A SNP molecular marker related to the initial node height of cotton and application thereof

Abstract

The application discloses a SNP molecular marker related to the initial node height of cotton and application thereof, and belongs to the technical field of plant molecular breeding. The SNP molecular marker is located at the 8,943,574th position of a D07 chromosome of upland cotton, the polymorphism is T / C, and the nucleotide sequence is shown as SEQ ID NO:1. The application also provides a specific primer set for KASP detection, and the sequences of the primer set are shown as SEQ ID NO:2-4. The genotype of a cotton sample at the SNP site can be quickly and accurately identified by using the primer set through a KASP method, so that the initial node height phenotype can be predicted. The application provides an efficient and accurate molecular marker and detection method for cotton plant type improvement and breeding of a suitable mechanical harvesting variety, and the breeding cycle can be significantly shortened and the breeding cost can be reduced.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular breeding technology, and relates to an SNP molecular marker related to the first node height of cotton and its application. Specifically, it relates to an SNP molecular marker related to the first node height trait of cotton, a KASP primer set developed based on the marker, a reagent kit, a detection method, and its application in cotton breeding. Background Technology

[0002] Xinjiang is one of my country's most important cotton-producing regions, and its cotton production has achieved significant development. Statistics show that my country ranks among the world's top cotton-producing areas in terms of planting area, yield per unit area, and total output. In 2024, Xinjiang's cotton planting area reached 36.719 million mu (approximately 2.18 million hectares), accounting for 86.25% of the national total of 42.574 million mu (approximately 3.88 million hectares); Xinjiang's cotton output reached 5.686 million tons, accounting for 92.2% of the national total of 6.164 million tons. The high yield and high quality of Xinjiang cotton provide crucial raw material support for the development of my country's textile industry. With the improvement of people's living standards and the advancement of urbanization, a large number of rural laborers have migrated to cities, significantly increasing the cost of manual cotton production. Therefore, accelerating the mechanization of cotton production is essential to reduce production costs and labor intensity, and to achieve sustainable development in cotton production.

[0003] In 2024, the mechanical harvesting rate of cotton in Xinjiang reached as high as 90%. Selecting cotton varieties suitable for mechanical harvesting is the main way to improve this rate. The morphological characteristics and spatial arrangement of cotton constitute its plant architecture. A suitable plant architecture for mechanical harvesting mainly includes a series of complex quantitative traits that reflect the external morphological characteristics of cotton, such as plant height, initial node height, internode length of the main stem, fruiting branch length, and the angle between the fruiting branch and the main stem. Mechanical harvesting of cotton is significantly influenced by plant architecture traits, with initial node height and plant height being two major traits that show a significant positive correlation. Furthermore, the main agronomic traits constituting the plant architecture of upland cotton directly affect its suitability for mechanical harvesting.

[0004] Currently, research on upland cotton plant architecture mainly focuses on plant height, fruiting branch length, and fruiting branch angle. However, there is a lack of genetic regulation and molecular markers for first node height. Therefore, studying the genetic characteristics of first node height and developing molecular markers for it can be used to analyze the influencing factors of upland cotton plant architecture and provide corresponding molecular markers for breeding upland cotton varieties suitable for machine harvesting, thus effectively selecting and improving varieties.

[0005] KASP (Competitive Allele-Specific PCR) marker technology is a molecular genotyping method based on endpoint fluorescence detection. Two specific primers carrying different fluorescent tags are designed based on the target SNP genotyping. The genotype (homozygous or heterozygous) of a sample can be accurately determined by detecting the endpoint fluorescence type (FAM, HEX, or mixed). The main advantages of this technology are its flexibility, precision, and low cost per point: no pre-synthesized probes are required, allowing for rapid development; flexible throughput design makes it suitable for high-throughput screening of large sample sizes; high genotyping accuracy (>99.5%); and relatively low requirements on DNA quality and quantity. KASP technology is widely used in molecular breeding of plants and animals for genotype selection (MAS), variety identification and purity analysis, and genetic map construction. It is an efficient tool for large-scale screening and validation of known key variant sites. Therefore, by identifying SNP sites associated with the first node height trait in cotton, molecular markers can be developed using KASP genotyping to screen suitable cotton resources for machine harvesting and to breed cotton varieties suitable for machine harvesting. Summary of the Invention

[0006] To overcome the shortcomings of existing technologies, this invention provides an SNP molecular marker related to cotton initial node height and its application, solving the problem of the lack of efficient and accurate molecular markers for cotton initial node height in existing technologies.

