may include steps (a) and (b) performed sequentially, or it may include steps (b) and (a) performed sequentially. For example, the method may also include step (c), indicating that step (c) may be added to the method in any order. For example, the method may include steps (a), (b), and (c), or it may include steps (a), (c), and (b), or it may include steps (c), (a), and (b), etc.

[0024] Unless otherwise specified, the terms used in this application have the common meanings as commonly understood by those skilled in the art.

[0025] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. When used herein, the singular forms “a,” “an,” and “the” are also intended to include the plural forms unless the context clearly indicates otherwise. It should also be understood that the terms “comprise” and / or “comprising,” when used in this specification, identify the presence of the stated features, integers, steps, operations, elements, and / or components, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups. When used herein, the term “and / or” includes any and all combinations of the associated listed items.

[0026] In view of this, the present invention provides a detection composition comprising a detection reagent for detecting methylation levels in the following regions: The region in the ASCL1 gene as shown in SEQ ID NO:1; The region of the LHX8 gene as shown in SEQ ID NO:2; and The region in SOX1 as shown in SEQ ID NO:3.

[0027] The regions shown in SEQ ID NO:1 of the ASCL1 gene, the regions shown in SEQ ID NO:2 of the LHX8 gene, and the regions shown in SEQ ID NO:3 of the SOX1 gene are segments of the CpG islands of their respective gene promoter regions.

[0028] Specifically, the SEQ ID NO:1 region of the ASCL1 (Genbank accession number: NG_008690.2) gene is shown below: TGAGACCGGCGGCCGACGGCCAGCCCTCAGGGGGGCGGTCACAAGTCAGCGCCCAAGCAAGTCAAGCGACAGCGCTCGTCTTCGCCCGAACTGATGCGCTGC.

[0029] The SEQ ID NO:2 region of the LHX8 (Genbank accession number: NM_001256114.2) gene is shown below: CGCCCGGGCTCAGGCCGCCGTGACGGCTGCACGCGCTGCCCCGCACTCTGAGGCCTTCATTAGCTCGCTCCCCGCGCCGAGGC.

[0030] The region in the SOX1 gene, as shown in SEQ ID NO:3, is as follows: CGCCTCCGCTCCGAGCGCACGGCCCCGGGCAGGCAGCGGGCAGCCCATCCCGGGCTCGGCGGCCCCGGCTCTCCGGCCCTCTCCGCGAGCCCG.

[0031] Using the composition "ASCL1+LHX8+SOX1" of this invention, triage was performed on 271 clinical samples from HPV-positive individuals (48 CIN2+ positive samples and 223 negative samples). The detection AUC for cervical intraepithelial neoplasia grade 2 and above (CIN2+) was 0.8387, the sensitivity was 0.7500, and the specificity was 0.8700. This composition enables the clinical detection of cervical exfoliated cells with fewer biomarkers, saving both cost and time, and can detect patients at true risk of cervical cancer in the early stages of the cancerous process with high sensitivity and specificity.

[0032] In this invention, "CpG island" is an abbreviation for cytosine (C)-phosphate (p)-guanine (G), which refers to some regions on the genome rich in CpG dinucleotides, with a length of 300~3000 bp.

[0033] In this invention, the term "CIN2+" includes cervical cancer, CIN3, and CIN2; the term "CIN3+" includes cervical cancer and CIN3.

[0034] In some embodiments, the detection reagent of the present invention can be used to detect the methylation level of CpG islands or a sequence segment on a CpG island in a sample. Specifically, in some instances, the average methylation level of CpG islands or a sequence segment on a CpG island in a sample can be detected.

[0035] In this invention, a "sample" is a biological sample selected from an individual. Specifically, for example, it is selected from histological sections, tissue biopsies / paraffin-embedded tissues, etc., with cervical exfoliated cell samples being preferred.

[0036] In this invention, "detection reagent" refers to a reagent used to detect the methylation level of genes in a sample. The methylation level is measured using amplification-sequencing, microarray detection, or quantitative methylation PCR.

[0037] In some specific implementations, the methylation level detection reagent may also be a reagent for detecting the average methylation level of a gene fragment.

[0038] In some specific implementations, the methylation level detection reagent may also be a detection reagent that detects one or more methylation sites within a gene segment.

[0039] Furthermore, the methylation level detection reagent may also be a detection reagent that detects the average methylation level of one or more methylation sites within a gene segment.

