InDel molecular marker related to alkali tolerance of maize and application thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- THE SHENNONG LABORATORY
- Filing Date
- 2026-06-22
- Publication Date
- 2026-08-07
AI Technical Summary
[0004]目前,针对玉米耐碱性育种的实用型分子标记仍较少,特别是能够直接区分耐碱杂交种与碱敏感杂交种的插入/缺失型标记尚不充分
[0023] This invention provides an insertional genetic variation and its molecular marker that is significantly associated with alkali tolerance in maize. This marker can stably distinguish between alkali-tolerant and alkali-sensitive maize materials, providing clear detection results, simple operation, and good reproducibility. It can significantly improve the efficiency of alkali-tolerant maize germplasm identification and screening, providing an effective tool for molecular-assisted breeding of alkali-tolerant maize, and has significant application value and promising prospects for wider application.
Smart Images

Figure CN122521898A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to an InDel variant, molecular marker, and its application related to alkali tolerance in maize. Background Technology
[0002] Soil salinization is one of the important abiotic stress factors affecting maize (Zea mays L.) production and food security. In particular, under alkaline stress conditions, a high pH environment not only causes ion poisoning and osmotic stress, but also further impairs the absorption of mineral elements by plant roots, inhibits plant growth and development, and ultimately leads to a decline in yield and quality.
[0003] Alkali tolerance in maize is a typical complex quantitative trait, regulated by multiple genes and easily affected by environmental conditions. Traditional field identification methods suffer from problems such as long cycles, significant environmental interference, and low identification efficiency, making it difficult to meet the needs of modern maize molecular breeding and rapid selection. Therefore, developing functional molecular markers that are closely linked to maize alkali tolerance, stable, reliable, and easy to operate is of great significance for the identification of alkali-tolerant maize germplasm resources, screening of superior hybrids, and molecular-assisted breeding.
[0004] Currently, there are still few practical molecular markers for breeding alkali-tolerant maize, especially insertion / deletion markers that can directly distinguish between alkali-tolerant hybrids and alkali-sensitive hybrids. Therefore, identifying specific genetic variations significantly associated with alkali tolerance and developing stable and efficient molecular markers based on these variations has significant theoretical and practical value. Summary of the Invention
[0005] The purpose of this invention is to provide an InDel molecular marker related to maize alkali tolerance and its application, which can directly distinguish between alkali-tolerant hybrids and alkali-sensitive hybrids, significantly improve the efficiency of alkali-tolerant maize germplasm identification and screening, and provide technical basis for alkali-tolerant maize germplasm resource identification, superior hybrid screening and molecular-assisted breeding.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0007] One of the objectives of this invention is to provide an InDel variant associated with alkali tolerance in maize, which is located at 166160183 bp on chromosome 6 of the maize B73 reference genome (RefGen_v4), within the genomic region of gene Zm00001d038870.
[0008] The second objective of this invention is to provide a candidate gene, Zm00001d038870, that regulates genetic variation in maize alkali tolerance. This gene is located on chromosome 6 of the maize B73 reference genome (RefGen_v4), within the interval 166158761-166163050 bp. GWAS was used to locate a candidate region significantly associated with maize alkali tolerance, with a significantly associated SNP (rs_6_166161359) located near the candidate gene Zm00001d038870. Further sequence comparison analysis of this region revealed an insertion variant at 166160183 bp, which has a more direct correlation with the alkali-tolerant phenotype. A PCR molecular marker was developed based on this insertion variant.
[0009] The third objective of this invention is to provide a molecular marker related to alkali tolerance in maize. This molecular marker can be used to detect the presence or absence of the aforementioned inserted fragment in maize materials, thereby distinguishing between alkali-tolerant and alkali-sensitive maize materials. The molecular marker corresponds to the nucleic acid sequence of chromosome 6, 166160143-166160552 bp, of the maize B73 reference genome (RefGen_v4), as shown in SEQ ID NO.1.
