A primer and probe composition, product and method for detecting candida auris
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUANGDONG PHARMA UNIV
- Filing Date
- 2026-06-30
- Publication Date
- 2026-08-07
AI Technical Summary
其中培养法往往耗时长,易出现假阴/阳结果
Smart Images

Figure CN122521877A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology detection technology, especially the detection of Candida auris, and specifically relates to a primer and probe composition, product and method for detecting Candida auris. Background Technology
[0002] Candida auris is a newly emerging global pathogenic fungus that, since its first report in 2009, has caused outbreaks and endemicities in healthcare facilities in multiple regions. It exhibits strong environmental adaptability and cross-regional transmission capabilities, posing a serious public health challenge. This fungus is associated with high mortality rates, particularly among intensive care patients, where mortality rates can reach 30-60%. High-risk groups include long-term hospitalized patients, immunocompromised individuals, and those receiving broad-spectrum antibiotic treatment.
[0003] Rapid on-site detection of infectious diseases is crucial. Currently, the detection of Candida auris mainly relies on culture-based phenotypic identification and molecular biological methods. Culture methods are often time-consuming and prone to false negative / positive results. Molecular biological methods such as qPCR are commonly used due to their high sensitivity and specificity, but they rely on large, expensive, and sophisticated instruments, require professional operation and complex sample pretreatment, and are time-consuming, posing challenges in remote areas or home testing scenarios. Isothermal amplification techniques, such as conventional loop-mediated isothermal amplification and recombinase polymerase amplification, do not have strict temperature requirements for instruments and can achieve a certain level of sensitivity, but they also suffer from operational complexity, limited throughput and specificity, and long processing times. These factors significantly limit their practical application and large-scale promotion in the field of pathogen detection.
[0004] Therefore, there is a need in this field for a simple, rapid, highly specific, and accurate method for detecting Candida auris that can be used for on-site testing. Summary of the Invention
[0005] Therefore, the purpose of this invention is to provide a primer and probe composition, product, and method for detecting Candida auris.
[0006] To achieve the above objectives, the present invention adopts the following technical solution.
[0007] A first aspect of the present invention is to provide a primer and probe composition for detecting Candida auris, comprising the following primers and probe: an outer primer F3 with the nucleotide sequence shown in SEQ ID NO: 1, an outer primer B3 with the nucleotide sequence shown in SEQ ID NO: 2, an inner primer FIP with the nucleotide sequence shown in SEQ ID NO: 3, an inner primer BIP with the nucleotide sequence shown in SEQ ID NO: 4, a loop primer LF with the nucleotide sequence shown in SEQ ID NO: 5, a loop primer LB with the nucleotide sequence shown in SEQ ID NO: 6, and a probe with the nucleotide sequence shown in SEQ ID NO: 7.
[0008] A second aspect of the invention is the use of the primer and probe composition described above in the preparation of Candida auris detection products.
[0009] In some implementations, the detection product includes a reagent kit and a microfluidic chip.
[0010] A third aspect of the present invention is to provide a kit for detecting Candida auris, the kit containing the primer and probe composition as described above.
[0011] A fourth aspect of the present invention is to provide a microfluidic chip for detecting Candida auris, wherein the reaction chamber of the microfluidic chip contains the primer and probe composition as described above.
[0012] In some embodiments, the reaction chamber of the kit or microfluidic chip also contains Bst DNA polymerase and RNase H II endonuclease.
[0013] A fifth aspect of the present invention is to provide a method for detecting Candida auris for non-disease diagnostic purposes, comprising the following steps: performing loop-mediated isothermal amplification of the DNA sample to be tested using the primer and probe composition as described above, the kit as described above, or the microfluidic chip as described above.
[0014] In some embodiments, the 50 µL reaction system for loop-mediated isothermal amplification comprises the following components at the following concentrations: outer primer F3 0.08 µM~0.11 µM, outer primer B3 0.08 µM~0.11 µM, inner primer FIP 0.64 µM~0.88 µM, inner primer BIP 0.64 µM~0.88 µM, loop primer LF 0.16 µM~0.22 µM, loop primer LB 0.16 µM~0.22 µM, probe 0.16 µM~0.22 µM, Bst DNA polymerase 0.05 U / µL~0.2 U / µL, and RNase H II restriction enzyme 0.01 U / µL~0.04 U / µL.
