A molecular marker related to seed drought seedling establishment ability of brassica napus and application thereof

Abstract

The application discloses a molecular marker related to seed drought-resistance seedling forming capacity of Brassica napus and application thereof, and belongs to the technical field of plant molecular breeding. The molecular marker is located in the promoter region of a BnaFAD3.A4 gene on an A4 chromosome of the Brassica napus, and has the nucleotide sequence shown in SEQ ID NO. 1. The application further provides a primer pair for specifically amplifying a DNA fragment containing the molecular marker, a method and a kit for identifying the seed drought-resistance seedling forming capacity of the Brassica napus. The seed drought-resistance seedling forming capacity of the Brassica napus is determined by detecting whether the molecular marker is contained in the seed genomic DNA of the Brassica napus to be tested. The molecular marker provided by the application has high genetic stability and is not easy to be lost due to generation recombination, and the identification result is reliable. The identification method developed based on the molecular marker only needs to observe whether a specific band exists after PCR amplification to determine the seed drought-resistance seedling forming capacity, and the method is simple and low in cost.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular breeding technology, specifically relating to a molecular marker, primer pair, identification method, identification kit, and their application related to the drought resistance and seedling emergence ability of Brassica napus seeds. Background Technology

[0002] Brassica napus L. is an important oilseed crop in my country, widely distributed across major production areas including the Yangtze River winter rapeseed region, the Northwest spring rapeseed region, and the Huang-Huai-Hai Plain. These regions generally employ mechanized direct seeding cultivation. However, the diverse and complex climatic conditions in these areas, especially during the rapeseed sowing season, mean that the Yangtze River basin often experiences autumn droughts, while the Northwest region faces spring droughts, leading to insufficient soil moisture and severely impacting normal seed germination and emergence. Achieving full seedling emergence is the foundation and prerequisite for efficient rapeseed production. Drought during the sowing period results in poor seedling stability and low seedling survival rates, directly affecting the yield and quality of rapeseed and reducing production efficiency.

[0003] Drought stress is one of the major abiotic stress factors limiting the production and distribution of Brassica napus. Particularly in the main planting areas mentioned above, drought significantly reduces seedling emergence and germination rates during the seed germination period, thus affecting the final yield. Therefore, exploring drought-resistant gene resources and breeding Brassica napus varieties with strong drought-resistant seedling emergence capabilities is of great significance for ensuring stable and high yields of Brassica napus.

[0004] Currently, the assessment of drought resistance and seedling emergence ability in Brassica napus mainly relies on phenotypic identification methods. This involves simulating drought stress in the field or greenhouse and evaluating the plant's drought resistance and seedling emergence ability by investigating indicators such as seedling emergence rate and seedling growth status. However, this phenotypic identification method has significant limitations: on the one hand, it has a long growth cycle, is labor-intensive, and inefficient; on the other hand, phenotypic traits are highly susceptible to environmental factors such as soil moisture, temperature, and light, leading to poor repeatability and difficulty in guaranteeing accuracy. Especially for Brassica napus germplasm distributed in different ecological zones, environmental differences make it difficult to compare phenotypic identification results across different regions.

[0005] Molecular marker-assisted selection (MAS) technology has become an important tool in crop breeding due to its advantages such as being unaffected by the environment and having high early selection efficiency. Developing and applying molecular markers closely linked to target traits is key to achieving efficient identification of drought-resistant seedling emergence ability.

[0006] While some molecular markers exist for identifying drought resistance traits in Brassica napus, most target drought resistance at the mature plant stage or are random markers rather than functional gene markers, making them difficult to directly apply to gene aggregation breeding. Therefore, there is an urgent need to develop a new method for accurately identifying the drought resistance and seedling emergence ability of Brassica napus seeds, along with closely linked functional molecular markers, to address the technical problems of existing identification methods being highly susceptible to environmental influences, having long cycles, low accuracy, and lacking effective functional markers. Summary of the Invention

[0007] This invention has discovered a molecular marker that is associated with strong drought resistance and seedling emergence ability in rapeseed seeds. The molecular marker is located in the promoter region of the BnaFAD3.A4 gene on chromosome A4 of rapeseed. The presence of this molecular marker indicates strong drought resistance and seedling emergence ability in the seeds; the absence of this molecular marker indicates weak drought resistance and seedling emergence ability in the seeds.

[0008] Based on this, the present invention provides a molecular marker related to the drought resistance and seedling emergence ability of Brassica napus seeds and its application, so as to overcome the problems of existing methods for identifying the drought resistance and seedling emergence ability of Brassica napus seeds being greatly affected by the environment, having a long cycle, and low accuracy.