[0010] The nucleotide sequence of SEQ ID NO.1 is as follows:
[0011] SEQ ID NO.1:
[0012] 166160143(bp)GTCCTTTCTACGTGGCCGTCATGTGGGAGGCTGGGAGCCCGGCCACGCTACGTGGCCCGGGGACTGCCTCGCTGCTTGCTTATAAATATTCCCCCGCTGGAAAAGCCCCCAGCCATCATCAGTAGCTAGCTGTTCGAAGCTTTTCAGCCGATCGAGCACCATCGTCACAGTCAGTAGTAGCCAAGCATATTTCTTTCTCCGAG TGATTTGCGCTGAGCGATCAGTTCATCCAGAGCGAGCGGAGCTGAGCTGAGCTGAGCGAGCTTGCGTTGCTTGAGAGACCCTGCTGCCATGGCTTCCCACCAGGACAAGGCTAGCTACCAGGCCGGCGAGACCAAGGCCCGCACCGAGGTATACGGACGGTGGCCTGCTTGCGGCTGCACTTGATCACGCACAAAACCACTTACAAA166160552 (bp)
[0013] The fourth objective of this invention is to provide primers for amplifying the aforementioned molecular markers. The primers are preferably designed based on conserved sequences flanking the insert fragment, and the nucleotide sequences of the left and right primers are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.
[0014] Left primer F (SEQ ID NO.2): GTCCTTTCTACGTGGCCGTCAT;
[0015] Right primer R (SEQ ID NO.3): TTTGTAAGTGGTTTTGTGCGTGA.
[0016] The fifth objective of this invention is to provide a method for identifying the alkali tolerance of maize. This method uses maize genomic DNA as a template and primers with the nucleotide sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 for PCR amplification, yielding amplification products. The amplification product of maize material without the insert fragment is approximately 410 bp in length; the amplification product of maize material with the insert fragment shown in SEQ ID NO. 4 is approximately 550 bp in length. The two can be clearly distinguished by 3% agarose gel electrophoresis. Electrophoretic detection or sequencing analysis is performed on the amplification products. If the identification result shows the presence of the insert fragment (SEQ ID NO. 4) at 166160183 bp on chromosome 6 of the maize B73 reference genome (RefGen_v4), then the maize material is alkali-tolerant; conversely, if the identification result shows no insert fragment (SEQ ID NO. 4) in the tested maize material, then the maize material is alkali-sensitive. The specific nucleotide sequence of the insert fragment (SEQ ID NO. 4) is as follows:
[0017] Insert fragment SEQ ID NO: 4:
[0018] GGGCTTGTTCGGTTAGCTCTCAATCCATGTGGATTAAGTGGGATTGGATGGGTTTGAATCCCAAACAAGTCAAACTTCTTCACAATTTTTTCCAATTCCATCCAATCCATGTGTATTGGGAATAACCGAACAAGCCCCTA
[0019] The sixth objective of this invention is to provide a PCR amplification system and amplification procedure for the primers SEQ ID NO.2 and SEQ ID NO.3 of the above-mentioned molecular markers.
[0020] The PCR amplification system consisted of 20 μL of the following components: 10 μL of 2 × Phanta Max Buffer, 0.4 μL of dNTP Mix (10 mM each), 0.4 μL of Phanta Max Super-Fidelity DNA Polymerase, 2 μL of DNA template, 0.8 μL of left primer F (10 μmol / L), 0.8 μL of right primer R (10 μmol / L), and 5.6 μL of ddH2O.
[0021] The PCR amplification program is as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 sec, annealing at 58℃ for 30 sec, extension at 72℃ for 20 sec, for a total of 36 cycles; final extension at 72℃ for 10 min; storage at 4℃.
[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0023] This invention provides an insertional genetic variation and its molecular marker that is significantly associated with alkali tolerance in maize. This marker can stably distinguish between alkali-tolerant and alkali-sensitive maize materials, providing clear detection results, simple operation, and good reproducibility. It can significantly improve the efficiency of alkali-tolerant maize germplasm identification and screening, providing an effective tool for molecular-assisted breeding of alkali-tolerant maize, and has significant application value and promising prospects for wider application. Attached Figure Description
[0024] Figure 1 The figure shows the results of genome-wide association analysis (GWAS) of alkali tolerance-related traits in maize seedlings in Example 1 of this invention. It shows that the significant associated SNP site rs_6_166161359 bp on chromosome 6 of the maize B73 reference genome (RefGen_v4) is significantly associated with alkali tolerance in maize seedlings.
[0025] Figure 2 This is a comparison diagram of the alkali tolerance phenotypes of the Zm00001d038870 gene EMS mutant and wild-type materials under alkaline stress in Example 4 of the present invention, used to illustrate the effect of the functional change of the Zm00001d038870 gene on the alkali tolerance of maize seedlings; wherein the EMS mutant has lower plant height, root length and shoot fresh weight than the wild type under alkaline stress, indicating that this gene is involved in the regulation of maize alkali tolerance.
