A liquid chip nucleic acid detection kit and a detection method for simultaneously detecting 10 kinds of intestinal pathogenic bacteria of experimental animals

Abstract

The application discloses a liquid chip nucleic acid detection kit and a detection method for simultaneously detecting 10 kinds of intestinal pathogenic bacteria of experimental animals. The 10 kinds of pathogenic bacteria are Salmonella typhimurium, Tyzzeria sp., Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentium, Helicobacter hepaticus, Klebsiella oxytoca, Staphylococcus aureus, Corynebacterium bovis and Yersinia pseudotuberculosis. Primers are designed according to specific target genes of the pathogenic bacteria, a TAG sequence is connected to the 5' end of the upstream primer, and a biotin label is marked on the 5' end of the downstream primer. After multiplex PCR amplification, the product is hybridized with the corresponding MagPlex-TAG microspheres, and the fluorescence signal is detected by using a liquid chip system. The method can simultaneously detect the 10 kinds of pathogenic bacteria in the same reaction system, and has the advantages of high throughput, high sensitivity, high specificity, good repeatability and the like, and provides an efficient monitoring tool for microbial quality control of experimental animals.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a 10-fold liquid-phase chip nucleic acid detection kit and method for simultaneously detecting 10 kinds of intestinal pathogens in laboratory animals (Salmonella typhimurium, Tyzer pathogen, Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentii, Helicobacter hepatis, Klebsiella pneumoniae, Staphylococcus aureus, Corynebacterium bovis, and Yersinia pseudotuberculosis) as specified in the national standard GB14922-2022 "Microbiological and Parasitological Grades and Monitoring of Laboratory Animals" and the Chinese Pharmacopoeia "3601 Quality Control of Laboratory Animals for Production and Identification of Biological Products"). In particular, it relates to a 10-fold nucleic acid detection method and dedicated primer and probe combination for simultaneously detecting the above 10 pathogens in the same reaction system using LuminexxTAG technology. Background Technology

[0002] Laboratory animals are an indispensable basic resource in life science research, drug development, and medical education. Their health status directly affects the reliability, reproducibility, and scientific validity of research results. However, laboratory animals are susceptible to infection by a variety of pathogens, which can not only cause serious damage to the animals' own health but also threaten the lives of those involved in their care and experimentation. The Chinese Pharmacopoeia 3601 Quality Control of Laboratory Animals for the Production and Identification of Biological Products and the national standard GB14922-2022 "Microbiological and Parasitological Grading and Monitoring of Laboratory Animals" sets forth clear control requirements for 10 pathogens, including Salmonella, Tyzer's pathogen, Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentii, Helicobacter pylori, Klebsiella pneumoniae, Staphylococcus aureus, Yersinia pseudotuberculosis, and Corynebacterium bovis.

[0003] Traditionally, the detection of intestinal pathogens in laboratory animals has mainly relied on culture methods and biochemical identification. While these methods can meet the detection needs to some extent, they have significant drawbacks such as cumbersome operation, long processing time, low sensitivity, and limited throughput. With the rapid development of molecular biology techniques, technologies such as PCR and real-time quantitative PCR have been widely used in the field of pathogen detection. However, these methods have limitations in the simultaneous detection of multiple pathogens. For example, real-time quantitative PCR is limited by the number of fluorescence channels, and the optimization difficulty of multiplex amplification systems increases significantly with the number of targets.

[0004] Luminex liquid chromatography-array technology, based on fluorescently encoded microspheres, boasts a theoretical multiplex detection throughput of up to 500 species, offering unique advantages in the field of multiplex pathogen detection. In recent years, studies have attempted to apply this technology to the detection of pathogens in laboratory animals, such as the Guangdong Provincial Standard DB44 / T2338-2021 "Liquid Chromatography-Based Qualitative Analysis of Nucleic Acids in Laboratory Animal Pathogens" and liquid chromatography-array detection technologies for 49 pathogens. However, among these existing technologies, there is no complete report on a 10-fold liquid chromatography-array detection method specifically targeting all 10 enteric pathogens specified in GB14922-2022 (especially including difficult-to-detect bacteria such as Corynebacterium bovis and Citrobacter rotavirus). Furthermore, Corynebacterium bovis primarily infects immunodeficient animals, and its genomic GC content differs significantly from other pathogens, posing technical challenges to primer compatibility and amplification uniformity when included in the same detection system as the other nine pathogens.

[0005] Therefore, developing a high-throughput detection method that can simultaneously, rapidly, and accurately detect all 10 types of intestinal pathogens in laboratory animals as specified in national standards has significant practical implications and application value. Summary of the Invention

[0006] The technical problem to be solved by this invention is to provide a decapsulated liquid-phase chip nucleic acid detection method and kit that can simultaneously, rapidly and accurately detect 10 kinds of experimental animal intestinal pathogens (Salmonella typhimurium, Tyzer pathogen, Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentii, Helicobacter hepatis, Klebsiella pneumoniae, Staphylococcus aureus, Corynebacterium bovis, and Yersinia pseudotuberculosis) as specified in the national standard GB14922-2022 and Chinese Pharmacopoeia 3601. This method solves the technical problems of existing detection methods being cumbersome, time-consuming, and unable to detect multiple pathogens simultaneously, especially addressing the problem that Corynebacterium bovis is difficult to detect together with the other 9 pathogens due to its large genomic differences.

[0007] This invention is mainly achieved through the following technical solutions.