[0009] The technical solution provided by this invention is as follows: In a first aspect, the present invention provides a molecular marker related to the drought resistance and seedling emergence ability of Brassica napus seeds, the molecular marker being located in the promoter region of the BnaFAD3.A4 gene on the A4 chromosome of Brassica napus, and the molecular marker having the nucleotide sequence shown in SEQ ID NO.1.

[0010] In some embodiments of the present invention, the polymorphism of the 9th and / or 440th bp bases in the nucleotide sequence is related to the drought resistance and seedling emergence ability of Brassica napus seeds.

[0011] Secondly, the present invention provides a primer pair for specifically amplifying DNA fragments containing the molecular marker, wherein the nucleotide sequences of the forward primer and the reverse primer of the primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0012] Thirdly, the present invention provides a kit for identifying the drought resistance and seedling emergence ability of Brassica napus seeds, comprising the above-mentioned primer pairs.

[0013] In some embodiments of the present invention, the kit further comprises at least one of the following: enzymes, dNTPs, and buffers required for PCR reaction.

[0014] Fourthly, the present invention provides the application of the above-mentioned molecular markers, primer pairs, or reagent kits in the identification of drought resistance and seedling emergence ability of Brassica napus seeds.

[0015] Fifthly, the present invention provides a method for identifying the drought resistance and seedling emergence ability of Brassica napus seeds, by using the above-mentioned molecular marker, the above-mentioned primer pair or the above-mentioned kit to detect whether the molecular marker is present in the genomic DNA of the Brassica napus to be tested.

[0016] In some embodiments of the present invention, the method includes the following steps: Genomic DNA was extracted from the rapeseed species to be tested; PCR amplification was performed using the primer pairs described above; Detection of amplification products: If a specific band of the expected size is obtained, the molecular marker is determined to be present; if no band is obtained, the molecular marker is determined to be absent.

[0017] In some embodiments of the present invention, the detection of amplification products includes: The PCR amplification products were separated by agarose gel electrophoresis, and the presence of a specific band of 481 bp was observed in the electrophoretic pattern.

[0018] In some embodiments of the present invention, the detection of amplification products includes detection using capillary electrophoresis, polyacrylamide gel electrophoresis, or real-time fluorescence PCR.

[0019] In a sixth aspect, the present invention provides the application of the above-mentioned molecular markers, primer pairs, or kits in the selection and breeding of rapeseed varieties with strong seed drought resistance and seedling emergence ability.

[0020] Compared with the prior art, the present invention has the following beneficial effects: 1. The molecular marker provided by this invention is located in the promoter region of the BnaFAD3.A4 gene on chromosome A4 of Brassica napus. It has a close linkage relationship with the drought resistance and seedling emergence ability trait, high genetic stability, is not easily lost due to generational recombination, and the identification results are reliable.

[0021] 2. The identification method developed based on this molecular marker in this invention only requires observing the presence or absence of a specific band after PCR amplification to determine the strength of drought resistance and seedling emergence, without the need for expensive sequencing or complex enzyme digestion analysis. This method is simple to operate, has high throughput, and is low in cost, making it very suitable for rapid screening in large-scale breeding populations. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 This is a frequency distribution diagram of the drought resistance and seedling emergence ability of the RIL population in an embodiment of the present invention.

[0024] Figure 2 This is a QTL mapping result of drought-resistant seedling survival rate during the germination period of the RIL population in an embodiment of the present invention.

[0025] Figure 3 Cluster analysis diagram of differential genes between ZG and ZS11; where: GK represents the germination time of ZG seeds under normal moisture conditions for 20 hours. SK indicates that ZS11 seeds germinated for 20 hours under normal moisture conditions. GP represents the germination of ZG seeds under drought stress conditions (15% PEG6000) for 20 hours. SP represents the germination of ZS11 seeds under drought stress (15% PEG6000) for 20 hours. GPLB represents the germination of ZG seeds under drought stress (15% PEG6000) for 24 hours. SPLB represents the germination of ZS11 seeds under drought stress (15% PEG6000) for 24 hours.

[0026] Figure 4 The graph shows the correlation between the functional enrichment of ZG and ZS11 genes and the phenotypic correlation of samples; where: GK represents ZG seeds germinating for 20 hours under normal moisture conditions; SK indicates that ZS11 seeds germinated for 20 hours under normal moisture conditions. GP represents the germination of ZG seeds under drought stress conditions (15% PEG6000) for 20 hours. SP represents the germination of ZS11 seeds under drought stress (15% PEG6000) for 20 hours. GPLB represents the germination of ZG seeds under drought stress (15% PEG6000) for 24 hours. SPLB represents the germination of ZS11 seeds under drought stress (15% PEG6000) for 24 hours.