[0026] Figure 3This figure shows the comparison of shoot fresh weight (g) between the Zm00001d038870 gene EMS mutant (Zm00001d038870 aa) and wild-type (Zm00001d038870 WT) materials under control and alkaline stress conditions in Example 4 of this invention. Under control conditions, there was no significant difference in shoot fresh weight between the mutant and wild-type. Under alkaline stress conditions, the shoot fresh weight of the mutant was significantly lower than that of the wild-type, indicating that impaired function of the Zm00001d038870 gene reduces alkali tolerance in maize seedlings, suggesting that this gene participates in the regulation of alkali tolerance in maize. In the figure, "ns" indicates no significant difference, "**" indicates a highly significant difference, and "****" indicates an extremely significant difference.
[0027] Figure 4 This is an agarose gel electrophoresis result of PCR amplification of different maize varieties using primers SEQ ID NO.2 and SEQ ID NO.3 in Example 3 of this invention. The left side shows the 2000 DNA Marker, with 1-11 corresponding to maize varieties MY73, Weike 702, Baiyu 99, Yuanyu 179, Hongdeng 7, Yudan 827, Taibang 111, Xinyu 158, Maoyu 6, Jinhuanghou 902, and Jufeng 1618, respectively. Larger bands represent those carrying the insert fragment, while smaller bands represent those not carrying the insert fragment.
[0028] Figure 5 This document describes the sequence alignment differences and alkali resistance performance of the maize varieties MY73, Weike 702, Baiyu 99, Yuanyu 179, Hongdeng 7, Yudan 827, Taibang 111, Xinyu 158, Maoyu 6, Jinhuanghou 902, and Yufeng 1618 in Example 3 of this invention. Detailed Implementation
[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments; it should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the scope of protection of the invention.
[0030] Example 1: GWAS localization of candidate regions associated with alkali tolerance in maize seedlings
[0031] This embodiment illustrates a method for obtaining candidate regions related to alkali tolerance in maize seedlings.
[0032] 1) Test materials
[0033] 196 maize hybrids widely planted in the Huang-Huai-Hai region were selected as the population material for association analysis.
[0034] 2) Alkali stress treatment
[0035] Select plump and uniformly sized corn seeds, surface disinfect them with a 10wt% sodium hypochlorite solution for 15 min, rinse them three times with sterile water, and then soak them at 25℃ for 6 h. Sow the treated seeds in a substrate with a 2:1 volume ratio of nutrient soil to vermiculite for cultivation.
[0036] Each sample included a control group (CK) and an alkali treatment group (AT), with three biological replicates per treatment. Culture conditions were: 18 h light / 6 h dark, light temperature 25°C, dark temperature 22°C, and relative humidity 60%. After germination, the control group received normal watering, while the alkali treatment group was watered daily with a 75 mmol / L alkali solution (NaHCO3:Na2CO3 molar ratio 5:1, pH 9.0) for 14 consecutive days.
[0037] 3) Phenotypic determination
[0038] After treatment, the shoot fresh weight (SF / SFT) of each material was measured under control and alkaline stress conditions.
[0039] Wherein, SF represents the fresh weight of buds under control conditions; SFT represents the fresh weight of buds under alkali stress conditions. Further calculation of the alkali tolerance index of bud fresh weight, i.e., the ratio of the trait value under alkali stress conditions to the trait value under control conditions, is denoted as: bud fresh weight alkali tolerance index (SFR).
[0040] 4) Genotype data and GWAS analysis
[0041] Genome-wide genotyping was performed using the Maize 48K Bead Chip microarray, yielding 359,809 high-quality SNP markers after quality control. Genome-wide association analysis was conducted using the GAPIT program in R software, employing a multi-site mixture linear model (MLMM) to analyze the original traits and alkali tolerance index under alkali stress, with a LOD ≥ 5.5 set as the significant association threshold.
[0042] GWAS results showed that multiple SNP sites significantly associated with alkali tolerance in maize seedlings were detected. Among them, the SNP site rs_6_166161359 bp on chromosome 6 of the maize B73 reference genome (RefGen_v4) showed a significant association with the fresh weight of sprouts trait, and is an important candidate site for further exploration of alkali tolerance-related functional variations.