[0008] In a first aspect, a 10-fold liquid-phase chip nucleic acid detection primer and TAG probe combination is provided for the simultaneous detection of Salmonella Typhimurium, Tyzer pathogen, Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentii, Helicobacter hepatis, Klebsiella pneumoniae, Staphylococcus aureus, Corynebacterium bovis, and Yersinia pseudotuberculosis in the same system, wherein the primer and TAG probe combination comprises:

[0009] Primers and TAG probes for detecting Salmonella Typhimurium include: a forward primer Sty-F with a nucleotide sequence as shown in SEQ ID NO:1, a reverse primer Sty-R with a nucleotide sequence as shown in SEQ ID NO:2, and a TAG sequence connected to the 5' end of the forward primer Sty-F that is complementary to the anti-TAG sequence connected to the microspheres.

[0010] Primers and TAG probes for detecting Taizer pathogens include: a forward primer Ty-F with a nucleotide sequence as shown in SEQ ID NO:3, a reverse primer Ty-R with a nucleotide sequence as shown in SEQ ID NO:4, and a TAG sequence connected to the 5' end of the forward primer Ty-F that is complementary to the anti-TAG sequence connected to the microspheres.

[0011] Primers and TAG probes for detecting Klebsiella pneumoniae include: a forward primer Kpn-F with a nucleotide sequence as shown in SEQ ID NO:5, a reverse primer Kpn-R with a nucleotide sequence as shown in SEQ ID NO:6, and a TAG sequence connected to the 5' end of the forward primer Kpn-F that is complementary to the anti-TAG sequence connected to the microspheres.

[0012] Primers and TAG probes for detecting Pseudomonas aeruginosa include: a forward primer Pa-F with a nucleotide sequence as shown in SEQ ID NO:7, a reverse primer Pa-R with a nucleotide sequence as shown in SEQ ID NO:8, and a TAG sequence connected to the 5' end of the forward primer Pa-F that is complementary to the anti-TAG sequence connected to the microspheres.

[0013] Primers and TAG probes for detecting Citrobacter rotavirus include: a forward primer Cro-F with a nucleotide sequence as shown in SEQ ID NO:9, a reverse primer Cro-R with a nucleotide sequence as shown in SEQ ID NO:10, and a TAG sequence connected to the 5' end of the forward primer Cro-F that is complementary to the anti-TAG sequence connected to the microspheres.

[0014] Primers and TAG probes for detecting Helicobacter hepatis include: a forward primer Hh-F with a nucleotide sequence as shown in SEQ ID NO:11, a reverse primer Hh-R with a nucleotide sequence as shown in SEQ ID NO:12, and a TAG sequence connected to the 5' end of the forward primer Hh-F that is complementary to the anti-TAG sequence connected to the microspheres;

[0015] Primers and TAG probes for detecting Klebsiella acidogenic bacteria include: a forward primer Kox-F with a nucleotide sequence as shown in SEQ ID NO:13, a reverse primer Kox-R with a nucleotide sequence as shown in SEQ ID NO:14, and a TAG sequence connected to the 5' end of the forward primer Kox-F that is complementary to the anti-TAG sequence connected to the microspheres.

[0016] Primers and TAG probes for detecting Staphylococcus aureus include: a forward primer Sa-F with a nucleotide sequence as shown in SEQ ID NO:15, a reverse primer Sa-R with a nucleotide sequence as shown in SEQ ID NO:16, and a TAG sequence connected to the 5' end of the forward primer Sa-F that is complementary to the anti-TAG sequence connected to the microspheres.

[0017] Primers and TAG probes for detecting Corynebacterium bovis include: a forward primer Cb-F with a nucleotide sequence as shown in SEQ ID NO:17, a reverse primer Cb-R with a nucleotide sequence as shown in SEQ ID NO:18, and a TAG sequence connected to the 5' end of the forward primer Cb-F that is complementary to the anti-TAG sequence connected to the microspheres;

[0018] Primers and TAG probes for detecting Yersinia pseudotuberculosis include: a forward primer Yps-F with a nucleotide sequence as shown in SEQ ID NO:19, a reverse primer Yps-R with a nucleotide sequence as shown in SEQ ID NO:20, and a TAG sequence connected to the 5' end of the forward primer Yps-F that is complementary to the anti-TAG sequence connected to the microspheres.

[0019] The microspheres used for each pathogen are numbered differently;

[0020] Furthermore, the 5' ends of the reverse primers Sty-R, Ty-R, Kpn-R, Pa-R, Cro-R, Hh-R, Kox-R, Sa-R, Cb-R, and Yps-R are all labeled with biotin.

[0021] In some implementations, the 5' ends of the forward primers Sty-F, Ty-F, Kpn-F, Pa-F, Cro-F, Hh-F, Kox-F, Sa-F, Cb-F, and Yps-F are all connected to the corresponding TAG sequences via spacer arms.

[0022] In some embodiments, the nucleotide sequences of the TAG sequences linked to the 5' end of the forward primer Sty-F are shown in SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28 respectively. As shown in NO:28, the nucleotide sequence of the TAG sequence connected to the 5' end of the forward primer Cb-F is shown in SEQ ID NO:29, and the nucleotide sequence of the TAG sequence connected to the 5' end of the forward primer Yps-F is shown in SEQ ID NO:30.

[0023] In a second aspect, a 10-fold liquid-phase chip nucleic acid detection kit is provided for the simultaneous detection of Salmonella typhimurium, Tyzer pathogen, Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentii, Helicobacter hepatis, Klebsiella pneumoniae, Staphylococcus aureus, Corynebacterium bovis, and Yersinia pseudotuberculosis. The kit is characterized in that it comprises the above-mentioned 10-fold liquid-phase chip nucleic acid detection primers and TAG probe combination.