[0027] Figure 5 This figure shows the difference in seed germination rate under drought stress between two types of RIL populations: those with strong drought resistance and seedling emergence ability (using primers SEQ2 and SEQ3 to amplify a 481bp band) and those with weak drought resistance and seedling emergence ability (not amplified).

[0028] Figure 6 These are images showing the seedling phenotypes of 12 natural populations under drought stress and a clean water control conditions, as described in this embodiment of the invention; wherein: A represents the seedling survival rate of the 12 materials marked in Table 1 under drought stress. From top to bottom, the first column is numbered as 9, 18, and 15 in Table 1; the second column is numbered as 3, 7, and 1; the third column is numbered as 4, 5, and 8; and the fourth column is numbered as 10, 2, and 6. B shows the seedling survival rate of the 12 unlabeled samples under drought stress. From top to bottom, the first column is numbered as 29, 27, and 44 in Table 1; the second column is numbered as 32, 25, and 38; the third column is numbered as 40, 34, and 30; and the fourth column is numbered as 35, 37, and 28. C represents the seedling growth of the 12 materials marked in Table 1 under the clear water control condition, with the same numbering as Figure A; D represents the seedling growth of the 12 unmarked samples in Table 1 under the clear water control condition, with the same numbering as Figure B.

[0029] Figure 7 To amplify the gel images of 48 natural populations using primers SEQ2 and SEQ3, the first row contains numbers 1-24 from Table 1, all of which carry markers. The second row contains numbers 25-48 from Table 1, all of which do not carry markers. The third row contains H2O and ZG. Detailed Implementation

[0030] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0031] In this invention, the term "Brassica napus" refers to a plant belonging to the genus Brassica in the family Brassicaceae. This term encompasses various cultivars, breeding lines, hybrids, and hybridizable germplasm resources with similar genetic backgrounds of Brassica napus, all of which are protected under this invention unless explicitly defined by the context.

[0032] In this invention, the term "drought-resistant seedling emergence ability" specifically refers to the trait of rapeseed seeds resisting drought stress and emerging normally from the stage of water absorption and germination to the full unfolding of cotyledons. This trait is quantitatively evaluated by relative seedling emergence rate and is the core phenotype predicted by the molecular markers of this invention.

[0033] In this invention, the term "BnaFAD3.A4 gene" refers to the fatty acid desaturase 3 (FAD3) gene located on chromosome 4 (A4) of the Brassica napus A genome. In the embodiments of this invention, the physical location of the BnaFAD3.A4 gene locus is located at 19,407,950 bp to 19,411,137 bp on chromosome A4 (reference genome version number: Brassica_napus.ZS11.v0.gene).

[0034] In this invention, the term "tight linkage" means that the genetic distance between the molecular marker and the target gene locus is less than 5 cM, preferably less than 1 cM, or that both are located within the same gene sequence.

[0035] In this invention, the term "drought stress treatment" refers to the experimental treatment process used during the seed germination stage of Brassica napus to simulate drought stress conditions in order to assess the seed's drought resistance and seedling emergence ability. In the embodiments of this invention, polyethylene glycol (PEG-6000, mass concentration 15%) was used to simulate drought stress, and the specific steps are as follows: (1) Seed disinfection and pretreatment: Select uniform, plump, and pest-free rapeseed seeds of each strain, surface disinfect them with a 75% alcohol solution for 1 minute, and then rinse them three times with sterile water. (2) Coercion Management: Two layers of seedling paper were laid in a 9 cm diameter petri dish, and 50 seeds were evenly placed in each dish. 10 mL of 15% PEG6000 solution was added to each petri dish to simulate drought stress.

[0036] (3) Cultivation conditions: The petri dishes were placed in a light incubator with light / dark times of 16 h and 8 h, temperatures of 25℃ and 20℃, light intensity of 13000 lx and 0 lx, and relative humidity of 65%.

[0037] In this invention, the term "QTL" is short for Quantitative Trait Locus, which refers to a specific DNA sequence region on a chromosome that controls a quantitative trait. Quantitative traits (such as drought resistance and seedling emergence ability, yield, etc.) exhibit continuous variation and are usually influenced by multiple genes and environmental factors, rather than being simple "present / absent" qualitative traits. QTL mapping is a technique that uses molecular marker linkage analysis to establish statistical associations between these phenotypic variations and specific regions of the genome.

[0038] This invention provides a complete molecular identification system for the drought resistance and seedling emergence ability of Brassica napus seeds, including molecular markers, primers, reagent kits, identification methods, and their applications.

[0039] The molecular marker provided by this invention is precisely located in the promoter region of the BnaFAD3.A4 gene on chromosome A4 of Brassica napus. The molecular marker has the nucleotide sequence shown in SEQ ID NO.1.