[0043] 5) Determining the candidate interval
[0044] Based on the linkage disequilibrium decay analysis results of the test population, with r 2When the threshold is 0.1, the corresponding LD decay distance is approximately 100 kb. Therefore, candidate regions of 100 kb upstream and downstream of the significant SNP rs_6_166161359 were extracted for candidate gene analysis. The results showed that this candidate region contained multiple annotated genes, among which Zm00001d038870 was located near the significant site, making it one of the important candidate genes for further exploring InDel variants related to maize alkali tolerance and developing molecular markers.
[0045] This embodiment illustrates that by combining maize hybrid populations with seedling alkali tolerance phenotypes and genome-wide association analysis, candidate genetic regions related to maize alkali tolerance can be effectively identified, providing a foundation for subsequent molecular marker development.
[0046] Example 2: Verification of the alkali tolerance phenotype of the Zm00001d038870 gene EMS mutant
[0047] To further verify the correlation between the candidate gene Zm00001d038870 and maize alkali tolerance, EMS mutant materials of this gene and wild-type background materials were selected for seedling alkali tolerance phenotype analysis.
[0048] 1) Experimental materials
[0049] One copy of the EMS mutant material of the maize Zm00001d038870 gene was selected, with its wild-type background material used as a control. The EMS mutant was provided by Qilu Normal University. Target site PCR amplification and sequencing verification were performed on the mutant. The results showed that the EMS mutant contained a single base substitution mutation in the Zm00001d038870 gene, resulting in a change in its coding sequence.
[0050] 2) Alkali stress treatment
[0051] Plump and uniform seeds were selected, disinfected, soaked, and sown, and then cultured under the same conditions as in Example 1. After seedling emergence, a control group and an alkali treatment group were set up. The control group was watered normally, while the alkali treatment group was watered daily with a 75 mmol / L alkali solution. The molar ratio of NaHCO3 to Na2CO3 in the alkali solution was 5:1, and the pH was 9.0. The treatment was carried out continuously for 14 days, with 3 biological replicates for each treatment.
[0052] 3) Phenotypic determination
[0053] After treatment, the fresh weight of buds and alkali tolerance index of EMS mutants and wild-type materials were measured under control conditions and alkali stress conditions, and the results were statistically analyzed.
[0054] 4) Results Analysis
[0055] The results showed that under normal conditions, there was no significant difference in growth between the EMS mutant and the wild type; however, under alkaline stress, the EMS mutant exhibited an alkaline-tolerant phenotype that was significantly different from that of the wild type, with plant height, root length, and shoot fresh weight being significantly lower than those of the wild type.
[0056] The above results indicate that functional changes in the Zm00001d038870 gene affect maize seedling alkali tolerance, suggesting that this gene is involved in the regulation of maize alkali tolerance. This further supports the correlation between the genetic variation near Zm00001d038870 located in this invention and maize alkali tolerance, demonstrating the significant application value of this InDel locus. Molecular markers developed based on this locus can be used for the identification of alkali-tolerant maize germplasm resources, screening of alkali-tolerant materials, and molecular-assisted breeding.
[0057] Example 3: Discovery of InDel variants within candidate regions and development of molecular markers
[0058] This embodiment illustrates the discovery of InDel variants related to maize alkali tolerance and the development of their molecular markers.
[0059] 1) Comparative analysis of candidate segment sequences
[0060] Based on the significant associated site rs_6_166161359 obtained from GWAS localization in Example 1, further sequence polymorphism analysis was performed on its candidate region. Maize materials exhibiting significant phenotypic differences under alkaline stress during the seedling stage were selected. PCR amplification, product purification, and bidirectional sequencing were performed on the candidate genomic region near Zm00001d038870, and the sequences from different materials were compared and analyzed.
[0061] Sequence alignment results showed a stable insertion / deletion variant (InDel) at 166160183 bp on chromosome 6 of the maize B73 reference genome (RefGen_v4). This variant is located within the candidate region Zm00001d038870 and corresponds to the differences in alkali tolerance phenotypes in the tested materials at the seedling stage.
[0062] 2) Determination of molecular marker regions
[0063] Centered on the InDel site, conserved sequences flanking it were selected as primer design regions to obtain molecular marker regions for detecting the insertion / deletion variant. These molecular markers correspond to the nucleic acid sequence of chromosome 6, 166160143-166160552 bp, of the maize B73 reference genome (RefGen_v4), as shown in SEQ ID NO.1.