[0024] In some embodiments, the kit also includes a positive control, which is a mixture of recombinant plasmids containing the target gene fragments of each pathogen.

[0025] In some embodiments, the kit also includes a negative control, which may optionally be nuclease-free water.

[0026] Thirdly, the application of the aforementioned 10-fold liquid-phase chip nucleic acid detection primer and TAG probe combination or the aforementioned 10-fold liquid-phase chip nucleic acid detection kit in the same system for the non-disease diagnostic purposes also falls within the scope of this invention. These applications may include: quality control and grade monitoring of laboratory animal microorganisms, inspection of intermediate and final products in the production process of biological products, environmental monitoring of laboratory animal facilities, pathogen screening in scientific research, quarantine of imported and exported laboratory animals, and efficacy evaluation of veterinary drugs or feed additives.

[0027] Fourthly, a 10-fold liquid-phase chip nucleic acid detection method is provided for the simultaneous detection of Salmonella Typhimurium, Tyzer pathogen, Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentii, Helicobacter hepatica, Klebsiella pneumoniae, Staphylococcus aureus, Corynebacterium bovis, and Yersinia pseudotuberculosis for non-disease diagnostic purposes. This method includes: performing multiplex PCR amplification on genomic DNA extracted from the sample to be tested using the aforementioned 10-fold liquid-phase chip nucleic acid detection primer and TAG probe combination or the aforementioned 10-fold liquid-phase chip nucleic acid detection kit; hybridizing the amplification product with microspheres conjugated with corresponding anti-TAG sequences; and detecting the fluorescence signal using a liquid-phase chip system to qualitatively detect the 10 pathogens.

[0028] In some implementations, the method includes the following steps:

[0029] (1) Multiplex PCR amplification: Using the genomic DNA of the sample to be tested as a template, multiplex PCR amplification is performed using the 10-fold liquid phase chip nucleic acid detection primers as described in any one of claims 1-3, wherein the final concentration of the upstream and downstream primers for Klebsiella pneumoniae, Pseudomonas aeruginosa, Tyzer pathogen, Klebsiella pneumoniae, Staphylococcus aureus, Yersinia pseudotuberculosis and Salmonella typhimurium is preferably 0.2 µmol / L, and the final concentration of the upstream and downstream primers for Citrobacter dentata, Corynebacterium bovis and Helicobacter hepatis is preferably 0.1 µmol / L;

[0030] (2) Hybridization incubation: The PCR product obtained in step (1) is mixed with the working solution of streptavidin phycoerythrin conjugate and a mixture containing 10 kinds of microspheres for hybridization incubation;

[0031] (3) Result detection and judgment: The fluorescence signal is detected using a liquid phase chip system, and the result is judged by the median value of fluorescence.

[0032] In some implementations, the reaction procedure for multiplex PCR amplification in step (1) includes: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 57°C for 90 s, extension at 72°C for 30 s, for a total of 35 cycles; and extension at 68°C for 10 min.

[0033] In some embodiments, the method has a detection sensitivity of 10 copies / μL for Helicobacter hepatis, 100 copies / μL for Salmonella, Pseudomonas aeruginosa, Corynebacterium bovis, Citrobacter dentata, and Staphylococcus aureus, and a detection sensitivity of 1×10⁻⁶ copies / μL for Klebsiella pneumoniae, Tyzer pathogen, Klebsiella pneumoniae, and Yersinia pseudotuberculosis. 3 copies / μL.

[0034] Compared with the prior art, the present invention has the following characteristics:

[0035] 1. For the first time, simultaneous detection of all 10 types of intestinal pathogens in laboratory animals as specified in GB14922-2022 has been achieved: This fills the gap in the field of LuminexxTAG technology for the 10-fold detection of intestinal bacterial pathogens in laboratory animals and provides a complete technical solution for the quality control of laboratory animals.

[0036] 2. High sensitivity and high specificity: The method exhibits a detection sensitivity of 10 copies / μL for Helicobacter hepatis, 100 copies / μL for Salmonella, Pseudomonas aeruginosa, Corynebacterium bovis, Citrobacter dentata, and Staphylococcus aureus, and a detection sensitivity of 1×10⁻⁶ copies / μL for Klebsiella pneumoniae, Tyzer pathogens, Klebsiella pneumoniae, and Yersinia pseudotuberculosis. 3 copies / μL.

[0037] 3. High throughput and high efficiency: 10 pathogens can be detected in a single reaction, the detection time is shortened to less than 4 hours, and the sample volume and reagent cost are significantly reduced.

[0038] 4. Good repeatability: The coefficient of variation (CV) within each group is less than 15%.

[0039] 5. The compatibility problem between high GC content pathogens (Corynebacterium bovis) and low GC content pathogens was solved: amplification uniformity was achieved by optimizing primer concentration and reaction conditions. Attached Figure Description

[0040] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0041] Figure 1 Electrophoresis images of target fragments from 10 target pathogens. Detailed Implementation

[0042] The technical solution of the present invention will be clearly and completely described below with reference to embodiments. It should be noted that, unless otherwise specified, the embodiments and features in the embodiments of the present invention can be combined with each other. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0043] The methods for obtaining various biological materials described in the embodiments are merely to provide experimental methods for specific disclosure purposes and should not be construed as limiting the sources of biological materials used in this invention. In fact, the sources of biological materials used are wide-ranging, and any biological material that can be obtained without violating laws and ethical standards can be substituted and used according to the suggestions in the embodiments.

[0044] Both the primers and probes used can be synthesized using existing techniques.

