Method for detecting mec a mutant strain of methicillin-resistant staphylococcus aureus by exponential rolling circle amplification

Abstract

The application is a detection method of methicillin-resistant Staphylococcus aureus based on exponential rolling circle amplification and combined with DNA fluorescent aptamer, and belongs to the technical field of gene detection. The detection method comprises the following steps: in the ring reaction, a DNA circular template is prepared, the circular DNA template is incubated with DNA polymerase, DNA scissors, primers, dNTPs, BSA and a DNA polymerase reaction buffer, then the reaction is terminated by heat treatment to obtain an eRCA amplification product; subsequently, a DFHBI-1T small molecule is added, and the mixture is incubated in a HEPES buffer solution in the dark to generate a detectable fluorescence signal change, thereby obtaining a sample solution to be detected, and the fluorescence signal is measured. The application has the advantages of short time consumption, high sensitivity, good specificity, repeatability and stability.

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, specifically relating to a method for detecting methicillin-resistant Staphylococcus aureus (MRSA) strains of MecA mutants based on exponential rolling circle amplification. Background Technology

[0002] Methicillin-resistant Staphylococcus aureus (MRSA) is a prevalent, multidrug-resistant bacterium in clinical practice. This strain is highly pathogenic, exhibits a broad spectrum of antibiotic resistance, and easily causes severe illnesses such as skin infections, pneumonia, and sepsis. It is also widely distributed in raw food, natural water bodies, medical supplies, and residential environments, posing a significant risk of cross-infection and public health incidents. The formation of MRSA resistance is directly related to the acquisition of the MecA gene. Compared to the endogenous penicillin-binding protein of Staphylococcus aureus, the PBP2a encoded by MecA differs in both spatial structure and substrate recognition characteristics, exhibiting a significantly weakened binding affinity to β-lactam antibiotics. Under the influence of β-lactam antibiotics, the function of conventional PBPs is inhibited, while PBP2a can still mediate peptidoglycan cross-linking, allowing cell wall synthesis to continue and maintaining bacterial growth. This mechanism leads to persistent resistance of MRSA to multiple β-lactam drugs in clinical treatment and is closely associated with an increased risk of treatment failure. Therefore, there is an urgent need for a rapid and accurate detection method to identify MRSA. Currently, the main clinical methods for diagnosing methicillin-resistant Staphylococcus aureus (MRSA) are traditional phenotypic culture and polymerase chain reaction (PCR)-based methods. Traditional phenotypic culture requires one to two days of bacterial culture before identification, thus the detection time is often two to three days, which is time-consuming. PCR requires three steps of annealing, denaturation, and extension, so it requires specialized experimental equipment, and the heating modules of this equipment are expensive, requiring a specialized laboratory. Furthermore, PCR is more difficult to operate and prone to false positives due to aerosols, thus requiring specialized personnel. This method, however, is simple to operate and does not involve aerosols. Therefore, existing publicly available detection methods are time-consuming and require expensive equipment, specialized laboratories, and skilled personnel.

[0003] Therefore, this invention designs a method for detecting methicillin-resistant Staphylococcus aureus (MRSA) mutant strains of MecA by exponential rolling circle amplification. Summary of the Invention

[0004] To overcome the shortcomings of existing technologies, this invention provides a method for detecting methicillin-resistant Staphylococcus aureus (MRSA) mutant strains based on exponential rolling circle amplification (ROA). Furthermore, ROA can be performed under isothermal conditions without the need for heating equipment, thus achieving interference-resistant and specific detection of MRA. Therefore, it offers advantages such as short detection time and sensitive detection within bacterial communities. This invention solves the problems of long detection time, susceptibility to interference, and unstable detection results in existing methods.