[0064] The nucleotide sequence of SEQ ID NO.1 is as follows:
[0065] GTCCTTTCTACGTGGCCGTCATGTGGGAGGCTGGGAGCCCGGCCACGCTACGTGGCCCGGGGACTGCCTCGCTGCTGCTGCTTATAAATATTCCCCGCTGGAAAAGCCCCCAGCCATCATCAGTAGCTAGCTGTTCGAAGCTTTTCAGCCGATCGAGCACCATCGTCACAGTCAGTAGTAGCCAAGCATATTTCTTTCTCCGAGTG ATTTGCGCTGAGCGATCAGTTCATCCAGAGCGAGCGGAGCTGAGCTGAGCTGAGCGAGCTTGCGTTGCTTGAGAGACCCTGCTGCCATGGCTTCCCACCAGGACAAGGCTAGCTACCAGGCCGGCGAGACCAAGGCCCGCACCGAGGTATACGGACGGTGGCCTGCTTGCGGCTGCACTTGATCACGCACAAAACCACTTACAAA
[0066] 3) Primer design
[0067] PCR amplification primers were designed based on the conserved sequences flanking the InDel site for the aforementioned molecular marker region. The primer sequences are as follows:
[0068] Left primer F (SEQ ID NO.2):
[0069] GTCCTTTCTACGTGGCCGTCAT
[0070] Right primer R (SEQ ID NO.3):
[0071] TTTGTAAGTGGTTTTGTGCGTGA
[0072] 4) InDel mutation type
[0073] When using the above primers to amplify different materials:
[0074] When the test material does not carry the insert fragment, the length of the amplification product is approximately 410 bp;
[0075] When the test material carries the insert fragment, the amplification product length is approximately 550 bp.
[0076] The inserted fragment sequence is shown in SEQ ID NO.4:
[0077] Insert fragment SEQ ID NO: 4:
[0078] GGGCTTGTTCGGTTAGCTCTCAATCCATGTGGATTAAGTGGGATTGGATGGGTTTGAATCCCAAACAAGTCAAACTTCTTCACAATTTTTTCCAATTCCATCCAATCCATGTGTATTGGGAATAACCGAACAAGCCCCTA
[0079] This embodiment illustrates that by performing fine sequence comparison analysis on GWAS candidate regions, InDel variants related to alkali tolerance in maize seedlings can be further discovered, and PCR molecular markers that are easy to detect can be developed accordingly.
[0080] Example 4: Validation of InDel molecular markers associated with maize alkali tolerance
[0081] This embodiment is used to illustrate the correspondence between the molecular markers described in this invention and the alkali-tolerant phenotypes in maize seedlings, and the feasibility of their application.
[0082] 1) Verification materials
[0083] The following 11 corn samples were selected as the verification subjects:
[0084] MY73, Weike 702, Baiyu 99, Yuanyu 179, Hongdeng 7, Yudan 827, Taibang 111, Xinyu 158, Maoyu 6, Jinhuanghou 902 and Yufeng 1618.
[0085] 2) Genomic DNA extraction
[0086] The novel plant genomic DNA extraction kit (centrifuge column type) from Tiangen Company was used. After DNA concentration was measured, it was diluted to 15µg / mL.
[0087] Take 0.1 g of fresh plant tissue, grind thoroughly with liquid nitrogen, add 400 µL of LP1-RNaseA mixture, shake for 1 min, and incubate at room temperature for 10 min. Add 130 µL of LP2, shake for 1 min, centrifuge at 12000 rpm for 5 min, transfer the supernatant to a 96-well filter plate (placed on a deep-well plate), centrifuge at 3550 rpm for 10 min and collect the filtrate. Add 1.5 times the volume of LP3 to the filtrate and immediately shake to mix for 15 s. Transfer all liquid to a 96-well adsorption plate CB3, centrifuge at 3550 rpm for 5 min, and discard the waste liquid. Add 550 µL of PW, centrifuge at 3550 rpm for 5 min, and discard the waste liquid; repeat this washing step once. Centrifuge at 3550 rpm for 5 min, and air dry the adsorption plate at room temperature for several minutes (to remove residual ethanol). Transfer the adsorption plate to a clean deep-well plate, add 50-200 µL TE (pH 7.0-8.5), incubate at room temperature for 2-5 min, and then elute by centrifugation at 3550 rpm for 8 min. The obtained DNA, after concentration and purity testing, is used for subsequent PCR amplification.
[0088] 3) PCR amplification and electrophoresis detection
[0089] Using genomic DNA from each material as a template, PCR amplification was performed using primers shown in SEQ ID NO.2 and SEQ ID NO.3.