[0045] Materials used in the following embodiments:

[0046] 1.1 Microbial strains

[0047] Salmonella typhimurium (Sty) (CMCC 50115), Clostridium piliforme (Ty) (RJ strain), Klebsiella pneumoniae (Kpn) (ATCC 13883), Pseudomonas aeruginosa (Pa) (ATCC 27853), Citrobacter rodentium (Cro) (ATCC BAA-352), Helicobacter hepaticus (Hh) (ATCC 51449), Klebsiella oxytoca (Kox) (ATCC 13182), Staphylococcus aureus (Sa) (ATCC 25923), Corynebacterium bovis (Cb) (ATCC 50115). Yersinia pseudotuberculosis (Ypt) (CMCC53518), Yersinia enterocolitica (CMCC 52301), Escherichia coli (ATCC 25922), Enterococcus faecalis (CMCC 29212), Shigella sonnei (CMCC 51082), Shigella dysenteriae (CMCC 51252), Proteus vulgaris (CMCC 49101), and Enterobacter cloacae (ATCC 13047) are preserved in this laboratory.

[0048] 1.2 Main Reagents

[0049] Multiplex PCR Plus Kit (QIAGEN), Streptavidin, R-phycoerythrin conjugate (SAPE) (Invitrogen), MagPlex-TAG microspheres (sizes 12, 18, 21, 26, 30, 46, 55, 63, 67 and 72) (Luminex), NaCl (Solarbio), Triton X-100 (Amresco), Tris (Solarbio), HCl (Sinopharm), BSA (Takara), nuclease-free water (Promega), blood agar medium (Oxiod), Genome Extraction Kit (Zhejiang Hanwei Technology Co., Ltd.), TE (Solarbio), Sheath fluid (Luminex), Luminex 200 Calibration Kit (Luminex), Luminex 200 Performance Verification Kit (Luminex), Anhydrous ethanol (Sinopharm), Sterile PBS (Solarbio).

[0050] Primers and probes for quantitative real-time PCR: Primers and probes were designed based on the bacterial 16S rRNA gene. The upstream primer was 5'-TCCTACGGGAGGCAGCAGT-3' (SEQ ID NO:31), the downstream primer was 5'-GGACTACCAGGGTATCTAATCCTGTT-3' (SEQ ID NO:32), and the probe was 5'-(FAM)CGTATTACCGCGGCTGCTGGCAC(BHQ1)-3' (SEQ ID NO:33). They were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0051] The plasmid standards were synthesized based on the target genes of 10 pathogens, using pUC57 as the vector, and were prepared by Sangon Biotech (Shanghai) Co., Ltd.

[0052] 1.3 Instruments and Equipment

[0053] PCR instrument (Hangzhou Baiheng, GE4852T), automated nucleic acid extractor (Boyue, BGNA-32P), real-time PCR instrument (ABI 7500fast), high-throughput liquid chromatography-chip analysis system (Luminex 200).

[0054] Example 1: Design and Synthesis of Primers and TAG Probes

[0055] Literature review and analysis of gene sequences from 10 intestinal pathogens in laboratory animals were conducted to identify specific target genes. Based on the *Salmonella typhimurium* invA gene sequence (GenBank: NC_003197.2), the *Taize pathogen* 16S rRNA gene sequence (GenBank: DQ352810.1), *Klebsiella pneumoniae* rpoB gene sequence (GenBank: ASM24018v2), *Pseudomonas aeruginosa* algD gene sequence (GenBank: ASM676v1), *Citrobacter dentata* EspB gene sequence (GenBank: NZ_CP082833), and *Helicobacter hepatica* 16S rRNA gene sequence published on NCBI, specific target genes were identified. The rRNA gene sequence (GenBank: ASM790v1), the *Klebsiella pneumoniae* pehX gene sequence (GenBank: LR134333.1), the *Staphylococcus aureus* nuc gene sequence (GenBank: ASM1342v1), the *Corynebacterium bovis* gyrB gene sequence (GenBank: ASM393229v1), and the *Yersinia pseudotuberculosis* inv gene sequence (GenBank: 51108_B01) were used to design PCR primers using Primer Premier 6.0 software (Premier Biosoft International), with the target fragment size controlled between 100 and 200. Multiplex primer analysis was performed using the Multiple PrimerAnalyzer (Thermo) tool to analyze the complementary sequences (TAGs) of the primers and TAG microspheres (which carry anti-TAG sequences) to determine the microsphere numbering. A spacer arm, Spacer18 (iSp18), was added between the 5' end of the upstream primer and the TAG (composition: TAG sequence—spacer arm—upstream primer sequence), and biotin was labeled at the 5' end of the downstream primer. The final primers and TAG sequences, determined after screening and validation, are shown in Table 1 and were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0056] Table 1: Primer combinations for 10-fold liquid-phase microarrays of intestinal pathogens in laboratory animals

[0057]

[0058] Example 2: Establishment of a 10-fold liquid phase chip detection method

[0059] 2.1 Genomic DNA Extraction

[0060] Genomic DNA was extracted from the samples using a magnetic bead-based bacterial genomic DNA extraction kit and an automated nucleic acid extractor. Amplification was performed using quantitative real-time PCR, and the concentration of the extracted DNA was calculated using the Ct value.

[0061] The extracted genomic DNA copy number concentration was calculated based on the copy number of the target gene contained in the genomes of 10 pathogens, and the actual nucleic acid concentration was estimated (as a reference for simulated positive results). The genomic DNA was diluted with TE buffer to adjust the concentration to approximately 10. 4 Copies / μL, concentrations are shown in Table 2.

