KASP primer set for detecting high and low oil content of rapeseed and application thereof

Abstract

The application discloses a KASP primer group for detecting high and low oil content of rapeseed and application thereof, and belongs to the field of molecular markers. The KASP primer group comprises BN900597_K01_X, BN900597_K01_Y and BN900597_K01_C, and sequences are shown as SEQ ID NO. 2-4. The X primer is connected with a FAM fluorescent label at the 5' end, and the Y primer is connected with a HEX fluorescent label at the 5' end. The KASP primer group is used for KASP amplification detection of rapeseed genomic DNA, and the high / low oil content phenotype can be distinguished according to the detected genotype. The application further discloses a KASP kit comprising the primer group and a detection method. The application has the advantages of high detection flux, accurate results, low cost, simple operation and the like, and is suitable for early screening of large-scale rapeseed high oil content breeding materials, and provides an efficient tool for molecular marker assisted selection.

Description

Technical Field

[0001] This invention belongs to the field of molecular markers and relates to a KASP primer set for detecting the oil content of rapeseed and its application. Background Technology

[0002] Rapeseed oil is the world's third-largest source of edible vegetable oil, providing approximately 13% of the global edible vegetable oil supply. In my country, rapeseed oil holds a particularly prominent position, accounting for over 55% of domestically produced edible vegetable oil, making it the largest domestic source. However, my country's dependence on imported vegetable oil remains high, with a self-sufficiency rate of only 31.5% in 2020, highlighting the growing concern about food and oil security. Therefore, increasing rapeseed production capacity is an urgent task, primarily achieved by expanding planting area and increasing oil yield.

[0003] Oil yield per unit area in rapeseed is mainly determined by two factors: seed yield and seed oil content. Studies have shown that a 1% increase in oil content is equivalent to a 2.3%–2.5% increase in seed yield. Therefore, increasing seed oil content is one of the most effective means to increase oil yield. However, seed oil content is a very complex quantitative trait, jointly controlled by embryonic genetic effects, cytoplasmic genetic effects, maternal genetic effects, and genotype-environment interactions, which poses a significant challenge to breeding rapeseed with high oil content.

[0004] Marker-assisted selection (MAS) is an effective means to accelerate the breeding process for high oil content rapeseed. Currently, researchers have located hundreds of QTL loci associated with rapeseed oil content, but the number of successfully cloned oil content QTL genes remains very limited. In recent years, with the development of genomics technology, significant progress has been made in the discovery of oil content-related genes. For example, Guo Liang et al. developed the molecular marker BnaLTP3.A02 gene for oil content-assisted selection; Zhang Chunyu et al. cloned the dominant yellow seed gene DYSOC1, which increases oil content by more than 10% while causing the seed coat to turn yellow; Li Wen et al. detected four SNPs in the exon region of the BnNAC082-A03 gene that were significantly associated with oil content through transcriptome analysis and GWAS. These studies provide important gene resources and marker tools for high oil content breeding.

[0005] KASP (Competitive Allele-Specific PCR) technology has demonstrated significant advantages in crop molecular breeding in recent years. This technology combines the simplicity of conventional PCR with the high sensitivity of fluorescence detection, offering advantages such as high throughput, low cost, high accuracy, and high reproducibility. Hong Meiyan et al. developed 90 high-quality KASP markers for identification and fingerprinting of Brassica napus varieties. However, to date, the number of KASP functional markers that can be used for direct screening of oil content traits in Brassica napus remains very limited. Reported oil content-related KASP markers are mainly designed for specific gene loci, and a high-throughput, low-cost, easy-to-operate detection system that can directly distinguish between high and low oil content varieties is still lacking.

[0006] Therefore, developing a KASP detection method based on SNP molecular markers to achieve rapid and accurate identification of the oil content of Brassica napus is of great significance for the early screening of high oil content varieties and molecular marker-assisted breeding, and can provide strong technical support for accelerating the breeding of new high oil content rapeseed varieties in my country. Summary of the Invention

[0007] The present invention aims to overcome the above-mentioned deficiencies of the prior art and provide a KASP primer set of SNP molecular markers that are significantly related to the oil content of rapeseed, as well as its application, kit and detection method.

[0008] To achieve the above objectives, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a KASP primer set of SNP molecular markers related to rapeseed oil content, comprising: Primer BN900597_K01_X, its nucleotide sequence is shown in SEQ ID NO.2; Primer BN900597_K01_Y, its nucleotide sequence is shown in SEQ ID NO.3; The universal primer BN900597_K01_C has the nucleotide sequence shown in SEQ ID NO.4.

[0009] Preferably, the 5' end of the BN900597_K01_X is connected to a FAM fluorescent tag, and the 5' end of the BN900597_K01_Y is connected to a HEX fluorescent tag.

[0010] Secondly, the present invention provides a KASP kit for detecting the oil content of rapeseed, comprising the KASP primer set described in the first aspect.

[0011] Thirdly, the present invention provides the application of the KASP primer set or the KASP kit in identifying the oil content of rapeseed.