[0005] The technical solution of this invention is: a method for detecting methicillin-resistant Staphylococcus aureus (MRSA) strains of MecA mutant based on exponential rolling circle amplification, the specific steps of which are as follows: Circulation reaction: When the target nucleic acid fragment is present in the sample to be tested, a circular DNA template is synthesized using the target nucleic acid fragment as a template, along with a padlock probe and ligase. Exponential rolling circle amplification reaction: Using the circular DNA template as a template, an exponential rolling circle amplification reaction is performed under the action of primers, DNA polymerase, dNTPs and endonuclease to obtain amplification products; the amplification products contain a first fragment and a second fragment, the first fragment being a nucleic acid aptamer with a specific spatial structure, and the second fragment being able to serve as a template or primer for the circularization reaction to trigger a new round of amplification; Signal output and detection: The amplification product is brought into contact with a signal molecule, which specifically binds to the first fragment to generate a detectable signal change. The signal change is measured to determine whether the target nucleic acid fragment exists in the sample to be tested.

[0006] The target nucleic acid fragment is a methicillin-resistant Staphylococcus aureus resistance-related gene or a fragment thereof, preferably the MecA gene or a MecA gene fragment of a variant thereof, and the sequence of the padlock probe is shown in SEQ ID NO. 1.

[0007] In some preferred embodiments, the circular DNA template in the circularization reaction is prepared by mixing the padlock probe with the genomic DNA of the MecA variant methicillin-resistant Staphylococcus aureus, annealing, incubating with DNA ligase in a reaction buffer system containing T4 ligase, and then terminating the reaction by heat treatment to obtain the circular DNA template.

[0008] Annealing conditions: slow annealing at 95℃ to room temperature for 40 min, followed by storage at 4℃; incubation conditions: 22℃ for 60 min; heat treatment conditions: 65℃ for 10 min.

[0009] The nucleic acid aptamer is the Bibb Lettuce aptamer or a variant thereof; The signal molecule is DFHBI-1T or its derivative; the signal change is a change in fluorescence signal; in the exponential rolling circle amplification reaction, the endonuclease is a nuclease capable of recognizing and cleaving a specific sequence in double-stranded DNA, preferably Nb.BbvCI or its isoschizase.

[0010] The exponential rolling ring amplification reaction is carried out under isothermal conditions, which are 25-37°C, preferably 30°C.

[0011] In some preferred embodiments, in the exponential rolling circle amplification reaction, the circular DNA template is incubated with DNA polymerase, dNTPs, Nb.BbvCI enzyme, primers, and polymerase reaction buffer, followed by heat treatment to terminate the reaction and obtain eRCA amplification products. Primers bind to the circular DNA template and initiate the amplification reaction under the action of Phi29 DNA polymerase, generating long single-stranded DNA products. During amplification, these products provide specific recognition sites for the Nb.BbvCI restriction enzyme, which cleaves them into short DNA fragments at specific sites. One portion of the cleaved fragments, the Bibb Lettuce structure, is released and binds to the small molecule DFHBI-1T to generate a fluorescent signal, resulting in signal output and the test sample solution. Another portion of the fragments is used to trigger a new round of padlock probe circularization and subsequent eRCA amplification.

[0012] The process parameters for preparing the eRCA amplification product are as follows: incubation conditions: incubation at 30℃ for 4 hours; heat treatment conditions: 65℃ for 10 minutes.

[0013] The volume ratio of the circular DNA template to DNA polymerase, endonuclease Nb.BbvCI, BSA, dNTPs, DNA primers, and polymerase reaction buffer is 60:1:1:4:12:12:12.

[0014] In the signal output step, the incubation conditions are light-protected room temperature incubation for 80-120 minutes, preferably 100 minutes. The signal change is measured by a fluorescence measuring instrument under the following conditions: excitation wavelength of 450-475nm and detection wavelength of 495-515nm, preferably 465nm and 505nm.

[0015] In some preferred embodiments, during signal output and detection, the DFHBI-1T small molecule and the eRCA amplification product are added to HEPES buffer and incubated to generate a detectable fluorescence signal, thus obtaining the sample solution to be tested. Specifically, the incubation conditions for the DFHBI-1T small molecule and the eRCA amplification product in HEPES buffer are: incubation at room temperature in the dark for 100 min. The concentration of the DFHBI-1T small molecule is 5-20 μM.