[0040] In some specific implementations, the detection reagents include, but are not limited to, nucleic acid primers and sequencing tag sequences, used to measure methylation levels by amplification-sequencing.

[0041] In some specific implementations, the detection reagents include, but are not limited to, chips, specifically methylation chips having probes that specifically bind to methylation regions. The chips are used to measure methylation levels.

[0042] In some specific implementations, the detection reagents include, but are not limited to, nucleic acid primers and nucleic acid probes, for measuring methylation levels via quantitative methylation PCR.

[0043] Furthermore, the detection reagent also includes internal standard primers and internal standard probes.

[0044] In one specific implementation, the internal standard primer and probe target the ACTB gene.

[0045] In a preferred embodiment, the internal standard primer and probe target the region of the ACTB gene as shown in SEQ ID NO:4.

[0046] The SEQ ID NO:4 region of the ACTB gene (Genebank accession number: NC_007992.1) is shown below: CCTACGGAAAACGGCAGAAGAGAGAACCAGTGAGAAAGGGCGCAGCTCCGGGAGGCCAGGAAGGAGGGAGGCGGCCACCA.

[0047] When the detection reagent includes nucleic acid primers and nucleic acid probes, the detection reagent detects the methylation level of nucleic acids in the sample by methylation fluorescence quantitative PCR.

[0048] In this invention, "methylation quantitative PCR" refers to the process of converting the region to be detected by sulfite conversion or digesting it with a methylation-sensitive restriction endonuclease, and then using primers and probes specifically designed for the detection target to perform quantitative PCR detection, thereby obtaining the methylation level of the region to be detected.

[0049] The above composition may also include other reagents, specifically, for example, various reagents required for sample pretreatment or conditioning. Examples include sample release agents for extracting nucleic acids from samples, purifying agents for purifying nucleic acids from samples, and bisulfites or sulfites used for conversion.

[0050] In some specific implementations, the detection reagents are shown in Tables 1 and 2. In the following detection reagents, the upstream primers / downstream primers / probes for detecting one target correspond to a set. The upstream primers / downstream primers / probes for detecting the targets to be detected are used, i.e., this set. Therefore, the detection reagents of the present invention may include any one or more sets of primers and probes from Tables 1 and 2 below.

[0051] Table 1

[0052] Table 2

[0053] "+" indicates locked nucleic acid modification of the corresponding base.

[0054] In some specific implementations, the four fluorescence channels used in this invention are FAM, ROX, VIC and CY5 channels, but in actual use they are not limited to these and can be any combination of other fluorescence channels; at the same time, different targets can also correspond to different fluorescence channels, such as any fluorescence channel can be used as an internal standard detection channel.

[0055] Secondly, the present invention provides a kit for detecting cervical cancer and high-grade cervical lesions (CIN2 and CIN3), the kit comprising the composition described above.

[0056] Furthermore, the kit also includes reagents for amplifying nucleic acids.

[0057] Furthermore, the kit also includes a negative sample.

[0058] Furthermore, the kit shown also includes positive samples.

[0059] Specifically, negative samples are methylation target regions of negative cellular DNA.

[0060] Specifically, positive samples are cellular DNA that is positive for methylation target regions.

[0061] Furthermore, the kit also includes dNTPs and Mg. 2+ K + At least one of the following: ammonium ions, ethylenediaminetetraacetic acid, polymerase, PCR buffer, and hot-start enzyme.

[0062] Furthermore, the methylation-sensitive restriction endonuclease includes at least one of Hpa II, HinP 1I, Hha I, Aci I, AccIl, and Aor51HI.

[0063] Furthermore, the methylation-sensitive restriction endonucleases include Aci I and Hha I.

[0064] Furthermore, the final concentration ranges of each component are shown below: Mg 2+ 1~6mM, dNTPs 1~80 mM, methylation-sensitive restriction endonuclease 0.01~30U, primers 0.1~40µM, probes 0.1~20µM.

[0065] Example The following describes embodiments of this application. The embodiments described below are exemplary and are only used to explain this application, and should not be construed as limiting this application. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all conventional products that can be obtained commercially.