[0062] Table 2: Genomic DNA concentrations of 10 pathogens in this study

[0063]

[0064] 2.2 Multiplex PCR amplification

[0065] The multiplex PCR reaction system was set to 30 μL. Taking Qiagen's multiplex PCR reagent as an example, it consisted of the following components: 15 μL of 2×Multiplex PCR Mix, 0.1 μmol / L of upstream and downstream primers for three pathogens (Citrobacter dentata, Corynebacterium bovis, and Helicobacter hepatis), 0.2 μmol / L of upstream and downstream primers for the other seven pathogens, 1 μL of template DNA, and nuclease-free water to a final volume of 30 μL.

[0066] Amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 57℃ annealing for 90 s, 72℃ extension for 30 s, for a total of 35 cycles; and finally 68℃ extension for 10 min.

[0067] PCR product electrophoresis: used to verify PCR amplification efficiency and determine the optimal annealing temperature. Mix 5 μL of PCR product with 1 μL of loading buffer and load the sample onto a 1.0% agarose gel. Electrophoresis should be performed at a constant voltage of 100V for 40 min. Each electrophoresis session should include a DNA relative molecular weight standard, a positive control, and a negative control on the same gel.

[0068] Ten pathogen genomic DNAs were added to a 10-fold reaction system for amplification. The PCR products were verified by electrophoresis to determine the size of the target fragments of each pathogen. Figure 1 As shown, lanes 1 and 12 represent 100bp DNA markers, and lanes 2-11 represent Salmonella Typhimurium, Tyzer pathogen, Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentii, Helicobacter hepatis, Klebsiella pneumoniae, Staphylococcus aureus, Corynebacterium bovis, and Yersinia pseudotuberculosis, respectively.

[0069] 2.3 PCR product hybridization detection

[0070] (1) Reagent preparation:

[0071] 1×TMAC hybridization buffer: 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH adjusted to 8.0 with HCl.

[0072] SAPE working solution: Dilute the SAPE stock solution (1 mg / mL) 100 times with 1×TMAC hybridization buffer to 10 μg / mL, and add BSA to make the final concentration in 100 μL hybridization system 0.1%. Prepare fresh before use and keep away from light.

[0073] Microsphere mixture: The concentration of the MagPlex-TAG microsphere stock solution is 2.5 × 10⁻⁶. 6 Take 1 μL of each of the 10 types (12, 18, 21, 26, 30, 46, 55, 63, 67 and 72) and add them to 10 μL of 1×TMAC hybridization buffer. Mix well until the final concentration of each microsphere is 125 microspheres / μL. Store in the dark.

[0074] (2) Hybridization and incubation:

[0075] Hybridization system 100μL: 75μL SAPE working solution, 20μL microsphere mixture, 5μL multiplex PCR product, mix well, and incubate at 45℃ for 30min in a PCR instrument.

[0076] (3) Result Interpretation:

[0077] Analysis was performed using a Luminex 200 liquid chromatography-mass spectrometry (LC-MS) system. The incubation products were analyzed using the LC-MS system, and the fluorescence signal of the microspheres corresponding to each pathogen was read. The results were reported as the median fluorescent intermediate (MFI) value of the microspheres. In the Luminex 200 LC-MS xPONENT software, the microsphere type was set to MagPlex, the sample volume per well was 50 μL, and the minimum number of microspheres read was no less than 100. A negative control using water as a template was included in each experiment. The average MFI value of the negative control was used as a reference. The MFI value of the negative control should be less than 300. A positive result for the corresponding pathogen was defined as follows: the MFI value of the microspheres corresponding to each pathogen was greater than or equal to three times that of the negative control and also greater than 300. Otherwise, the result was negative.

[0078] Example 3: Methodological Performance Evaluation

[0079] 3.1 Sensitivity Test

[0080] Ten pathogenic plasmid standard DNA samples (using pUC57 as the vector) were serially diluted 10-fold to a concentration of 1×10⁻⁶. 5Single plasmid templates at six dilutions, ranging from copies / μL to 1 copy / μL, were used for multiplex PCR amplification, with sterile water as a negative control, to evaluate the sensitivity of the reaction system when amplifying each single plasmid template. Simultaneously, the 10 plasmids were diluted together to a concentration of 1×10⁻⁶. 5 Six dilutions of mixed plasmid templates, ranging from 1 copy / μL to 1 copy / μL (concentration of each plasmid standard), were used for three replicate detections according to the method in Example 2. The results are shown in Table 3. It can be seen that when detecting 10 mixed plasmids, this method achieves a detection sensitivity of 10 copies / μL for *Helicobacter hepatis*, 100 copies / μL for *Salmonella*, *Pseudomonas aeruginosa*, *Corynebacterium bovis*, *Citrobacter dentata*, and *Staphylococcus aureus*, and a detection sensitivity of 1×10⁻⁶ copies / μL for *Klebsiella pneumoniae*, Tyzer's pathogen, *Klebsiella pneumoniae*, and *Yersinia pseudotuberculosis*. 3 copies / μL.