[0016] In some preferred embodiments, the fluorescence signal is measured by excitation with light at a wavelength of 465 nm and measurement of the change in fluorescence signal at 505 nm.

[0017] A kit for detecting drug-resistant bacteria, comprising the following components for carrying out the detection method: Padlock probe; Primers; DNA ligase; DNA polymerase; Nucleotide endonucleases; dNTPs; signaling molecules.

[0018] The sequence of the padlock probe comprises the sequence shown in SEQ ID NO:1 or a fragment thereof; and / or, the sequence of the primer comprises the sequence shown in SEQ ID NO:2 or a fragment thereof; the DNA polymerase is phi29 DNA polymerase or a homologous enzyme with strand displacement activity thereof; the endonuclease is Nb.BbvCI; and the signal molecule is DFHBI-1T.

[0019] A nucleic acid composition for detecting methicillin-resistant Staphylococcus aureus, comprising: Padlock probe, the sequence of which includes the sequence shown in SEQ ID NO:1; and, Primers whose sequences include those shown in SEQ ID NO:2.

[0020] The use of the method, the kit, or the nucleic acid composition described herein in the preparation of a diagnostic reagent or device for detecting methicillin-resistant Staphylococcus aureus.

[0021] A method for detecting methicillin-resistant Staphylococcus aureus for non-diagnostic purposes, comprising the steps of using the method to detect food samples, environmental samples, or medical consumable samples.

[0022] The beneficial effects of this invention are as follows: This invention utilizes exponential rolling circle amplification technology combined with DFHBI-1T small molecules for MecA gene detection. Only when the MecA gene is present can the amplification reaction of eRCA be activated and a Bibb Lettuce structure be formed, which binds to the DFHBI-1T small molecule, resulting in a change in fluorescence signal. When the MecA gene is absent, eRCA cannot be activated and a Bibb Lettuce structure cannot be formed, and no change in fluorescence signal occurs.

[0023] This invention, through optimization of the detection system, successfully achieved specific detection of methicillin-resistant Staphylococcus aureus (MRSA) variants of MecA. Rolling circle amplification (RCA) uses circular DNA as a template. A short DNA primer (partially complementary to the circular template) converts dNTPs into single-stranded DNA under enzymatic catalysis. This single-stranded DNA contains hundreds or thousands of Bibb Lettuce structures and sequences, which are cleaved by Nb.BbvCI enzyme. The Bibb Lettuce structures bind to the DFHBI-1T small molecule to generate a fluorescent signal. The sequences then undergo a circularization reaction with the padlock probe, followed by eRCA amplification. These processes collectively form a cyclic amplification mechanism of "circularization-extension-cleavage." This mechanism not only ensures the continuous generation of new amplification endpoints during the reaction but also achieves exponential signal amplification, thereby significantly improving the sensitivity and reliability of MecA detection. Linearity assays showed good linearity in the range of 0.05-5 nM. Figure 3 C), correlation coefficient (R) 2 The value of 0.995 indicates its great potential for sensitive detection of the MecA gene.

[0024] This invention offers better sensitivity and specificity than commonly used PCR methods. It also excels in detection time, completing detection in approximately 8 hours, compared to 18-24 hours for traditional KB diffusion and VITEK2 methods (e.g., patent CN118773350A). Attached Figure Description

[0025] Figure 1 Compare the fluorescence spectra of linear RCA and eRCA.

[0026] Figure 2 Figure 1 shows the optimization results of the reaction system. (A) Optimized results of eRCA amplification reaction time; (B) Optimized results of fluorescence reaction time; (C) Optimized results of PadLock 1 probe concentration; (D) Optimized results of Primer concentration; (E) Optimized results of Nb.BbvCI enzyme concentration; (F) Optimized results of DFHBI-1T small molecule concentration. Error bars represent the standard deviation of three measurements.

[0027] Figure 3 Sensitivity detection results: (A) Fluorescence spectrum response of eRCA amplification to different concentrations of MecA; (B) Fluorescence response of eRCA amplification to the logarithm of MecA concentration; (C) Linear relationship of eRCA amplification to the logarithm of MecA concentration. Wherein, the error bars represent the standard deviation of three measurements. The results show a linear relationship between the fluorescence intensity of the solution and the change in MecA concentration, ranging from 0.05 nM to 5 nM.