[0040] The BnaFAD3 gene family encodes fatty acid desaturases, which are mainly involved in regulating the fatty acid composition and oil content of Brassica napus seeds, making them an important target for quality breeding of Brassica napus. However, the specific relationship between haplotype variations of BnaFAD3 gene family members, especially BnaFAD3.A4, and the drought resistance and seedling emergence ability of Brassica napus seeds is currently unclear, and there are no reports of using specific haplotypes of this gene to identify drought resistance and seedling emergence ability.

[0041] Existing molecular markers for drought resistance are mostly randomly distributed SSR or SNP markers, often located in intergenic regions. Their linkage with the target trait may recombine due to different populations, leading to poor identification stability. In addition, there is a lack of molecular markers targeting the drought resistance and seedling emergence ability of seeds during the critical stage of seed germination.

[0042] Because this molecular marker is located in the promoter region of the BnaFAD3.A4 gene and is a functional marker, it exhibits extremely high co-segregation with the drought resistance and seedling emergence trait, good genetic stability, and is not prone to recombination. Regardless of the genetic background of the population, this molecular marker can stably indicate drought resistance and seedling emergence ability, significantly improving the accuracy of marker-assisted selection.

[0043] The present invention also provides primer pairs (SEQ ID NO. 2 and 3) for specific amplification of the above-mentioned markers. These primer pairs have undergone rigorous screening, exhibiting high specificity and high amplification efficiency.

[0044] This invention also establishes a method for identifying the drought resistance and seedling emergence ability of Brassica napus seeds. The method utilizes the aforementioned molecular marker, primer pairs, or kit to detect whether the genomic DNA of the Brassica napus seed to be tested contains the molecular marker. The presence of the molecular marker indicates strong drought resistance and seedling emergence ability; the absence of the molecular marker also indicates strong drought resistance and seedling emergence ability.

[0045] The detection method of this invention allows for direct DNA extraction and identification during seed germination, eliminating the need to wait for plant maturity and significantly shortening the breeding cycle. This method avoids subjective errors associated with human observation of phenotypes, and the results are digitized and standardized.

[0046] This invention also integrates the aforementioned primers into a reagent kit for use in germplasm resource screening. Breeding units lack standardized tools for detecting drought resistance and seedling emergence rates, and establishing their own systems is time-consuming and labor-intensive. This invention provides a standardized detection tool, facilitating rapid screening of large-scale germplasm resources and early aggregation of breeding materials, and has extremely high promotional value and application prospects.

[0047] The technical solution of the present invention will be described in detail below through specific embodiments.

[0048] The seed depository and acquisition method are: Huazhong Agricultural University; DNA extraction reagent: Tiangen DNA extraction kit DP350 was used; PCR reaction reagents: The DNA polymerase used was Novozymes' Mark 2000; Electrophoresis reagent: Agarose gel concentration 0.02 g / mL; Nucleic acid dye: Novozymes' K5Gelred PLUS nucleic acid dye.

[0049] The ZG material used in this invention is obtained by distantly hybridizing "Dwarf Yellow" and "Zhuge Cai", then hybridizing the resulting hybrid with Brassica napus, and after multiple generations of self-pollination, selecting a Brassica napus-type rapeseed from the F16 line. Reference: "Phenotypic, cytogenetic, and molecular marker analysis of Brassica napus introgressants derived from an intergeneric hybridization with Orychophragmus".

[0050] Example 1: Identification of drought resistance and seedling emergence ability of RIL population of Brassica napus seeds and phenotypic data analysis 1. Test materials In this embodiment, the Shuang 11 (ZS11, with a seedling rate of 18.3% after 7 days of drought stress treatment) and ZG material (with a seedling rate of 88.6% after 7 days of drought stress treatment), which have significant differences in drought resistance and seedling emergence ability, were used as parents. The F1 generation was obtained by hybridization, and subsequent generations were self-pollinated. The resulting F8 generation was named the RIL population, which consisted of 104 lines. Seeds from each line were used for subsequent experiments.

[0051] 2. Drought stress treatment and seedling survival rate determination Drought stress group: treated with polyethylene glycol to simulate drought stress.

[0052] The only difference between the clean water control group and the drought stress group was that the 15% PEG6000 solution was replaced with an equal volume of sterile water.

[0053] The seedling survival rate was calculated after 7 days of cultivation. The seedling survival rate was calculated using the following formula: Seedling survival rate (%) = (Number of seedlings on day 7 / Total number of seeds tested) × 100% Note: Each strain was replicated 6 times, and the average value was taken as the seedling survival rate of that strain.

[0054] 3. Results Analysis like Figure 1 As shown, statistical analysis was performed on the drought resistance and seedling emergence data of the RIL population measured in this embodiment. The results showed that: (1) Under drought stress and water control conditions, the seedling rate of the 104 lines in this population showed a continuous normal distribution with a wide range of variation, indicating that the drought resistance seedling ability of Brassica napus seeds is a quantitative trait and is controlled by multiple genes.