[0081] Table 3: Results of template sensitivity tests for 10 mixed plasmids (MFI values)

[0082]

[0083] 3.2 Specificity Test

[0084] Sterile water was used as a negative control (NC-1 and NC-2). The following bacteria were tested: Salmonella Typhimurium (CMCC 50115), Tyzer pathogen (RJ strain), Klebsiella pneumoniae (ATCC 13883), Pseudomonas aeruginosa (ATCC 27853), Citrobacter rodentii (ATCC BAA-352), Helicobacter hepatica (ATCC 51449), Klebsiella pneumoniae (ATCC 13182), Staphylococcus aureus (ATCC 25923), Corynebacterium bovis (ATCC 7715), Yersinia pseudotuberculosis (CMCC 53518), Yersinia enterocolitica (CMCC 52301), Escherichia coli (ATCC 25922), Enterococcus faecalis (CMCC 29212), Shigella sonnei (CMCC 51082), Shigella dysenteriae (CMCC 51252), and Proteus vulgaris (CMCC 50115). DNA from 17 reference strains, including *Enterobacter cloacae* (ATCC 13047) and *Enterobacter 49101*, was used as templates for specificity verification. The results are shown in Table 4. No non-specific reactions were observed; all target bacteria were positive, and all non-target bacteria were negative. Furthermore, the MFI values ​​were all less than 100, indicating good specificity of this method.

[0085] Table 4: Specificity test results (MFI value)

[0086]

[0087] 3.3 Repeatability Test

[0088] 1×10⁻¹¹ plasmids containing 10 pathogens were serially diluted 10-fold. 5 copies / μL, 1×10 4 copies / μL and 1×10 3 Three dilutions (copies / μL) were used as templates, with nuclease-free water as a negative control. PCR was performed, and detection was conducted using a liquid chromatography-array system. Both inter- and intra-group experiments were repeated three times to evaluate the reproducibility of the reaction system. The results are shown in Tables 5 and 6. The coefficient of variation (CV) for each MFI value was less than 15%, indicating good reproducibility of this method.

[0089] Table 5: Results of within-group repeatability trials (CV%)

[0090]

[0091] Table 6: Results of intergroup repeatability trials (CV%)

[0092]

[0093] 3.4 Simulated positive sample detection

[0094] The extracted nucleic acids of 10 pathogens were mixed (as shown in Table 7 below) and detected using the established 10-fold liquid chromatography-array method to verify the effectiveness of the method. The results were completely consistent with the settings (Table 8), indicating that this method can accurately identify single and mixed infections in samples. It should be noted that as the number of target nucleic acid types increased, the MFI values ​​of each target decreased to varying degrees, but this did not affect the final detection results.

[0095] Table 7: Multiple Combinations of Nucleic Acids from 10 Pathogens

[0096]

[0097] Table 8: Results of multiplex nucleic acid simulation detection (partial, MFI values)

[0098]

[0099] Example 4: Application in actual sample testing

[0100] Ten cecal contents samples were collected from SPF-grade mice, rats, guinea pigs, and rabbits. Genomic DNA was extracted using a magnetic bead method and used as samples. The 10-fold liquid chromatography-array method established in this study was employed for detection. A positive control (PC) containing mixed genomic DNA of 10 pathogens and a sterile water negative control (NC) were also included. The test samples were compared and tested according to relevant standards. The methods used for each pathogen are shown in Table 9.

[0101] Table 9: Comparison of Detection Methods

[0102]

[0103] This 10-fold detection method was used to detect genomic DNA in the cecal contents of mice, rats, guinea pigs, and rabbits. With controls established, three mouse and three rat samples tested positive for Tyzer pathogen nucleic acid, while ELISA did not detect it. Two rat samples showed positive results for Helicobacter hepatitis, consistent with quantitative real-time PCR. No other target bacteria were detected. See Table 10.

[0104] Table 10: Detection Results of the Application of the Heavy Liquid Phase Chip Method

[0105]

[0106] In summary, this invention can simultaneously detect 1 to 10 enteric pathogens, including Salmonella, Tyzer pathogens, Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentii, Helicobacter hepatica, Klebsiella pneumoniae, Staphylococcus aureus, Corynebacterium bovis, and Yersinia pseudotuberculosis. It maintains high sensitivity and specificity even when detecting 10 pathogens simultaneously, simplifies multiple single-indicator detections into a single multiplex detection, shortens the detection cycle, reduces sample volume and reagent costs, avoids the risk of cross-contamination caused by multiple operations, and greatly improves detection efficiency.

[0107] Comparison Example 1: Comparison of different target gene selections

[0108] Based on existing technologies (Reference 1: CN108004338A; Reference 2: Lü Dongyue et al. Establishment and application of rapid screening method for 7 common foodborne pathogens using xMAP liquid phase chip [J]. Journal of Health Research, 2012, 41(1): 96-101; Reference 3: Zhu Yanbo et al. Establishment and application of multiplex PCR method for four pathogens in laboratory animals [J]. Chinese Journal of Comparative Medicine, 2017, 27(8): 80-84), the inventors selected publicly available primer sequences from existing technologies and modified them to be suitable for Luminex liquid phase chip technology. The specific sequence information is shown in Table 11 below.

[0109] Table 11: Partial primer sequences in the modified existing technology

[0110]

[0111] After combining the modified pathogen primers from References 1, 2, and 3 with the primers for other pathogens in this invention to form a new 10-fold system, 10-fold liquid-phase chip detection was performed according to the method of Example 2.

[0112] The results are shown in Table 12. The sensitivity for *Salmonella typhimurium* (No. 18) and *Helicobacter hepatica* (No. 72) was 100 copies / μL; the sensitivity for *Taize pathogen* (No. 30) and *Yersinia pseudotuberculosis* (No. 67) reached 10 copies / μL, but non-specific reactions may occur; *Klebsiella pneumoniae* (No. 55) showed a non-specific increase in MFI value, indicating that the introduction of primers from the literature caused system turbulence; the sensitivity for *Klebsiella pneumoniae* (No. 12), *Pseudomonas aeruginosa* (No. 21), *Corynebacterium bovis* (No. 26), and *Citrobacter rodentii* (No. 46) was 1×10⁻⁶. 3 copies / μL; the sensitivity for Staphylococcus aureus (63) is approximately 1×10⁻⁶ copies / μL. 5 The results indicate that the modified 10-fold liquid-phase chip system cannot be used to simultaneously detect 10 kinds of intestinal pathogens in experimental animals. On the one hand, it will cause a decrease in the detection sensitivity of individual pathogens, and on the other hand, it will cause the entire system to be disordered, resulting in non-specific reactions.