[0015] In some embodiments, the 50µL reaction system for loop-mediated isothermal amplification further comprises the following components at concentrations: Tris-HCl buffer 10mM~20mM, MgCl2 0.245μM~0.385μM, KCl 2μM~2.75μM, dNTPs 0.7μM~1.19μM, and (NH4)2SO4 0.35μM~0.55μM.
[0016] In some embodiments, the activity ratio of the Bst DNA polymerase to the RNase H II endonuclease is 10:2.
[0017] Compared with the prior art, the present invention has the following beneficial effects.
[0018] Through extensive research and optimization, this invention has discovered a target gene that is highly suitable for the detection of Candida auris with high specificity. This gene exhibits high intraspecific conservation and interspecific differentiation. Further research and screening have yielded a primer and probe composition based on the target gene for loop-mediated isothermal amplification (LAMP), which enables accurate identification of Candida auris, eliminates interference from other common Candida species, and provides high detection specificity and sensitivity.
[0019] Furthermore, this invention optimizes the method for loop-mediated isothermal amplification using the primer and probe composition, particularly by controlling the appropriate enzyme activity ratio of Bst DNA polymerase and RNase H II restriction enzyme in the reaction system. This allows the two enzymes to form optimal synergy under high-intensity amplification conditions, solving the potential interference problem of RNase H II restriction enzyme on LAMP reaction intermediates. The fluorescence signal shows significant enhancement in high-concentration samples approximately 5 minutes after the start of the reaction, much faster than the 20-30 minute start-up time of conventional LAMP. This significantly shortens the detection cycle, enabling rapid screening and early interpretation of Candida auris, improving clinical and field testing efficiency, and meeting the needs of primary healthcare institutions, ports, and remote areas for immediate testing.
[0020] In practical applications, the primer and probe composition of this invention, along with other detection reagents, can be packaged in pre-contained liquid or lyophilized powder form within the independent reaction chamber of a disposable microfluidic chip. During detection, simply add the processed DNA sample to the chip's sample well, complete all fluid operations through a preset centrifugation program, and then place the chip into a portable isothermal fluorescence detector to automatically complete isothermal amplification and real-time signal acquisition. The entire detection method is highly integrated and miniaturized, and the accompanying detector is portable and easy to use, making it ideal for scenarios with limited resources or requiring immediate results, such as primary healthcare institutions, port sites, and bedside testing. From sample addition to obtaining results, it achieves the rapid detection goal of "sample in, result out," providing an efficient technical solution for the detection of Candida auris. Attached Figure Description
[0021] Figure 1 Comparison of detection effects of different Bst DNA polymerase and RNase HII endonuclease activity ratios.
[0022] Figure 2 This is the result of the feasibility verification of the reagent kit of the present invention.
[0023] Figure 3 These are the specificity test results for the kit of this invention.
[0024] Figure 4 The results show the sensitivity detection of the reagent kit of this invention.
[0025] Figure 5 The results of testing real samples using the kit of this invention are shown.
[0026] Figure 6 The results are for the detection of the first set of primer and probe compositions and the second set of primer and probe compositions.
[0027] Figure 7 The results are for the detection of the first and third primer and probe compositions. Detailed Implementation
[0028] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.
[0029] The following description is based on specific implementation methods.
[0030] The centrifugal microfluidic chip used in the following examples is a self-developed chip.
[0031] Example 1
[0032] Screening of detection targets.
[0033] In existing molecular detection of fungi, high copy number repeat sequences such as ITS or 18S / 28S rDNA are commonly used as targets. However, Candida auris and its closely related species, such as Candida sylvatica, have extremely high evolutionary similarity in the rDNA region. Primers designed based on this region are prone to cross-species false positive interference.