[0028] Figure 4 (A) Sequences of different targets (methicillin-resistant Staphylococcus aureus (MRSA), Escherichia coli (E. coli), Staphylococcus aureus (MSSA) and Pseudomonas aeruginosa (P. aeruginosa)); (B) Comparison diagrams of three different common pathogens: Escherichia coli, Staphylococcus aureus (MSSA) and Pseudomonas aeruginosa. All errors are from three independent experiments. Detailed Implementation

[0029] The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the invention, and should not be construed as limiting the invention.

[0030] Addressing the issues of time-consuming, susceptible to interference, and unstable detection results in existing detection methods, this invention provides a method for detecting methicillin-resistant Staphylococcus aureus (MRSA) strains of MecA mutants based on exponential rolling circle amplification, comprising the following steps: Step 1: Mix the padlock probe, primer sequence, and genomic DNA of the MecA variant methicillin-resistant Staphylococcus aureus, add T4 ligase 10× buffer, anneal at 95°C to room temperature for 40 min, and then store at 4°C. Next, add 1 μL T4 ligase, mix gently, and incubate at 22°C for 1 h. Then terminate the reaction by heat treatment at 65°C for 10 min to obtain a circular DNA template; the padlock probe sequence... P-TGATCCCAATCC TCAGCCGC GTG GCC CAC TGC CGC CAC ATCCCTACTACAACATCAGTCTGATAAGCTATTTTAGT CCC CTC GCGCC TCAGC AATGACGCTA Preferably, 100 nM padlock probe, 100 nM primer sequence and genomic DNA of MecA mutant strain methicillin-resistant Staphylococcus aureus are mixed and added to T4 ligase 10× buffer, annealed, then 1 μL T4 ligase is added, gently mixed and incubated at 22°C for 1 h, and then the reaction is terminated by heat treatment to obtain a circular DNA template. Step 2: The circular DNA template was incubated with DNA polymerase, dNTPs, Nb.BbvCI enzyme, primers, and polymerase reaction buffer at 30°C for 4 hours. The reaction was then terminated by heat treatment at 65°C for 10 minutes to obtain the eRCA product. The primer sequence was: AAA TAG CTT ATC AGA CTG ATG TTG Preferably, 30 μL of circular DNA template is incubated with 0.5 μL of DNA polymerase, 0.5 μL of Nb.BbvCI restriction enzyme, 2 μL of LBSA, 6 μL of dNTPs, 6 μL of DNA primers and 6 μL of polymerase reaction buffer, and then the reaction is terminated by heat treatment to obtain the eRCA product. Step 3: Add the DFHBI-1T small molecule and eRCA amplification product to HEPES buffer and incubate for 100 min at room temperature in the dark.

[0031] Preferably, the concentration of the DFHBI-1T small molecule is 10 μM.

[0032] Step 4: Measurement of fluorescence signal.

[0033] This invention also provides a kit for detecting methicillin-resistant Staphylococcus aureus (MRSA) variant strains, comprising a padlock probe, genomic DNA of MRSA variant strains, T4 ligase, dNTPs, buffer, primers, Nb.BbvCI enzyme, BSA, phi29 DNA polymerase, and DFHBI-1T small molecule.

[0034] The above technical solution will be further explained below with reference to the accompanying drawings and specific examples: 1. Detection method for methicillin-resistant Staphylococcus aureus (MRSA) variants of MecA The oligonucleotide sequences required for this method are listed in Table 1-1 and were synthesized by Sangon Biotech Co., Ltd., as detailed in the table below: The sequence used in this invention Table 1-1