[0113] Table 12: Reaction results of the 10-fold detection system after replacement

[0114]

[0115] Comparison Example 2: Comparison of different primer sequences for the same target gene

[0116] In Comparative Example 2, the applicant also optimized and designed another set of primer combinations based on the 16S rRNA of Tyzer pathogen and the rpoB gene sequence of Klebsiella pneumoniae using Primer Premier 6.0 software. The specific sequence information is shown in Table 13 below.

[0117] Table 13: Additional primer sequence information for Taizer pathogen 16S rRNA and Klebsiella pneumoniae rpoB gene

[0118]

[0119] After replacing the primer sets for the 16S rRNA of Taizer pathogen and the rpoB gene of Klebsiella pneumoniae in Table 1 with the primer sets for Taizer pathogen and Klebsiella pneumoniae rpoB gene in Table 13, a new 10-fold liquid phase chip primer combination for experimental animal intestinal pathogens was formed. The specificity test of the simulated positive reference DNA sample was performed according to the 10-fold liquid phase chip detection method established in Example 2. The results are shown in Table 14 below. It can be seen that microspheres No. 12, No. 18, No. 63 and No. 72 all showed different degrees of cross-reactivity, and the MFI value increased nonspecifically.

[0120] Table 14: Results of Detection of Pathogen Genomic DNA After Primer Replacement

[0121]

[0122] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A 10-fold liquid-phase chip nucleic acid detection primer and TAG probe combination, used for the simultaneous detection of Salmonella Typhimurium, Tyzer pathogen, Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentii, Helicobacter hepatis, Klebsiella pneumoniae, Staphylococcus aureus, Corynebacterium bovis, and Yersinia pseudotuberculosis in the same system, characterized in that, The primer and TAG probe combination includes: Primers and TAG probes for detecting Salmonella Typhimurium include: a forward primer Sty-F with a nucleotide sequence as shown in SEQ ID NO:1, a reverse primer Sty-R with a nucleotide sequence as shown in SEQ ID NO:2, and a TAG sequence connected to the 5' end of the forward primer Sty-F that is complementary to the anti-TAG sequence connected to the microspheres. Primers and TAG probes for detecting Taizer pathogens include: a forward primer Ty-F with a nucleotide sequence as shown in SEQ ID NO:3, a reverse primer Ty-R with a nucleotide sequence as shown in SEQ ID NO:4, and a TAG sequence connected to the 5' end of the forward primer Ty-F that is complementary to the anti-TAG sequence connected to the microspheres. Primers and TAG probes for detecting Klebsiella pneumoniae include: a forward primer Kpn-F with a nucleotide sequence as shown in SEQ ID NO:5, a reverse primer Kpn-R with a nucleotide sequence as shown in SEQ ID NO:6, and a TAG sequence connected to the 5' end of the forward primer Kpn-F that is complementary to the anti-TAG sequence connected to the microspheres. Primers and TAG probes for detecting Pseudomonas aeruginosa include: a forward primer Pa-F with a nucleotide sequence as shown in SEQ ID NO:7, a reverse primer Pa-R with a nucleotide sequence as shown in SEQ ID NO:8, and a TAG sequence connected to the 5' end of the forward primer Pa-F that is complementary to the anti-TAG sequence connected to the microspheres. Primers and TAG probes for detecting Citrobacter rotavirus include: a forward primer Cro-F with a nucleotide sequence as shown in SEQ ID NO:9, a reverse primer Cro-R with a nucleotide sequence as shown in SEQ ID NO:10, and a TAG sequence connected to the 5' end of the forward primer Cro-F that is complementary to the anti-TAG sequence connected to the microspheres. Primers and TAG probes for detecting Helicobacter hepatis include: a forward primer Hh-F with a nucleotide sequence as shown in SEQ ID NO:11, a reverse primer Hh-R with a nucleotide sequence as shown in SEQ ID NO:12, and a TAG sequence connected to the 5' end of the forward primer Hh-F that is complementary to the anti-TAG sequence connected to the microspheres; Primers and TAG probes for detecting Klebsiella acidogenic bacteria include: a forward primer Kox-F with a nucleotide sequence as shown in SEQ ID NO:13, a reverse primer Kox-R with a nucleotide sequence as shown in SEQ ID NO:14, and a TAG sequence connected to the 5' end of the forward primer Kox-F that is complementary to the anti-TAG sequence connected to the microspheres. Primers and TAG probes for detecting Staphylococcus aureus include: a forward primer Sa-F with a nucleotide sequence as shown in SEQ ID NO:15, a reverse primer Sa-R with a nucleotide sequence as shown in SEQ ID NO:16, and a TAG sequence connected to the 5' end of the forward primer Sa-F that is complementary to the anti-TAG sequence connected to the microspheres. Primers and TAG probes for detecting Corynebacterium bovis include: a forward primer Cb-F with a nucleotide sequence as shown in SEQ ID NO:17, a reverse primer Cb-R with a nucleotide sequence as shown in SEQ ID NO:18, and a TAG sequence connected to the 5' end of the forward primer Cb-F that is complementary to the anti-TAG sequence connected to the microspheres; Primers and TAG probes for detecting Yersinia pseudotuberculosis include: a forward primer Yps-F with a nucleotide sequence as shown in SEQ ID NO:19, a reverse primer Yps-R with a nucleotide sequence as shown in SEQ ID NO:20, and a TAG sequence connected to the 5' end of the forward primer Yps-F that is complementary to the anti-TAG sequence connected to the microspheres. Furthermore, the 5' ends of the reverse primers Sty-R, Ty-R, Kpn-R, Pa-R, Cro-R, Hh-R, Kox-R, Sa-R, Cb-R, and Yps-R are all labeled with biotin.