[0034] Therefore, this embodiment performed a comparative analysis of the whole genomes of three Candida auris species (GenBank numbers MW463338, CP041945.1, and NC_072818) to obtain a detection target with high intraspecific conservation and interspecific differentiation: the putative protein gene (XM_018317007). For the three highly related Candida auris species, the proportion of identical bases in the putative protein gene (XM_018317007) was 81.05%, 78.11%, and 78.05%, respectively, while the proportions of the ITS gene (LN624638.1) were 84.56%, 84.60%, and 84.03%, respectively, as shown in Table 1. The sequence identity of the putative protein gene among closely related species is generally lower than that of the ITS gene.
[0035] Through whole-genome alignment analysis, this invention abandons high-copy regions that are prone to misdiagnosis and selects a putative protein gene. NCBI alignment verification shows that: firstly, the sequence identity of this putative protein gene is as high as 98% among different lineages within the Candida auris species, exhibiting extremely strong intraspecific conservation and ensuring stable coverage of all prevalent lineages; secondly, it addresses the pain point of cross-reaction among closely related species. The highest homology between this target and closely related species such as Candida simulans is only 78%, with significant interspecific differences, thus avoiding cross-reaction from the source.
[0036] Table 1
[0037] Example 2
[0038] This embodiment provides a Candida auris detection kit, using the putative protein gene (XM_018317007) from Example 1 as the detection target. The kit contains the following components: (1) Primer and probe composition: outer primer F3 with nucleotide sequence as shown in SEQ ID NO: 1, outer primer B3 with nucleotide sequence as shown in SEQ ID NO: 2, inner primer FIP with nucleotide sequence as shown in SEQ ID NO: 3, inner primer BIP with nucleotide sequence as shown in SEQ ID NO: 4, loop primer LF with nucleotide sequence as shown in SEQ ID NO: 5, loop primer LB with nucleotide sequence as shown in SEQ ID NO: 6, and probe P with nucleotide sequence as shown in SEQ ID NO: 7.
[0039] F3: CCATGCTAACCCTGAAACT (SEQ ID NO: 1); B3: CGAAGATACCACAACAACC (SEQ ID NO: 2); FIP: GGCCTTGGAGATGACACCATTTTTGTCGCTTTTGGTGCTC (SEQ ID NO: 3); BIP: CTCCTGTTGGTTTGGTTAAGGTCAGTTGCGTGCAGACGAAGG (SEQ ID NO: 4); LF: GCAAGCTCAGTAGCCTGGT (SEQ ID NO: 5); LB: TTCCATTTGCTCAAGAACACT (SEQ ID NO: 6); P: CCTTTCGCATTTACTCAAGAACACT (SEQ ID NO: 7).
[0040] The working principle of primers is as follows: (1) The outer primers F3 / B3 are complementary to the F3c / B3c regions of the target gene, respectively, and serve as the amplification initiation sites; the 3' ends of the inner primers FIP / BIP are complementary to the F2c / B2c regions of the target gene, respectively, and the 5' ends are homologous to the F1c / B1c regions of the target gene, respectively, and the cyclic amplification of the target gene fragment is initiated by the strand displacement action of Bst DNA polymerase. (2) The loop primer LF / LB anneals to the loop region between F1-F2 and B1-B2 of the target gene, and binds to the single-stranded loop structure formed during the amplification process, initiating a new strand substitution reaction and accelerating the amplification efficiency. (3) Bst DNA polymerase is used to perform isothermal amplification of Candida auris DNA as a template, and RNase HII endonuclease cuts the probe to achieve indirect amplification of DNA target and signal amplification.
[0041] The working principle of the probe is as follows: (1) When there is no target, the probe has a single-chain structure, the fluorescent group and the quenching group are closely adjacent, and no fluorescent signal is released; (2) When there is a target, the amplification product and the probe sequence are completely complementary and hybridize to form a DNA-RNA hybrid double strand. The RNaseHI enzyme specifically recognizes the ribonucleotides in the hybrid double strand and cuts the phosphodiester bond adjacent to its 5' end. (3) After the probe is cut, the fluorescent group and the quenching group separate, releasing a fluorescent signal; at the same time, the melting temperature of the cut probe fragment decreases, and it dissociates from the target single chain. The target single chain can re-bind a new complete probe, start the next round of cutting cycle, and achieve exponential signal amplification. (4) Since RNase HII endonuclease only recognizes perfectly complementary heterozygous double strands, non-target sequences cannot form effective heterozygous double strands with the probe, so no fluorescent signal is generated, ensuring detection specificity.