[0066] Example 1: Screening of methylation genes This invention collects and mines cervical cancer methylation data based on public data source platforms such as TCGA, NCBI, PubMed, and EBI ArrayExpress. It employs various bioinformatics methods to analyze the differential methylation levels of normal cervix or cervical inflammation, cervical intraepithelial neoplasia grade 1 (CIN1), cervical intraepithelial neoplasia grade 2 (CIN2), cervical intraepithelial neoplasia grade 3 (CIN3), and cervical cancer samples, initially screening out relatively specific methylation markers. Further, methylation levels in real clinical samples are detected and analyzed using ddPCR and quantitative real-time PCR for verification. Specifically, it is divided into three stages. First, this study used methylation data of cervical cancer from The Cancer Genome Atlas (TCGA) and gene expression data from EBI ArrayExpress for bioinformatics analysis and mining. Initial screening was performed with a methylation Beta Value > 0.5 in 90% of cervical cancer tissues and a Beta Value < 0.2 in normal tissues. Then, sites showing significant differences between cervical cancer and normal tissues were selected to identify CpG sites with significantly different methylation levels. Combined with literature review and comparison, target regions for methylation markers with significant differences were screened. Finally, six significantly different methylation target gene regions were selected: PAX1, SOX1, ZNF671, JAM3, EPB41L3, and TRH. Furthermore, based on reports of cervical cancer methylation genes in the NCBI and PubMed databases, this study screened 18 specific target genes, including ASCL1, LHX8, PAX1, SOX1, TWIST1, MAL, PCH10, WT1, CADM1, DAPK1, NKX6.1, JAM3, LMX1A, EPB41L3, SEPT9, TERT, ZNF671, and TRH. The methylation levels of real clinical samples were then detected and analyzed using quantitative real-time PCR for validation. Methylated DNA associated with cervical cancer progression enters the urine through the flushing of vaginal secretions. However, the DNA extracted from the urine is mixed with background DNA from sources such as the bladder, further diluting the methylation signal and making it more difficult to detect. Therefore, this study designed specific primers and probes based on eight core genes (PAX1, SOX1, ZNF671, JAM3, EPB41L3, TRH, ASCL1, and LHX8) selected through two screening methods. Singleton and multiplex sequential tests were performed using a relatively sensitive ddPCR platform.

[0067] Finally, based on the urine DNA sample data modeling analysis, the CpG island regions of three genes, ASCL1, LHX8, and SOX1, were selected as optional detection targets. Furthermore, a combination model of these three genes was constructed on the real-time PCR platform for the detection of cervical cancer and high-grade cervical lesions, and its detection performance was evaluated in different populations.

[0068] Example 2: Method for detecting methylation levels Test reagents Methylation level detection enzyme mixture: DNA polymerase, dNTPs, MgCl2, etc.

[0069] Methylation reaction solution: any primers and probes in Tables 1 and 2, TE buffer.

[0070] Negative control: DNA from negative cell regions of methylation target areas of ASCL1, LHX8, and SOX1 genes.

[0071] Positive control: Cell DNA with positive methylation target regions of ASCL1, LHX8, and SOX1 genes.

[0072] Nucleic acid extraction or purification reagent: Guangdong-Shenzhen Medical Device Registration No. 20230847.

[0073] Methylation detection sample pretreatment reagent: Guangdong-Shenzhen Medical Device Registration No. 20240689.

[0074] Testing instruments Fully automated medical PCR analysis system; Shanghai Hongshi Medical Technology Co., Ltd.; National Medical Device Registration Certificate No. 20183221659; SLAN-96S.

[0075] Detection methods 1. Sample processing 1.1 Nucleic acid extraction: Nucleic acid was extracted from the urine sample using nucleic acid extraction or purification reagents.

[0076] 1.2 Bisulfite conversion: Take 20-30 μL of extracted urine DNA (if the DNA volume is less than 30 μL, add ultrapure water to make up to 30 μL), and process it with methylation detection sample pretreatment reagent. For each round of detection, 30 μL of positive and negative quality control samples should be converted simultaneously. It is recommended to perform PCR detection immediately after conversion of the sample and quality control sample (Bis-DNA). If not used immediately, Bis-DNA can be stored at -20±5℃ for no more than 1 month.

[0077] 2. Reagent preparation 2.1 Take out each component of the kit in advance, thaw at room temperature, vortex for 10 seconds, and then centrifuge briefly to remove the liquid on the tube wall.