2. The 10-fold liquid-phase chip nucleic acid detection primer and TAG probe combination according to claim 1, characterized in that, The 5' ends of the forward primers Sty-F, Ty-F, Kpn-F, Pa-F, Cro-F, Hh-F, Kox-F, Sa-F, Cb-F, and Yps-F are all connected to the corresponding TAG sequences via spacer arms.

3. The 10-fold liquid-phase chip nucleic acid detection primer and TAG probe combination according to claim 1 or 2, characterized in that, The nucleotide sequences of the TAG sequences attached to the 5' end of the forward primer Sty-F are shown in SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28 respectively. As shown in NO:28, the nucleotide sequence of the TAG sequence connected to the 5' end of the forward primer Cb-F is shown in SEQ ID NO:29, and the nucleotide sequence of the TAG sequence connected to the 5' end of the forward primer Yps-F is shown in SEQ ID NO:

30.

4. A 10-fold liquid-phase chip nucleic acid detection kit for the simultaneous detection of Salmonella Typhimurium, Tyzer pathogen, Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentii, Helicobacter hepatis, Klebsiella pneumoniae, Staphylococcus aureus, Corynebacterium bovis, and Yersinia pseudotuberculosis, characterized in that, The kit comprises the 10-fold liquid-phase chip nucleic acid detection primers and TAG probe combination as described in any one of claims 1-3.

5. The 10-fold liquid-phase chip nucleic acid detection kit according to claim 4, characterized in that, The kit also includes a positive control, which is a mixture of recombinant plasmids containing the target gene fragments of each pathogen.

6. The 10-fold liquid-phase chip nucleic acid detection kit according to claim 4 or 5, characterized in that, The kit also includes a negative control, which may optionally be nuclease-free water.

7. The application of the 10-fold liquid-phase chip nucleic acid detection primer and TAG probe combination according to any one of claims 1-3 or the 10-fold liquid-phase chip nucleic acid detection kit according to any one of claims 4-6 for the non-disease diagnostic purpose of simultaneously detecting Salmonella Typhimurium, Tyzer pathogen, Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentii, Helicobacter hepatis, Klebsiella pneumoniae, Staphylococcus aureus, Corynebacterium bovis and Yersinia pseudotuberculosis in the same system.

8. A decaplex liquid-phase chip nucleic acid detection method for simultaneously detecting Salmonella Typhimurium, Tyzer pathogen, Klebsiella pneumoniae, Pseudomonas aeruginosa, Citrobacter rodentii, Helicobacter hepatis, Klebsiella pneumoniae, Staphylococcus aureus, Corynebacterium bovis, and Yersinia pseudotuberculosis for non-disease diagnostic purposes, characterized in that, The method includes: performing multiplex PCR amplification on genomic DNA extracted from the sample to be tested using the 10-fold liquid-phase chip nucleic acid detection primer and TAG probe combination as described in any one of claims 1-3 or the 10-fold liquid-phase chip nucleic acid detection kit as described in any one of claims 4-6; hybridizing the amplification product with microspheres coupled with the corresponding anti-TAG sequence; and detecting the fluorescence signal using a liquid-phase chip system to qualitatively detect 10 pathogens.

9. The method for nucleic acid detection using a 10-fold liquid-phase chip according to claim 8, characterized in that, The method includes the following steps: (1) Multiplex PCR amplification: Using the genomic DNA of the sample to be tested as a template, multiplex PCR amplification is performed using the 10-fold liquid phase chip nucleic acid detection primers as described in any one of claims 1-3, wherein the final concentration of the upstream and downstream primers for Klebsiella pneumoniae, Pseudomonas aeruginosa, Tyzer pathogen, Klebsiella pneumoniae, Staphylococcus aureus, Yersinia pseudotuberculosis and Salmonella typhimurium is preferably 0.2 µmol / L, and the final concentration of the upstream and downstream primers for Citrobacter dentata, Corynebacterium bovis and Helicobacter hepatis is preferably 0.1 µmol / L; (2) Hybridization incubation: The PCR product obtained in step (1) is mixed with the working solution of streptavidin phycoerythrin conjugate and a mixture containing 10 kinds of microspheres for hybridization incubation; (3) Result detection and judgment: The fluorescence signal is detected using a liquid phase chip system, and the result is judged by the median value of fluorescence; Optionally, the reaction procedure for multiplex PCR amplification in step (1) includes: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 s, annealing at 57℃ for 90 s, extension at 72℃ for 30 s, for a total of 35 cycles; and extension at 68℃ for 10 min.

10. The method for nucleic acid detection using a decathione liquid-phase chip according to claim 8 or 9, characterized in that, The method has a detection sensitivity of 10 copies / μL for H. hepaticus, 100 copies / μL for Salmonella, P. aeruginosa, M. bovis, L. delbrueckii, and S. aureus, and 1 x 10 3 copies / μL for K. pneumoniae, T. denticola, K. oxytoca, and Y. pseudotuberculosis.

Images