[0042] Primer and probe compositions can be prepared as shown in Table 2 for later use: Table 2
[0043] (2) Buffer components: Tris-HCl buffer, MgCl2, KCl, dNTPs, (NH4)2SO4.
[0044] The buffer components can be configured as shown in Table 3 for later use: Table 3
[0045] (3) Enzyme system components: Bst DNA polymerase and RNase H II endonuclease.
[0046] The enzyme system components can be prepared as shown in Table 4 for later use: the volume ratio of Bst DNA polymerase to RNase H II endonuclease is 5:1, and the corresponding enzyme activity ratio is 10:2.
[0047] Table 4
[0048] The method for testing using the above-mentioned kit is as follows: The amplification system is configured as shown in Table 5: Table 5
[0049] That is, the loop-mediated isothermal amplification reaction system (50 μL) contains components at the following concentrations: the outer primer F3 at 0.096 μM, the outer primer B3 at 0.096 μM, the inner primer FIP at 0.768 μM, the inner primer BIP at 0.768 μM, the loop primer LF at 0.192 μM, the loop primer LB at 0.192 μM, the probe at 0.192 μM, the Bst DNA polymerase at 0.2 U / μL, the RNase H II endonuclease at 0.04 U / μL, Tris-HCl buffer at 10 mM, MgCl2 at 0.245 μM, KCl at 2 μM, dNTPs at 0.7 μM, and (NH4)2SO4 at 0.35 μM. The volume ratio of the Bst DNA polymerase to the RNase H II endonuclease is 5:1, and the corresponding enzyme activity ratio is 10:2.
[0050] Amplification reaction procedure: The reaction temperature is set at 60 - 65°C (optimal at 65°C), and the reaction time is 30 - 60 min (optimal at 40 min). Fluorescence signals are collected starting from when the reaction system reaches the preset temperature, and the fluorescence signals are collected every 0.2 s. [[ID=[4]]
[0051] The result judgment criteria are as follows: If Tt ≤ 30, the LAMP test result is determined to be positive; If Tt > 40, the LAMP test result is determined to be negative; If 30 < Tt ≤ 40, the LAMP result is determined to be suspicious and needs to be retested; After re - testing the suspicious results, if Tt < 40, the LAMP test result is determined to be positive, otherwise it is determined to be negative.
[0052] This example also studied the influence of the composition of the detection reaction system on the detection effect and found that the enzyme activity ratio of Bst DNA polymerase and RNase H II endonuclease in the reaction system will significantly affect the starting time of the fluorescence signal.
[0053] Using the Candida auris nucleic acid standard as the detection sample, three groups of enzyme activity ratios of Bst DNA polymerase and RNase H II endonuclease are set: 6:2 (volume ratio of 3:1), 10:2 (volume ratio of 5:1), and 14:2 (volume ratio of 7:1), and at the same time, a blank sample is used as a control (NTC). Except for the enzyme activity ratio, other components of each reaction system are the same as above; the detection method is the same as above.
[0054] The results are as Figure 1As shown, when the enzyme activity ratio of Bst DNA polymerase to RNase H II restriction enzyme in the reaction system is 10:2 (volume ratio 5:1), the two enzymes can form optimal synergy under high-intensity amplification conditions, solving the potential interference problem of RNase H II restriction enzyme on LAMP reaction intermediates. The fluorescence signal shows a significant enhancement about 5 minutes after the start of the reaction, much faster than the 20-30 minute onset time of conventional LAMP. When the enzyme activity ratio is 6:2, the Bst polymerase activity is insufficient, the amplification efficiency is reduced, the fluorescence onset time is delayed to about 6 minutes, the endpoint fluorescence intensity is slightly lower than that of the 10:2 group, and RNase H II is relatively excessive, and the interference of LAMP intermediates is not sufficiently suppressed. When the enzyme activity ratio is 14:2, although the onset time is earlier, the background signal increases and the signal-to-noise ratio decreases, the onset is still later than that of the 10:2 group, and the endpoint signal is also slightly lower. At a 10:2 enzyme activity ratio, the fluorescence signal showed a significant enhancement in approximately 5 minutes, exhibiting the fastest onset, highest endpoint fluorescence, and optimal signal-to-noise ratio. This indicates that this ratio enables the two enzymes to achieve optimal synergy during high-intensity amplification, efficiently driving amplification while minimizing potential interference from RNase H II on reaction intermediates. Therefore, the 10:2 enzyme activity ratio demonstrates clear advantages in both onset speed and amplification efficiency, representing the optimal enzyme activity ratio for balancing amplification performance and enzyme interference control.