[0055] Example 2: Whole-genome resequencing and high-density variant detection of the tested parents and RIL population 1. Genomic DNA extraction and sequencing Genomic DNA was extracted from leaves of the 104 strains and their parents described in Example 1. Whole-genome resequencing (WGS) was performed using a high-throughput sequencing platform (Illumina HiSeq). The sequencing strategy was paired-end sequencing (150 bp) to ensure that the average sequencing depth of each sample was not less than 10×.

[0056] 2. Sequencing data filtering The raw sequencing results may contain adapter sequences or low-quality bases. To ensure data quality, the raw sequences must be filtered to obtain clean sequences. Subsequent analyses are based on these clean sequences. The data filtering steps are as follows: 1) Use FASTP software (version 0.23.0) to remove adapter sequences from the sequences; 2) Use FASTP software (version 0.23.0) to remove low-quality bases from the sequences (calculate the average quality number using a 4bp sliding window; if it is less than 15, remove all subsequent bases); 3) The sequence length must be greater than 50bp.

[0057] 3. Sequence alignment The sequencing data was aligned to the reference genome using the MEM algorithm in BWA software (version 0.7.15-r1140) (only PE sequences with matched ends were considered alignable to the genome), resulting in SAM format alignment results. Then, samtools software (version 1.3.1) was used to convert the SAM files to BAM format, and the sequences in the BAM files were sorted to obtain the final BAM file. The reference genome information for Brassica napus used in this alignment is as follows: 1) Version: Brassica_napus.ZS11.v0.gene.

[0058] 4. Mutation detection Based on the BAM files obtained from sequence alignment analysis with the reference genome, we first used the HaplotypeCaller module in the GATK (version 3.7) package to generate a gvcf file for each sample. Then, we used the GenotypeGVCFs module to perform variant detection on all samples together, including SNPs and InDels. The variant information output by GATK is stored in a vcf file, which contains all the variants that exist between the samples and the reference genome. A total of 45,479 variant sites were obtained, including 40,540 SNPs and 4,939 InDels.

[0059] 5. Construction of genetic linkage maps A genetic linkage map is a map constructed based on chromosomal recombination and exchange, using genetic markers as landmarks, and defining the distance between two genetic markers as the recombination value between them. The unit of genetic map distance is centi-morgan (cM), and typically 1 cM corresponds to a 1% recombination rate. The steps for constructing a genetic map for subsequent QTL mapping are as follows: 1) The genotypes of the parents can be inferred from the linkage relationships between markers within the offspring population. At the same time, they can be compared with the actual parental genotypes to determine the authenticity of the parental materials. 2) Fill in missing genotypes based on Hidden Markov Model (HMM) and correct some incorrect genotypes; 3) Assess the recombination rate between markers according to the method described in the MSTMap software, and then use the Kosambi plotting function to calculate the genetic map distance between markers.

[0060] The 45,479 variant sites and genetic linkage maps obtained were used for QTL localization analysis in Example 3.

[0061] Example 3: QTL Locating Analysis of Drought Resistance and Seedling Growth Ability of Brassica napus 1. Data integration The genetic map dataset for QTL mapping was created by integrating the seedling rate phenotypic data of 104 lines measured in Example 1 under drought stress and water control conditions, and the 45,479 high-quality variant sites identified in Example 2.

[0062] 2. QTL positioning method Windows QTL Cartographer 2.5 software was used to perform QTL localization and effect detection on the seedling survival rate of the RIL population using the Composite Interval Mapping (CIM) method. The main parameter settings are as follows: (1) Scan window size: 10 cM; (2) Walk Speed: 1 cM; (3) Detect whether two adjacent peaks are of the same QTL, and filter the window. for 10 cM, step size set to 1.0 cM, (4) Threshold determination: The LOD threshold was determined by performing 1000 permutation tests at a significance level of P<0.05. When the LOD value of a certain interval is greater than or equal to the LOD threshold, it is determined that there is a QTL site in that interval.

[0063] 3. Location Results like Figure 2 As shown, a genome-wide scan was performed based on the seedling survival rate trait under drought stress, and two QTL loci significantly associated with drought resistance seedling survival ability were detected, located on chromosomes A4 and A6, respectively. The QTL locus on chromosome A4 explained 14.60% of the phenotypic variation (PVE), which is a large effect value. In this embodiment, this QTL locus was selected as the target region for subsequent candidate gene mining and molecular marker development.