[0078] 2.2 Reagent Preparation 2.2.1 If the number of samples to be tested is n, the required number of reactions N = number of samples to be tested (n) + 1. Calculate the amount of each reagent added to the reaction mixture, as shown below: Methylase mixture 12.5 N (μL), methylation reaction solution 2.5 N (μL).

[0079] 2.2.2 Take a 1.5 mL centrifuge tube to prepare the reaction system. After adding all the reagents, vortex for 10 seconds and then centrifuge briefly to remove the liquid on the tube wall.

[0080] 2.2.3 Dispense the above reaction solution into PCR reaction tubes at a rate of 15 μL / tube.

[0081] 3. Sample addition Add 10 μL each of the bisulfite-converted Bis-DNA sample, negative control, and positive control. Then carefully cap the PCR reaction tube (avoiding air bubbles), centrifuge briefly, and immediately perform the PCR amplification reaction.

[0082] 4. PCR amplification program settings Set the PCR instrument amplification parameters according to Table 3 and start amplification.

[0083] Table 3. PCR Parameter Setting Table

[0084] The CY5, ROX, FAM, and VIC channels correspond to the ASCL1, LHX8, SOX1, and ACTB genes, respectively. After setting up, run the PCR program. The amplification curve is shown below. Figure 1 As shown.

[0085] 5. Baseline and threshold settings 5.1 Threshold Setting For the SLAN-96S fully automated medical PCR analysis system, the recommended threshold settings are 25 for target gene channels (CY5, ROX, FAM) and 45 for the internal standard channel (VIC). The baseline start and end points for CY5, ROX, and VIC channels are set to automatic optimization 6-12 by default, while those for the FAM channel are set to manual optimization 3-18. Due to potential differences between instruments, the Ct value for each reaction tube can also be obtained by using the inflection point of the amplification curve for each gene as the threshold line. The same threshold values ​​must be maintained for the same fluorescence channels in each batch of tests.

[0086] 5.2 Export the Ct values ​​of each gene (retain two decimal places). The Ct value of the ACTB internal reference gene corresponding to the VIC channel is recorded as ACTB Ct; The Ct value of the ASCL1 target gene corresponding to the CY5 channel is recorded as ASCL1 Ct; The Ct value of the LHX8 target gene corresponding to the ROX channel is recorded as LHX8 Ct; The Ct value of the SOX1 target gene corresponding to the FAM channel is recorded as SOX1 Ct.

[0087] 6. Result Calculation The ΔCt used is a uniform ΔCt: Target ΔCt = (target Ct - internal reference Ct) / (45 - internal reference Ct); the target Ct value that does not generate an amplified signal is defined as 45.

[0088] Logit value calculation: Logit = 2.438 - 2.123 ASCL1 ΔCt-2.797 LHX8 ΔCt-1.164 SOX1 ΔCt; P-value calculation (results are rounded to 3 decimal places): P = 1 / (1 + exp (-Logit)).

[0089] This product calculates the P-value based on the ΔCt value of each gene, with a positive cutoff of 0.40. A P-value greater than or equal to a cutoff of 0.40 is considered positive, indicating a high risk of CIN2+.

[0090] 7. The process of determining the calculation model and the positive judgment value. To establish the result calculation model and positive cutoff value for the kit, 782 clinical samples were tested, divided into training and validation sets. These included urine samples from patients with cervical cancer, precancerous lesions of various grades, cervical inflammation, and normal cervix, as well as urine samples from some other cancer patients. The p-values ​​were obtained by performing regression fitting analysis on the ΔCt values ​​of each gene in the training set using a logistic regression model. The positive cutoff value was determined through ROC analysis and Youden's index. Specifically, the results for the training and validation sets are shown in Table 4 below.