[0055] Example 3: Feasibility Verification of the Reagent Kit Use concentration of 10 8 Feasibility testing was conducted on Candida auris DNA standards at a ratio of copies / mL.
[0056] Using the kit components and detection system described in Example 1, the prepared detection system and the template to be tested were added to the sample wells of the centrifugal microfluidic chip, and then the chip was placed in its nucleic acid amplification analysis device for detection. The operating procedure was: 1200 rpm for 30 seconds, followed by 3700 rpm for 90 seconds; incubation at 65°C for 45 minutes.
[0057] The results are as follows Figure 2 As shown, under isothermal reaction conditions of 65℃, a significant increase in fluorescence signal was observed in the positive reaction wells containing Candida auris DNA template approximately 5 minutes after the start of the reaction. The fluorescence curve exhibited an S-shaped increase and far exceeded the NTC threshold.
[0058] Example 4 Specificity Test
[0059] The Candida auris quality control sample (BNCC391280, concentration (2.4±0.6)×10⁻⁶) was used. 5 The positive sample was identified as copies / mL, and *Candida dulcis* (BNCC379538, concentration 1×10⁻⁶) was used as the sample. 8CFU / mL), Candida albicans (BNCC preserved strain, concentration 1×10⁻⁶). 8 CFU / mL), Candida albicans (BNCC186382, concentration 1×10⁻⁶) 8 CFU / mL), Candida tropicalis (BNCC119734, concentration 1×10⁻⁶) 8 CFU / mL), Candida glabrata (BNCC363170, concentration 1×10⁻⁶) 8 Five closely related bacterial control samples (CFU / mL) were used as negative controls for microfluidic detection.
[0060] Using the kit components and detection system described in Example 1, the prepared detection system and the test template were added to the sample wells of the centrifugal microfluidic chip, and then the chip was placed in its nucleic acid amplification analysis device for detection. The operating procedure was: 1200 rpm for 30 seconds, followed by 3700 rpm for 90 seconds; incubation at 65°C for 45 minutes.
[0061] The result is as follows Figure 3 As shown, only the *Candida auris* sample showed a significant increase in fluorescence signal within 30 minutes, indicating a strong positive result. In contrast, no amplification signal was observed in other closely related bacteria or clinically common *Candida* species after 45 minutes of reaction, and the fluorescence curve remained flat, indicating a negative result.
[0062] Example 5: Detection Limit Test
[0063] Based on the sensitivity measured on the qPCR instrument, the lowest detection limits were set at 0.2×, 0.5×, 1×, 2× and 4×.
[0064] Candida auris DNA standards were used at concentrations of 500 copies / mL, 1000 copies / mL, 5000 copies / mL, and 10000 copies / mL. Using the kit and detection system described in Example 1, the prepared detection system and the test template were added to the sample wells of a centrifugal microfluidic chip, which was then placed in its nucleic acid amplification analysis device for detection. The operating procedure was: 1200 rpm for 30 seconds, followed by 3700 rpm for 90 seconds; incubation at 65°C for 45 minutes.
[0065] The result is as follows Figure 4As shown, at four concentration gradients (500 copies / mL, 1000 copies / mL, 2500 copies / mL, 5000 copies / mL, and 10000 copies / mL), a typical "S"-shaped fluorescence growth curve was consistently observed at concentrations of 5000 copies / mL and 10000 copies / mL. The Tt value increased significantly with increasing template concentration and remained within the judgment range. Although this value is slightly higher than the minimum sensitivity of the qPCR instrument (2500 copies / mL), it is sufficient for rapid screening and preliminary diagnosis given the pathogen load levels commonly found in clinical ear swab samples.