[0012] Fourthly, the present invention provides a method for identifying the oil content of rapeseed, comprising the following steps: S1: Extracting genomic DNA from rapeseed; S2: Using the genomic DNA extracted in step S1 as a template, KASP amplification and detection are performed using the KASP primer set described above; S3: Determine the genotype based on the detected fluorescence signal, and then determine the oil content of the rapeseed.

[0013] Preferably, the PCR amplification reaction uses the Touchdown PCR program, including: denaturation at 94℃ for 15 min; denaturation at 95℃ for 20 s, annealing and extension at 65℃→56℃ for 60 s, for a total of 10 cycles, with the annealing and extension temperature decreasing by 0.8℃ in each cycle; and denaturation at 94℃ for 20 s, annealing and extension at 57℃ for 60 s, for a total of 30 cycles.

[0014] Preferably, the genotype interpretation rule in step S3 is as follows: FAM signal detected only: identified as homozygous G genotype, corresponding to low oil content variety; HEX signal detected: identified as homozygous A genotype, corresponding to high oil content variety.

[0015] The beneficial effects of this invention are: This invention provides a novel set of KASP primers designed for a new SNP site on chromosome A09 of the rapeseed genome. These primers exhibit high specificity, directly distinguishing between high and low oil content phenotypes. The detection results are highly consistent with the oil content phenotype data (p<0.05). This marker is a universal marker for a common genomic location, offering advantages such as wide applicability and low operational barriers. The detection system of this invention is low-cost, easy to operate, and high-throughput, making it particularly suitable for early screening of large-scale breeding materials. It can significantly shorten the breeding cycle and accelerate the breeding process of new high-oil-content varieties. Attached Figure Description

[0016] Figure 1 This is a graph showing the genotyping results of Example 3. The horizontal axis represents the HEX fluorescence signal intensity (corresponding to the A allele), and the vertical axis represents the FAM fluorescence signal intensity (corresponding to the G allele). Blue dots (lower right cluster) represent homozygous A genotype (high oil content), red dots (upper left cluster) represent homozygous G genotype (low oil content), and gray dots represent the blank control.

[0017] Figure 2 This is a bar chart comparing the oil content of different genotypes. The chart shows that the average oil content of the homozygous A genotype (A:A) is significantly higher than that of the homozygous G genotype (G:G). The error bars represent the standard deviation, and * indicates p<0.05. Detailed Implementation

[0018] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and not for limiting the scope of protection of the present invention. Various modifications or equivalent substitutions made by those skilled in the art based on the following embodiments should also be considered to fall within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally implemented according to conventional conditions or reference books, or according to the methods recommended in the manufacturer's operating manual. Materials in the embodiments that do not specify their source are all commonly used materials in the art and can be obtained commercially.

[0019] Example 1: Acquisition of SNP molecular markers and primer set design 1. Screening and confirmation of SNP loci A single nucleotide polymorphism (SNP) site with a base of G or A was found at position 63,221,150 bp on chromosome A09 in the reference genome of Brassica napus (ZS11 v0) (BnTIR website, https: / / yanglab.hzau.edu.cn / BnIR). This site is located in the intergenic region and is named BN900597_K01.

[0020] The nucleotide sequence of the SNP site is as follows: GATCCACAGATCAAAGAAGAAAACCAATAACGTGTCAAGCAAGAAAGAAGGAGGACGCGGTAAGAAGAAGAGCAAAGCTGTTGATTTCCGCACGCTTCTCACTCTATGCGCACAATCCATCTCATCAGGAGACAAGCTCGCAGCAGATGATCTGCTAAACCAGATAAAGAAACAATGCTCACCTCTAGGCGATGCGTCGCA[G / A ]AGACTAGCTTACTTCTTCACCAAGGCACTCGAGGCACGTCTCCAAGGAAGCAGCGGAGTAATGATACAGAGTTACTACGACTCCATAACGTCAAAGAAACGAACAGCTGCGCAGATTCTTAAGACTTATAAAGCCTTCTTGTCTGCTTCTCCCTTCATGACTTTGATTTACTTCTTCTCTAATAAAATGATTCTTGACGC (SEQ ID NO.1) 1.2 KASP Primer Set Design Using BatchPrimer 3 software, competitive allele-specific PCR (KASP) primers were designed using the above nucleotide sequence as a template. The primer set with the highest screening score included two allele-specific primers and one universal primer. BN900597_K01_X (recognizes the G allele), with a FAM fluorescent tag attached to the 5' end; BN900597_K01_Y (recognizes the A allele), with a HEX fluorescent tag attached to the 5' end; BN900597_K01_C (universal primer): No fluorescent label.

[0021] The sequences of the three primers are shown in Table 1.

[0022] Table 1: KASP primer sequences

[0023] Note: The italicized parts are fluorescent linker sequences.