[0035] Rolling circle amplification (RCA) is an efficient enzymatic isothermal reaction that uses a circular probe as a template to generate long tandem single-stranded DNA or RNA products under the initiation of a short primer. When the target MecA gene is absent or only one of it is present, the Padlock is an independent single-stranded structure and cannot initiate subsequent rolling circle amplification reactions, thus terminating the reaction. This invention designs the Padlock sequence to generate long single-stranded DNA under the initiation of a short primer. During amplification, these long single-stranded DNA sequences provide specific recognition sites for the restriction enzyme Nb.BbvCI, and are cleaved into short DNA fragments at specific sites. One portion of the cleaved fragments, the Bibb Lettuce structure, is released and binds to the small molecule DFHBI-1T to generate a fluorescent signal, achieving signal output and obtaining the test sample solution; the other portion of the fragments is used to trigger a new round of padlock probe circularization reaction and subsequent eRCA amplification.

[0036] Example 1 This embodiment presents a method for detecting methicillin-resistant Staphylococcus aureus (MRSA) mutant strains of MecA based on exponential rolling circle amplification. The specific steps are as follows: Step 1: Formation of the Circular Template To synthesize a circular DNA template in a 60 μL circularization reaction system, prior to template and circularization, 100 nM padlock probe (SEQ ID NO:1), primers (SEQ ID NO:2), and the target MecA gene (SEQ ID NO:3) were added to T4 ligase 10× buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, and 0.5 mM ATP, pH 7.8) and annealed slowly at 95°C to room temperature for 40 min. The resulting solution was then stored at 4°C. The mixture was gently mixed with T4 ligase and incubated at 22°C for 1 h to ligate the DNA into a circular template. This template was then stored at -20°C for use in step 2.

[0037] Step 2: Generation of eRCA amplification products For the eRCA reaction, 30 μL of the circular DNA template prepared in step 1 above was incubated with phi29 DNA polymerase (0.5 μL, 1 U / μL), dNTPs (6 μL, 1 mM), BSA (2 μL, 5 mg / mL), Nb.BbvCI restriction enzyme (0.5 μL, 5 U / μL), primers (SEQ ID NO:2) (6 μL, 100 nM), dH2O (9 μL), and polymerase reaction buffer (33 mM Tris-HCl, 10 mM MgCl2, 66 mM KCl, 0.1% Tween 20, 1 mM DTT, pH 7.9) (6 μL, 10×). The reaction mixture was incubated at 30 °C for 4 hours, and then terminated by heat treatment (65 °C, 10 min). The mixture was stored at -20 °C for use in step (3).

[0038] Step 3: Generation of fluorescence signal Add 40 μL of the eRCA amplification product from step 2 above and 6 μL of DFHBI-1T small molecule (10 nM) to HEPES buffer and incubate for 100 min at room temperature in the dark.

[0039] Step 4: Measurement of fluorescence signal The DFHBI-1T small molecule itself does not produce a fluorescent signal; it only produces a fluorescent signal after binding to the Bibb Lettuce structure in the eRCA amplification product.

[0040] Measurement conditions for fluorescence signal: Take the reaction solution from step 3, use a fluorescence meter to excite it with light at a wavelength of 465nm, and measure the change in fluorescence signal at 505nm.

[0041] The feasibility of this method was investigated by measuring the fluorescence intensity detected using a fluorescence meter. Figure 1 As shown, eRCA amplification can only be completed when the target MecA gene is present, and the Bibb Lettuce structure can bind to the DFHBI-1T small molecule to generate a fluorescent signal.

[0042] In summary, the formation of the circular template took one hour and forty minutes, eRCA amplification took four hours and ten minutes, and the generation of the fluorescence signal took one hundred minutes, for a total of approximately eight hours.

[0043] Example 2 Optimization of the reaction system Based on the steps in Example 1, the eRCA amplification reaction time, fluorescence reaction time, padlock probe concentration, primer concentration, Nb.BbvCI enzyme concentration, and DFHBI-1T small molecule concentration were individually adjusted for testing. The specific steps are as follows: (1) Adjust the eRCA amplification reaction time: The method and steps are the same as in Example 1, except that the eRCA amplification reaction time is adjusted to 1 hour, 2 hours, 4 hours and 6 hours respectively.