[0066] Example 6: Real Sample Testing Twelve clinical ear swab samples were selected and tested using the method of this invention and a commercial qPCR kit on an ABI 7500 qPCR instrument. The positive concordance rate between the method of this invention and the qPCR method was calculated based on the qPCR instrument results.
[0067] Nucleic acid was extracted from ear swab samples using nucleic acid extraction buffer. Using the kit and detection system described in Example 1, the prepared detection system and the test template were added to the sample wells of a centrifugal microfluidic chip. The chip was then placed in its amplification and analysis device for detection. The operating procedure was: 1200 rpm for 30 seconds, followed by 3700 rpm for 90 seconds; incubation at 65°C for 45 minutes. Parallel control experiments were performed using the same nucleic acid samples on an ABI 7500 real-time PCR instrument as a baseline reference.
[0068] The results are as follows Figure 5 As shown in Table 6, through parallel testing of 12 clinical ear swab samples, the kit of this invention was able to detect all positive samples within 20 minutes at its fastest. Compared with the traditional qPCR method, the positive concordance rate was 100%, and the negative concordance rate was 100%. Among them, 7 positive samples were detected within 10 minutes, and 1 positive sample was detected at 20 minutes, while the detection time of the traditional qPCR method was 1.5-2 hours.
[0069] Table 6
[0070] The results show that the LAMP detection kit for Candida auris provided by this invention can be used for the real-time detection of clinical samples. Its ease of operation and accuracy provide an efficient technical means for infection control in medical institutions.
[0071] Example 7
[0072] After studying and analyzing the hypothetical protein gene (XM_018317007) as the detection target, a large number of primers and probes were designed for it. Finally, the primer and probe composition with high detection specificity of the present invention was obtained through screening. The following groups are used as examples for illustration.
[0073] First set of primer and probe compositions F3: CCATGCTAACCCTGAAACT (SEQ ID NO: 1); B3: CGAAGATACCACAACAACC (SEQ ID NO: 2); FIP: GGCCTTGGAGATGACACCATTTTTGTCGCTTTTGGTGCTC (SEQ ID NO: 3); BIP: CTCCTGTTGGTTTGGTTAAGGTCAGTTGCGTGCAGACGAAGG (SEQ ID NO: 4); LF: GCAAGCTCAGTAGCCTGGT (SEQ ID NO: 5); LB: TTCCATTTGCTCAAGAACACT (SEQ ID NO: 6); P: CCTTTCGCATTTACTCAAGAACACT (SEQ ID NO: 7).
[0074] Second set of primer and probe compositions F3: CCATGCTAACCCTGAAACT (SEQ ID NO: 9); B3: CGAAGATACCACAACAACC (SEQ ID NO: 10); FIP: GGCCTTGGAGATGACACCATTTTTGTCGCTTTTGGTGCTC (SEQ ID NO: 11); BIP: CTCCTGTTGGTTTGGTTAAGGTCAGTTGCGTGCAGACGAAGG (SEQ ID NO: 12); LF: GCAAGCTCAGTAGCCTGGT (SEQ ID NO: 13); LB: TTCCATTTGCTCAAGAACACT (SEQ ID NO: 14); P: CCTTTCGCATTTACTCAAGAACACT (SEQ ID NO: 7).
[0075] The third set of primer and probe compositions F3: CCATGCTAACCCTGAAACT (SEQ ID NO: 1); B3: CGAAGATACCACAACAACC (SEQ ID NO: 2); FIP: GGCCTTGGAGATGACACCATTTTTGTCGCTTTTGGTGCTC (SEQ ID NO: 3); BIP: CTCCTGTTGGTTTGGTTAAGGTCAGTTGCGTGCAGACGAAGG (SEQ ID NO: 4); LF: GCAAGCTCAGTAGCCTGGT (SEQ ID NO: 5); LB: TTCCATTTGCTCAAGAACACT (SEQ ID NO: 6); P: TGAGCACCAAAAGCGACAAAA (SEQ ID NO: 8).