[0064] Example 4: Candidate gene mining and functional analysis of BnaFAD3.A4 gene 1. Material processing and transcriptome sequencing The parent varieties of the RIL population described in Example 1 were selected: a parent with strong drought resistance and seedling growth ability (hereinafter referred to as ZG) and a parent with weak drought resistance and seedling growth ability (hereinafter referred to as ZS11).

[0065] ZG and ZS11 seeds were placed under germination conditions, and the following treatment groups were set up respectively: (1) Control group (CK): treated with water, samples were taken after 20 hours of germination and quick-frozen with liquid nitrogen. (2) Drought treatment group (PEG): 15% PEG6000 simulated drought stress. Three samples were taken at 20h and 24h of germination and then quick-frozen with liquid nitrogen.

[0066] Each treatment group had three biological replicates, totaling 18 samples. Transcriptome sequencing was performed using the Illumina platform. Quality control results showed that the Pearson correlation coefficients between samples were all greater than 0.85, indicating high data reliability.

[0067] 2. Differentially expressed gene (DEG) analysis Sequencing data were compared and expression levels were calculated. Gene expression differences between untreated ZG seeds and ZS11 seeds were compared, and a total of 12,035 differentially expressed genes were identified, reflecting significant genotypic differences between the two parents.

[0068] Further analysis of gene expression responses under drought stress (e.g.) Figure 3 As shown in C), differentially expressed genes were divided into upregulated and downregulated groups. Under simulated drought conditions, cluster analysis determined the optimal number of clusters to be 8. Among them, DEGs in clusters C3, C5, and C6 of ZG showed an upregulated trend, and their accumulated abundance was higher than that of ZS11 (e.g., Figure 3 (As shown).

[0069] 3. Weighted Gene Co-expression Network Analysis (WGCNA) Expression data from all samples were integrated, and low-expression genes (TPM < 3 in all samples) were filtered out, retaining 22,127 high-expression genes for constructing a co-expression network. Pearson correlation thresholds were set to > 0.7 or < -0.7, resulting in 12 gene modules.

[0070] GO and KEGG enrichment analyses of genes in each module revealed that genes in the yellow, red, pink, and purple modules were mainly enriched in pathways such as plant hormone signal transduction, lipid metabolism, and carbohydrate metabolism. Correlation analysis showed that these four modules were closely related to the phenotypic traits of the samples (correlation coefficient ≥ 0.7). Figure 4 (As shown).

[0071] 4. Candidate gene screening Based on the above analysis, the following strategy was adopted to screen candidate genes: (1) Select hub genes from four modules (yellow, red, pink, and purple) that are highly correlated with the phenotype. (2) Based on the QTL localization results in Example 3, the candidate range is narrowed down to the major QTL interval of chromosome A4; (3) Genes with expression differences and sequence variations between ZG and ZS11 were selected. After screening, the candidate gene BnaA04G0191900ZS (BnaFAD3.A4) was finally identified.

[0072] Example 5: Identification of BnaFAD3.A4 gene haplotypes and its association with drought-resistant seedling ability. 1. Sequence alignment and haplotype classification The parental varieties of the RIL population described in Example 1 were selected: a parent with strong drought resistance and seedling emergence ability (ZG) and a parent with weak drought resistance and seedling emergence ability (ZS11). The full-length sequences of the BnaFAD3.A4 gene in these two parents were amplified and sequenced, and the analyzed regions included the promoter region, exons, introns, and 3'-UTR region. Sequence alignment analysis revealed significant differences between the two parents, particularly in the presence of insertion / deletion (InDel) or polymorphic sites in the primer-binding region.

[0073] 2. Association analysis between molecular marker detection results and drought resistance seedling emergence phenotype of RIL population The drought stress treatment method in Example 1 was used to identify the seed drought resistance and seedling emergence ability of the RIL population of Brassica napus germplasm.

[0074] like Figure 5 As shown, the statistical analysis results indicate that: (1) when amplified using primer pairs SEQ ID NO.2 and 3, the average seedling survival rate of materials with a specific band of approximately 481 bp under drought stress was 80.2%; (2) when amplified using primer pairs SEQ ID NO.2 and 3, the average seedling survival rate under drought stress was 66.6% when no band appeared. The difference in drought resistance seedling survival phenotype between the two groups was statistically significant (P<0.05). This indicates that the molecular marker detection results of the BnaFAD3.A4 gene are closely related to the drought resistance seedling survival ability of Brassica napus seeds.

[0075] Example 6: Development of molecular markers for drought-resistant seedling growth 1. Molecular marker design and primer synthesis The sequences of BnaFAD3.A4 from the two parental lines ZG and ZS11 were compared to identify differential sites, and specific molecular markers and matching primers were designed and developed.

[0076] Marker for strong drought resistance and seedling emergence: The target sequence is shown in SEQ ID NO.1. The specific primer pair is: forward primer SEQ ID NO.2, and reverse primer SEQ ID NO.3.