[0024] The KASP primer technology described in this embodiment operates on the following principle: the 3' ends of two specific primers (X and Y) are complementary to the two alleles (G or A) at the SNP site. DNA polymerase can only initiate extension when the 3' ends are perfectly matched, thus achieving allele-specific amplification. Different fluorescent tags (FAM or HEX) are attached to the 5' ends of the X and Y primers, and the corresponding fluorescent groups are integrated into the amplification products. After PCR, the fluorescence intensity of FAM and HEX is detected using a plate reader. Kraken software automatically determines the genotype based on fluorescence signal clustering.

[0025] Example 2: Detection of oil content genotype in Brassica napus This embodiment provides a method for detecting the oil content of rapeseed using the above-mentioned primer set. The specific steps are as follows: 1. Genomic DNA extraction Genomic DNA was extracted from young leaves of Brassica napus using a modified CTAB method. NanoDrop analysis showed OD260 / 280 ratios between 1.8 and 2.0. The DNA was diluted to 20–50 ng / μL and stored at -20°C for later use.

[0026] 2. Preparation of the KASP reaction system Prepare the following PCR reaction system (total reaction volume 0.8 μL).

[0027] Table 2: PCR reaction system

[0028] Note: The dosages in the table are calculated based on the proportions of each component when preparing the premix (e.g., 10 μL). In actual operation, the premix should be prepared in larger quantities according to the proportions and then dispensed.

[0029] 3. PCR amplification procedure The Touchdown PCR program was used for amplification on a thermal cycler: denaturation at 94℃ for 15 min; denaturation at 95℃ for 20 s, annealing and extension at 65℃-56℃ for 60 s, 10 cycles, with the annealing and extension temperature decreasing by 0.8℃ per cycle; denaturation at 94℃ for 20 s, annealing and extension at 57℃ for 60 s, 30 cycles.

[0030] 4. Fluorescence signal reading and genotype interpretation After amplification, the fluorescence signal was read using a PHERAstar two-way single-excitation plate reader.

[0031] Table 3: Fluorescence signal reading parameters

[0032] Each sample was tested in triplicate. Kraken software was used to perform automated cluster analysis of the fluorescence signals, generating two-dimensional scatter plots.

[0033] Genotype interpretation rules: Pure Type A: HEX signal only (green / blue dot) → high oil content; Pure G-type: FAM signal only (red / orange dot) → low oil content; No signal (gray dot): blank control or reaction failure.

[0034] Example 3: Validation experiment of 63 rapeseed varieties 1. Experimental Materials Sixty-three rapeseed varieties with known oil content were selected, with 31 replicates and two blank controls, for a total of 96 samples (1×96-well plate).

[0035] 2. Test Results KASP detection was performed according to the method in Example 2, and the results are as follows: Figure 1 As shown: Genotype I (blue, lower right cluster): 22 samples, all homozygous type A (HEX+); Type II genotype (red, upper left cluster): 72 samples, homozygous G type (FAM+); Gray dot: blank control, no signal.

[0036] 3. Statistical analysis of oil content Independent samples t-tests were performed on the oil content data of the two genotype samples, and the results are as follows: Figure 2As shown: Homozygous type A: average oil content 41.26%, significantly higher than homozygous type G (average 38.48%) (p<0.05); indicating that the A allele at the BN900597_K01 locus is significantly associated with high oil content.

Claims

1. A KASP primer set for SNP molecular markers related to rapeseed oil content, characterized in that, include: Primer BN900597_K01_X, its nucleotide sequence is shown in SEQ ID NO.2; Primer BN900597_K01_Y, its nucleotide sequence is shown in SEQ ID NO.3; The universal primer BN900597_K01_C has the nucleotide sequence shown in SEQ ID NO.

4.

2. The KASP primer set according to claim 1, characterized in that, The 5' end of the BN900597_K01_X is connected to a FAM fluorescent tag, and the 5' end of the BN900597_K01_Y is connected to a HEX fluorescent tag.

3. A KASP reagent kit, characterized in that, It includes the KASP primer set as described in claim 1 or 2.

4. The application of the KASP primer set according to claim 1 or 2 or the KASP kit according to claim 3 in identifying the oil content of rapeseed.

5. A method for determining the oil content of rapeseed, characterized in that, Includes the following steps: S1: Extracting genomic DNA from rapeseed; S2: Using the genomic DNA extracted in step S1 as a template, KASP amplification and detection are performed using the KASP primer set described in claim 2; S3: Determine the genotype based on the detected fluorescence signal, and then determine the oil content of the rapeseed.

6. The method according to claim 4, characterized in that, The PCR amplification reaction was performed using the Touchdown PCR program, which included: denaturation at 94℃ for 15 min; denaturation at 95℃ for 20 s, followed by annealing and extension at 65℃→56℃ for 60 s, for a total of 10 cycles, with the annealing and extension temperature decreasing by 0.8℃ in each cycle; and denaturation at 94℃ for 20 s, followed by annealing and extension at 57℃ for 60 s, for a total of 30 cycles.

7. The method according to claim 5, characterized in that, The genotype interpretation rules in step S3 are as follows: FAM signal detected only: identified as homozygous G genotype, corresponding to low oil content variety; HEX signal detected: identified as homozygous A genotype, corresponding to high oil content variety.

Images