[0076] The above primer and probe combinations were used to dilute the Candida auris DNA standard (catalog number: BNCC391282) to 10⁻⁶. 6 The samples were tested at copies / mL, and the detection system and procedure were the same as in Example 1.
[0077] like Figure 6 As shown, both the first and second primer and probe combinations, as well as the positive controls, exhibited standard "S"-shaped amplification curves, demonstrating good amplification rates and efficacy. The negative control using the first primer and probe combination (C. Auris 1) maintained a flat baseline throughout the 45-minute reaction period, while the negative control using the second primer and probe combination (C. Auris 2) showed a significant non-specific amplification signal at 19 minutes. This non-specific amplification is typically associated with primer dimer formation or interference from complex secondary structures, and in highly sensitive clinical detection, it can easily lead to false positive results.
[0078] like Figure 7As shown, C. Auris1-P2 (the third set of primer and probe composition) exhibited an extremely early positive amplification peak and strong fluorescence signal. However, its template-free control also showed a significant and early amplification curve, confirming a serious risk of false positives in this group. In contrast, the positive amplification curve of C. Auris1-P1 (the first set of primer and probe composition) was normal and reached the plateau phase, with its corresponding NTC maintaining a stable baseline without any signal, indicating good specificity and no false positive interference. This demonstrates that the primer and probe composition of the present invention not only has a strong positive signal but also extremely low NTC background.
[0079] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.
Claims
1. A primer and probe composition for detecting Candida auris, characterized in that, It contains the following primers and probes: outer primer F3 with nucleotide sequence as shown in SEQ ID NO: 1, outer primer B3 with nucleotide sequence as shown in SEQ ID NO: 2, inner primer FIP with nucleotide sequence as shown in SEQ ID NO: 3, inner primer BIP with nucleotide sequence as shown in SEQ ID NO: 4, loop primer LF with nucleotide sequence as shown in SEQ ID NO: 5, loop primer LB with nucleotide sequence as shown in SEQ ID NO: 6, and probe with nucleotide sequence as shown in SEQ ID NO:
7.
2. The use of the primer and probe composition as described in claim 1 in the preparation of Candida auris detection products.
3. The application as described in claim 2, characterized in that, The testing products include reagent kits and microfluidic chips.
4. A kit for detecting Candida auris, characterized in that, The kit contains the primer and probe composition as described in claim 1.
5. A microfluidic chip for detecting Candida auris, characterized in that, The reaction chamber of the microfluidic chip contains the primer and probe composition as described in claim 1.
6. The kit as described in claim 4 or the microfluidic chip as described in claim 5, characterized in that, The reaction chamber of the kit or microfluidic chip also contains Bst DNA polymerase and RNase H II endonuclease.
7. A method for detecting Candida auris for non-disease diagnostic purposes, characterized in that, Includes the following steps: Loop-mediated isothermal amplification of the DNA sample to be tested is performed using the primer and probe composition as described in claim 1, the kit as described in claim 4, or the microfluidic chip as described in claim 5.
8. The detection method as described in claim 7, characterized in that, The 50µL reaction system for loop-mediated isothermal amplification contains the following components at the following concentrations: outer primer F3 0.08µM~0.11µM, outer primer B3 0.08µM~0.11µM, inner primer FIP 0.64µM~0.88µM, inner primer BIP 0.64µM~0.88µM, loop primer LF 0.16µM~0.22µM, loop primer LB 0.16µM~0.22µM, probe 0.16µM~0.22µM, Bst DNA polymerase 0.05 U / µL~0.2U / µL, and RNase H II restriction enzyme 0.01U / µL~0.04 U / µL.
9. The detection method as described in claim 8, characterized in that, The 20µL reaction system for loop-mediated isothermal amplification also contains the following components at the following concentrations: Tris-HCl buffer 10mM~20mM, MgCl2 0.245μM~0.385μM, KCl 2μM~2.75μM, dNTPs 0.7μM~1.19μM, and (NH4)2SO4 0.35μM~0.55μM.
10. The detection method as described in claim 8 or 9, characterized in that, The ratio of Bst DNA polymerase to RNase H II endonuclease activity is 10:2.