[0044] (2) Fluorescence reaction time: The method and steps are the same as in Example 1, except that the fluorescence reaction time is adjusted to 30 minutes, 60 minutes, 90 minutes and 120 minutes respectively to plot the kinetic curves.

[0045] (3) Padlock probe concentration: The method and steps are the same as in Example 1, except that the padlock probe concentration is adjusted to 50nM, 100nM and 200nM respectively.

[0046] (4) Primer concentration: The method and steps are the same as in Example 1, except that the primer concentrations are adjusted to 50 nM, 100 nM and 200 nM respectively.

[0047] (5) Nb.BbvCI enzyme concentration: The method and steps are the same as in Example 1, except that the Nb.BbvCI enzyme concentration is adjusted to 2 U / μL, 5 U / μL and 8 U / μL respectively.

[0048] (6) DFHBI-1T small molecule concentration: The method and steps are the same as in Example 1, except that the DFHBI-1T small molecule concentration is adjusted to 5μM, 10μM and 20μM respectively.

[0049] like Figure 2As shown, the amplification efficiency and fluorescence signal output were best when the eRCA amplification reaction time was 4 hours, the fluorescence reaction time was 100 minutes, the padlock probe concentration was 100 nM, the primer concentration was 100 nM, the Nb.BbvCI enzyme concentration was 5 U / μL, and the DFHBI-1T small molecule concentration was 10 μM.

[0050] Example 3: Sensitivity Detection The experiment set up standard solutions of the target analyte MecA at different concentrations (0, 0.05, 0.1, 0.5, 1, 5, 10 nM), and carried out eRCA amplification and fluorescence signal generation reactions under the same conditions. The fluorescence signals of each sample were measured to evaluate the system's response to different concentrations of MecA.

[0051] The key to the analysis is the linear response of the analyte, such as Figure 3 As shown, with the gradual increase of MecA gene concentration, the fluorescence signal intensity at 505 nm wavelength gradually increases. Figure 3 The results showed that the fluorescence signal intensity had a good linear relationship with the logarithm of MecA concentration, with a correlation coefficient (R²) of 0.995, a response range of 0.05–5 nM, and a detection limit of 15.6 pM for MecA. The linear fitting equation for MecA was F = 2490lgC + 7266. These results indicate the great potential of this biosensor to sensitively detect the MecA gene.

[0052] Example 4 Specificity Detection The specificity of the eRCA amplification detection reaction system was demonstrated by using the same concentrations of nucleic acid sequences from methicillin-resistant Staphylococcus aureus, Escherichia coli, Staphylococcus aureus, and Pseudomonas aeruginosa under the same conditions for eRCA amplification and fluorescence signal generation, and measuring the fluorescence signal of each sample.

[0053] Test results are shown Figure 4 B. The results showed that only the system containing methicillin-resistant Staphylococcus aureus (MRSA) exhibited a strong fluorescence signal. In contrast, the fluorescence signals corresponding to the specific interfering sequences of Escherichia coli, Staphylococcus aureus, and Pseudomonas aeruginosa were at low levels, with no significant difference from the blank control group. This demonstrates that the system has good specificity.

[0054] Figure 4(A) Sequences of different targets (methicillin-resistant Staphylococcus aureus (MRSA), Escherichia coli (E. coli), Staphylococcus aureus (MSSA), and Pseudomonas aeruginosa (P. aeruginosa)); (B) Control figures of three different common pathogens: Escherichia coli, Staphylococcus aureus (MSSA), and Pseudomonas aeruginosa. All errors were derived from three independent experiments. Notably, when the target was MRSA, the fluorescence ratio signal intensity was significantly enhanced. Compared to MRSA, the fluorescence ratio signals of the other pathogen groups were the same as those of the blank group, indicating that the proposed method can specifically distinguish MRSA from other pathogens.

[0055] Example 5: A kit for detecting methicillin-resistant Staphylococcus aureus The kit includes padlock probes, genomic DNA of methicillin-resistant Staphylococcus aureus (MRSA) mutant strain, T4 ligase, dNTPs, buffer, primers, Nb.BbvCI enzyme, BSA, phi29 DNA polymerase, and DFHBI-1T small molecule.