[0077] 2. PCR amplification and detection The genomic DNA of the target Brassica napus variety was amplified by PCR using the primers described above. The reaction system and procedure were the same as those described in Example 1. The amplification products were detected by agarose gel electrophoresis.

[0078] 3. Result Judgment and Verification The electrophoresis results are as follows: (1) When using primer pairs SEQ ID NO.2 and 3 for amplification: if a specific band of approximately 481 bp appears, it is determined that the drought-resistant seedling ability is strong; if no band appears, it is determined that the drought-resistant seedling ability is weak.

[0079] The marker system was used to conduct blind tests on several unknown Brassica napus varieties. The results showed that the consistency rate with the field phenotypic identification results was over 95%, proving that the molecular markers developed in this invention can accurately and quickly identify the drought resistance and seedling emergence ability of Brassica napus seeds.

[0080] GCATGTGACTAAAAGTCTAAAAGCATCAAAATCTTTAGCATCCATGAAAAAAGAACAAAACTTTTATTTAATGCTATGGGCCTATTTATGGTCCAATTAGCTATTATCATATGACATGTCCTTGAATAAATTAATGTATAAGTTTAATAATATTTATATATTTTTGTTTTAATGGCTTATTTTATTGTTAAATGGATACATCAGCTTGAAATATCTATGAACATGCATCATTTTC CTAAGATACATTTGTTTGTTGCTCAAAAAATAAATAACTAGTTAAACGAGTGAGATTCTTAGCATCTGCCTCGAAAACGATATGTTATTGACAATTCCAATTTCATTTTTATGAAAATAAAAATAATAGTTTATTTTATAATTGGGGTTGGTTGCAGGAGAATAAGCCATCGGACACACCACCAGAACCATGGCCATGTTGAAAACGACGAGTCTTGGGTTCCGGTAATCTTTCCCT CTCTCATATT(SEQ ID NO.1); 5'-GCATGTGACTAAAAGTCTAAAAGCA-3' (SEQ ID NO. 2); 5' - AATATGAGAGAGGGAAAGATTACCG -3' (SEQ ID NO. 3).

[0081] Example 7: Application and verification of molecular markers in the identification of drought resistance and seedling emergence ability of Brassica napus and in assisted breeding 1. Test materials Forty-eight rapeseed germplasm resources (excluding ZG and ZS11) were randomly selected from a natural population of 529 as test materials. All materials were provided by Huazhong Agricultural University.

[0082] 2. Genomic DNA extraction Genomic DNA was extracted from young leaves of the test material using a modified CTAB method. The specific steps are as follows: (1) Take about 1cm of tender leaves from each plant 2 Place the sample into a 2 mL centrifuge tube, add steel beads and 250 μL of 2% CTAB extraction buffer, and grind it on a grinder for 5 min; then add 500 μL of 2% CTAB extraction buffer.

[0083] (2) Place it in a 65℃ water bath for 45 minutes, and gently shake it once every 15 minutes.

[0084] (3) After water bath, cool to room temperature, add an equal volume (about 750 μL) of chloroform:isoamyl alcohol mixture (volume ratio 24:1), place on a shaker and shake at 125 rpm for 8 min, then centrifuge at 12000 rpm for 10 min.

[0085] (4) Pipette 450 μL of the supernatant into a new 1.5 mL centrifuge tube, add 900 μL of pre-cooled anhydrous ethanol, shake gently to mix, and place in a -20 °C freezer for 20 min to allow genomic DNA to precipitate.

[0086] (5) Centrifuge at 12000 rpm for 10 min, discard the supernatant, add 500 μL of 75% ethanol to wash the DNA precipitate twice, and discard the supernatant.

[0087] (6) Place the centrifuge tube containing DNA precipitate in a fume hood to dry, add 200 μL ddH2O to dissolve the DNA, and store at -20℃ for later use after complete dissolution.

[0088] 3. PCR amplification Using the genomic DNA extracted in step 2 as a template, PCR amplification was performed using the primer pair described in Example 6.

[0089] (1) Reaction system (10 μL): Vazyme 2×Taq Plus Master Mix: 3.5 μL; ddH2O: 3.5 μL; DNA template: 2 μL; 10 μM forward primer: 0.5 μL; 10 μM reverse primer: 0.5 μL.

[0090] (2) Reaction procedure: Pre-denaturation at 94℃ for 5 min, 1 cycle; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 45 s, 35 cycles; Extend the heat to 72℃ for 10 minutes, one cycle; 20℃ 20 s.