[0091] Bioinformatics analysis of the training and validation process: Clinical samples were divided into a training set (511 cases) and a validation set (approximately 271 cases) according to a 6:4 to 7:3 ratio. The different pathological grades (CIN0 in normal cervical lesions, CIN1 in low-grade intraepithelial neoplasia, CIN2 / CIN3 in high-grade intraepithelial neoplasia, and CCA in cervical cancer) in the two sets of samples conformed to a certain natural distribution pattern of the patient population. Multivariate logistic regression analysis was performed using the `glm` function of the `stats` package in R, with pathological diagnosis as the gold standard. The regression model was constructed using the ΔCt values ​​of each gene as independent variables, and the joint diagnostic P-value was obtained through maximum likelihood estimation. ROC curves were plotted using the `pROC` package, and the AUC and 95% confidence interval were calculated. The positive judgment value (critical value) was determined according to the principle of maximizing the Youden index (J = sensitivity + specificity - 1), and the sensitivity, specificity, positive predictive value, and negative predictive value corresponding to this critical value were calculated. The AUC was 0.8225. The results are as follows: Figure 2 As shown. The ΔCt values ​​of the validation set samples were substituted into the model constructed from the training set to calculate the P-value and compare it with the gold standard. The sensitivity, specificity, AUC, and 95% confidence interval of the model were evaluated to verify its generalization ability. Therefore, the calculation method and positive judgment value in Part 6 of the examples are derived from this. Similarly, the same reaction system and training logic were used to obtain the swab methylation calculation model, including 271 patients in the validation set. Swabs and urine were tested in pairs.

[0092] Table 4

[0093] Furthermore, the detection performance of the biomarker combination used in this invention in the validation set of urine samples with CIN2+ / CIN3+ and the detection performance of the biomarker combination used in this invention in the validation set of swab samples were calculated. The urine validation results and swab validation results are shown in Tables 5 and 6, respectively (the 6 samples with CIN2-3 levels were not included in the specificity calculation with CIN3+ as the cutoff point). The AUC results are as follows: Figure 3 As shown.

[0094] Table 5

[0095] Table 6

[0096] Example 3: Detection performance of the composition of the present invention In the screening of combined biomarkers, a total of 222 independent clinical samples were used, and the sample information is shown in Table 7. Urine samples from the clinical samples were used as the test subjects, and multi-target combined testing was performed according to the methylation level detection method in Example 2.

[0097] Table 7

[0098] The specific detection results of each marker and its combination are shown in Table 8 below. It can be seen from the table that the marker combination used in this invention has the highest CIN2+ detection effect, with an AUC of 0.8783, a sensitivity of 0.7191, and a specificity of 0.9023.

[0099] Table 8

[0100] Example 4: Comparison of methylation detection and liquid-based thin-layer cytology (TCT) results A statistical analysis was conducted on 259 cases with TCT results from the validation set in Table 4. The statistical results are shown in Tables 9 and 10. The results show that, with consistent sensitivity, urinary cervical cancer methylation showed significantly higher specificity than TCT (P < 0.0001), effectively reducing the number of unnecessary colposcopy referrals.

[0101] Table 9

[0102] Table 10

[0103] Example 4: Limit of Detection Using a 30ng sample with a mutation frequency of 0.2%, the detection limit of each combination was determined, and the specific results are shown in Table 11. As can be seen from the table, the biomarker combination of this invention has the lowest detection limit, exhibiting better detection performance and a lower false negative rate than other combinations. The biomarker combination of this invention has a detection rate of over 95%, meeting the requirements.

[0104] Table 11

[0105] It should be noted that this application is not limited to the above-described embodiments. The above embodiments are merely examples, and any embodiments with the same structure and effect as the technical concept within the scope of this application are included in the technical scope of this application. Furthermore, various modifications that can be conceived by those skilled in the art to the embodiments, and other ways of constructing by combining some of the constituent elements of the embodiments, without departing from the spirit of this application, are also included in the scope of this application.

Claims

1. A detection composition, characterized in that, The detection composition includes nucleic acid primers and nucleic acid probes, wherein the nucleic acid primers and nucleic acid probes are: Nucleic acid primers and probes shown in SEQ ID NO:5~13.

2. The detection composition according to claim 1, characterized in that, The detection composition further includes an internal standard upstream primer, an internal standard downstream primer, and an internal standard probe for detection.

3. The detection composition according to claim 1 or 2, characterized in that, The detection composition further includes a sample release agent for extracting sample nucleic acid, a purifying agent for purifying sample nucleic acid, and one or more of the bisulfite or bisulfite used for conversion.

4. Use of the detection composition according to any one of claims 1 to 3 in the preparation of a kit for detecting cervical cancer and high-grade cervical lesions.

5. A kit for detecting cervical cancer and high-grade cervical lesions, characterized in that, The kit comprises the composition according to any one of claims 1 to 3.

6. The reagent kit according to claim 5, characterized in that, The kit also includes dNTPs and Mg. 2+ K + At least one of the following: ammonium ions, ethylenediaminetetraacetic acid, polymerase, PCR buffer, and hot-start enzyme.

Images