[0056] The sequence of the padlock probe is shown in Table 1-1 as PadLock 1, the sequence of the primer is shown in Table 1-1 as Primer, and the sequence of the MecA gene fragment is shown in Table 1-1 as MecA.

[0057] In practice, the specific dosage of each component in the kit should be referred to the content described above.

[0058] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention without departing from the principles and spirit of the present invention.

Claims

1. A method for detecting drug-resistant bacteria based on exponential rolling circle amplification, characterized in that, Includes the following steps: Circulation reaction: When the target nucleic acid fragment is present in the sample to be tested, a circular DNA template is synthesized using the target nucleic acid fragment as a template, along with a padlock probe and ligase. Exponential rolling circle amplification reaction: Using the circular DNA template as a template, an exponential rolling circle amplification reaction is performed under the action of primers, DNA polymerase, dNTPs and endonuclease to obtain amplification products; the amplification products contain a first fragment and a second fragment, the first fragment being a nucleic acid aptamer with a specific spatial structure, and the second fragment being able to serve as a template or primer for the circularization reaction to trigger a new round of amplification; Signal output and detection: The amplification product is brought into contact with a signal molecule, which specifically binds to the first fragment to generate a detectable signal change. The signal change is measured to determine whether the target nucleic acid fragment exists in the sample to be tested.

2. The detection method according to claim 1, characterized in that, The target nucleic acid fragment is a methicillin-resistant Staphylococcus aureus resistance-related gene or a fragment thereof, preferably the MecA gene or a MecA gene fragment of a variant thereof, and the sequence of the padlock probe is shown in SEQ ID NO.

1.

3. The detection method according to claim 1, characterized in that, The nucleic acid aptamer is the Bibb Lettuce aptamer or a variant thereof; The signal molecule is DFHBI-1T or its derivative; the signal change is a change in fluorescence signal; in the exponential rolling circle amplification reaction, the endonuclease is a nuclease capable of recognizing and cleaving a specific sequence in double-stranded DNA, preferably Nb.BbvCI or its isoschizase.

4. The detection method according to claim 1, characterized in that, The exponential rolling ring amplification reaction is carried out under isothermal conditions, which are 25-37°C, preferably 30°C.

5. The detection method according to claim 1, characterized in that, In the signal output step, the incubation conditions are light-protected room temperature incubation for 80-120 minutes, preferably 100 minutes. The signal change is measured by a fluorescence measuring instrument under the following conditions: excitation wavelength of 450-475nm and detection wavelength of 495-515nm, preferably 465nm and 505nm.

6. A kit for detecting drug-resistant bacteria, characterized in that, It comprises the following components for implementing the detection method according to any one of claims 1-5: Padlock probe; Primers; DNA ligase; DNA polymerase; Nucleotide endonucleases; dNTPs; signaling molecules.

7. The reagent kit according to claim 6, characterized in that, The sequence of the padlock probe comprises the sequence shown in SEQ ID NO:1 or a fragment thereof; and / or, the sequence of the primer comprises the sequence shown in SEQ ID NO:2 or a fragment thereof; the DNA polymerase is phi29 DNA polymerase or a homologous enzyme with strand displacement activity thereof; the endonuclease is Nb.BbvCI; and the signal molecule is DFHBI-1T.

8. A nucleic acid composition for detecting methicillin-resistant Staphylococcus aureus, characterized in that, include: A padlock probe whose sequence includes the sequence shown in SEQ ID NO:1; and, Primers whose sequences include those shown in SEQ ID NO:

2.

9. The use of the method according to any one of claims 1-5, the kit according to any one of claims 6-7, or the nucleic acid composition according to claim 8 in the preparation of a detection reagent or device for detecting methicillin-resistant Staphylococcus aureus.

10. A method for detecting methicillin-resistant Staphylococcus aureus (MRSA) for non-diagnostic purposes, characterized in that, The method includes the steps of testing food samples, environmental samples, or medical consumable samples using the method described in any one of claims 1-5.

Images