[0091] 4. Electrophoresis detection and result analysis The PCR amplification products were electrophoresed on a 2% agarose gel, stained with GelRed nucleic acid dye, and the bands were observed and recorded under a UV imager. The results are as follows: Figure 7 As shown: (1) Germplasm numbered 1-24 can be amplified with primer pair SEQ ID NO.2 and 3 to produce a specific band of about 481 bp, which is determined to be germplasm with strong drought resistance and seedling growth ability.

[0092] (2) No bands were amplified using primer pairs SEQ ID NO.2 and 3 for numbers 25-48, which were determined to be seedlings with weak drought resistance.

[0093] 5. Phenotypic verification of drought-resistant seedling emergence ability Select uniform, plump, and pest-free Brassica napus seeds from various lines. Disinfect the seeds with a 75% ethanol solution for 1 minute, then rinse three times with sterile water. Place two layers of seedling paper in 9 cm diameter petri dishes, and evenly distribute 50 seeds in each dish. Add 10 mL of 15% PEG6000 solution to each dish to simulate drought stress; add the same volume of water as a control. Place the petri dishes in a light incubator with a light / dark cycle of 16 h / 8 h, temperatures of 25℃ / 20℃, light intensity of 13000 lx / 0 lx, and relative humidity of 65%. Incubate for 7 days, and then calculate the seedling rate.

[0094] The results are shown in Table 1. The seedling survival rates of the 48 germplasm accessions in the natural population varied significantly under drought stress. Among them, accessions 1-24, which carried markers, had an average seedling survival rate of 75.06% under drought stress. Accessions 25-48, which did not carry markers, had an average seedling survival rate of 22.31% under drought stress. The seedling survival rates of the two types of germplasm under drought stress were highly significant (P<0.01).

[0095] The phenotypic identification results of drought resistance and seedling emergence ability of the above-mentioned 48 germplasm accessions were consistent with the electrophoresis results (results are shown in Table 1). Figure 6 , Figure 7As shown in the figure, the accuracy rate reached 95%. This indicates that the molecular markers and primer pairs developed in this invention can effectively distinguish the drought resistance and seedling emergence ability of Brassica napus seeds during the germination period, and can be widely used in molecular marker-assisted breeding and germplasm resource screening of Brassica napus.

[0096] Table 1. Results of drought resistance and seedling emergence ability verification of 48 natural populations of Brassica napus germplasm.

[0097] Note: CK represents the water control condition, P represents the drought stress condition, and the detection of a 481bp band indicates strong drought resistance and seedling emergence ability, while the absence of a band indicates weak drought resistance and seedling emergence ability.

[0098] The above description is merely a specific embodiment of the present invention, enabling those skilled in the art to understand or implement the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features claimed herein.

Claims

1. A molecular marker associated with drought resistance and seedling emergence ability of Brassica napus seeds, characterized in that, The molecular marker is located in the promoter region of the BnaFAD3.A4 gene on chromosome A4 of Brassica napus, and the molecular marker has the nucleotide sequence shown in SEQ ID NO.

1.

2. A primer pair for specifically amplifying a DNA fragment containing the molecular marker of claim 1, characterized in that, The nucleotide sequences of the forward and reverse primers of the primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

3. A kit for identifying the drought resistance and seedling emergence ability of Brassica napus seeds, characterized in that, It includes the primer pair as described in claim 2.

4. The reagent kit according to claim 3, characterized in that, It also contains at least one of the enzymes, dNTPs, and buffers required for PCR reactions.

5. The application of the molecular marker of claim 1, the primer pair of claim 2, or the kit of claim 3 in the identification of drought resistance and seedling emergence ability of Brassica napus seeds.

6. A method for identifying the drought resistance and seedling emergence ability of Brassica napus seeds, characterized in that, The molecular marker described in claim 1, the primer pair described in claim 2, or the kit described in claim 3 can be used to detect whether the genomic DNA of the rapeseed plant is containing the molecular marker.

7. The method according to claim 6, characterized in that, The method includes the following steps: Genomic DNA was extracted from the rapeseed species to be tested; PCR amplification was performed using the primer pair described in claim 2; Detection of amplification products: If a specific band of the expected size is obtained, the molecular marker is determined to be present; if no band is obtained, the molecular marker is determined to be absent.

8. The method according to claim 7, characterized in that, The detected amplification products include: The PCR amplification products were separated by agarose gel electrophoresis, and the presence of a specific band of 481 bp was observed in the electrophoretic pattern.

9. The method according to claim 7, characterized in that, The detection of amplified products includes methods such as capillary electrophoresis, polyacrylamide gel electrophoresis, or real-time fluorescence PCR.

10. The application of the molecular marker of claim 1, the primer pair of claim 2, or the kit of claim 3 in the selection and breeding of rapeseed varieties with strong seed drought resistance and seedling emergence ability.

Images