[0090] The 20 µL reaction system is shown in Table 1.
[0091] Table 1 Reaction System
[0092]
[0093] The PCR amplification procedure is shown in Table 2.
[0094] Table 2 PCR amplification program
[0095]
[0096] Electrophoresis: 3% agarose gel; 1×TAE buffer; 120 V voltage, 150 mA current, electrophoresis for 15 minutes.
[0097] The test results showed that different materials could be divided into two types of amplification:
[0098] The amplified band size was approximately 550 bp.
[0099] The amplified band size was approximately 410 bp.
[0100] Further sequencing analysis of the PCR amplification products showed that:
[0101] The material that amplified a band of approximately 550 bp carried the insert fragment SEQ ID NO.4 at 166160183 bp on chromosome 6 of the maize B73 reference genome (RefGen_v4);
[0102] The material that amplifies a band of approximately 410 bp does not carry the inserted fragment at the corresponding site.
[0103] 4) Correspondence between markers and phenotypes
[0104] Comparing the molecular marker detection results with the seedling alkali stress phenotype identification results, it was found that the materials carrying the inserted fragment generally showed stronger alkali resistance under the alkali stress identification conditions used in this embodiment, while the materials without the inserted fragment generally showed weaker alkali resistance.
[0105] Among them, MY73, Weike 702, Baiyu 99, Yuanyu 179, Hongdeng 7, and Yudan 827 amplified to obtain a band of approximately 550 bp, corresponding to the insertion fragment SEQ ID NO.4 at 166160183 bp; Taibang 111, Xinyu 158, Maoyu 6, Jinhuanghou 902, and Yufeng 1618 amplified to obtain a band of approximately 410 bp, corresponding to the absence of the insertion fragment at the stated site.
[0106] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The application of molecular markers related to maize alkali tolerance or primers amplifying said molecular markers in the identification of alkali-tolerant maize germplasm resources, screening of alkali-tolerant maize materials, and molecular-assisted breeding of alkali-tolerant maize, characterized in that, The molecular marker is located in the 166160143-166160552 bp region on chromosome 6 of the maize B73 reference genome (RefGen_v4), and its nucleotide sequence is shown in SEQ ID NO.
1.
2. The application according to claim 2, characterized in that, The nucleotide sequences of the left and right primers for amplifying the molecular marker are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively: Left primer F (SEQ ID NO.2): GTCCTTTCTACGTGGCCGTCAT; Right primer R (SEQ ID NO.3): TTTGTAAGTGGTTTTGTGCGTGA.
3. A method for identifying the alkali tolerance of corn, characterized in that, Genomic DNA was extracted from the maize material to be tested; Using maize genomic DNA as a template, PCR amplification was performed using left primer F and right primer R to obtain amplification products; The amplified products are then detected by electrophoresis or sequenced.
4. The identification method according to claim 3, characterized in that, Agarose gel electrophoresis was used to identify the PCR amplification results: when the molecular marker size was detected to be 410 bp, it indicated that the maize material did not carry the insert fragment and was an alkali-sensitive material; when the molecular marker size was detected to be 550 bp, it indicated that the maize material carried the insert fragment and was an alkali-resistant material.
5. The identification method according to claim 3, characterized in that, Sequencing analysis results: If the results show that there is an insertion fragment at 166160183 bp on chromosome 6 of the maize B73 reference genome (RefGen_v4), the maize material is alkali-resistant; otherwise, if the results show that there is no insertion fragment in the maize material, the maize material is alkali-sensitive.
6. The identification method according to claim 5, characterized in that, The nucleotide sequence of the inserted fragment is shown in SEQ ID No.
4.
7. The identification method according to claim 3, characterized in that, The PCR amplification system consisted of 20 μL of the following components: 10 μL of 2× Phanta Max Buffer, 0.4 μL of dNTP Mix (10 mM each), 0.4 μL of Phanta Max Super-Fidelity DNA Polymerase, 2 μL of DNA template, 0.8 μL of left primer F (10 μmol / L), 0.8 μL of right primer R (10 μmol / L), and 5.6 μL of ddH2O.
8. The identification method according to claim 3, characterized in that, The PCR amplification program is as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 sec, annealing at 58℃ for 30 sec, extension at 72℃ for 20 sec, for a total of 36 cycles; final extension at 72℃ for 10 min; storage at 4℃.