[0007] The technical solution is as follows:

[0008] In a first aspect, the present invention provides a SNP molecular marker related to the initial node height of cotton, the nucleotide sequence of which is shown in SEQ ID NO:1, wherein the base at position 151 is T or C. SEQ ID NO:1:

[0009] AACTAACGCTTTTGTGAGTGAATGCGTTGATTACTACATTGCAATTGTCATTAGAAGAAACCCCAAACCCTTTTAATTTAATTCTGCCTTTATTAAAATATAGAGCACACAATGTAGTATTGAAGAGTCAATTGCAGTAAGATATTCTCAA[C / T]TATAACCCTCATTTTAATTTAGTTCTTAGATTTCAAAATATTTTAATTGCATCCCTTAACTATTGGTGTTCTATCAATCGTGTCTTATTTATTTATTTATTAAAACCGATAAATAACACATCAAATCTTATGCAGCTAAATTTAAAATGA.

[0010] Furthermore, the SNP molecular marker is located at position 8,943,574 on chromosome D07 of upland cotton, and its polymorphism is T / C.

[0011] Specifically, the physical location of the SNP molecular marker was determined based on the standard reference genome of upland cotton. This locus was determined by constructing an F2 population using extreme first node height materials as parents, selecting extreme progeny materials to construct a mixed pool, and using BSA-seq technology to locate the QTL interval (qFBH7, located at positions 8,379,614 to 10,628,581 on chromosome D07). Ten SNP loci were developed within this interval, and the SNP loci that were most significantly associated with the first node height trait were finally screened.

[0012] Secondly, the present invention provides a KASP primer set for detecting the above-mentioned SNP molecular markers, the KASP primer set comprising: a first upstream primer, a second upstream primer, and a downstream primer.

[0013] Specifically, the nucleotide sequence of the first upstream primer is shown in SEQ ID NO:2; the nucleotide sequence of the second upstream primer is shown in SEQ ID NO:3; and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:4.

[0014] More specifically, the 5' ends of the first and second upstream primers are respectively connected to different KASP universal fluorescent adapter sequences. Specifically, the 5' end of the first upstream primer is connected to the FAM fluorescent adapter sequence (GAAGGTGACCAAGTTCATGCT); the 5' end of the second upstream primer is connected to the HEX fluorescent adapter sequence (GAAGGTCGGAGTCAACGGATT). The downstream primer is a standard amplification primer.

[0015] Thirdly, the present invention provides a kit for identifying or assisting in the identification of the initial node height of cotton, the kit comprising the KASP primer set described in the second aspect above.

[0016] Furthermore, the kit also includes KASP 2× Master Mix, a positive control, a negative control, and / or instructions for use. The KASP 2× Master Mix contains Taq DNA polymerase, a FAM / HEX universal fluorescent probe, dNTPs, buffer, MgCl2, and the reference dye ROX.

[0017] Fourthly, the present invention provides a method for identifying or assisting in the identification of the initial node height of cotton, the method comprising the following steps:

[0018] (1) Extract genomic DNA from the cotton sample to be tested;

[0019] (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using the KASP primer set described in the second aspect above;

[0020] (3) Detect the fluorescence signal of the PCR amplification product and determine the genotype of the cotton sample to be tested at SNP site D07_03 based on the fluorescence signal;

[0021] (4) Predict the first node height phenotype of the cotton to be tested based on genotype: if the genotype is T / T, it is predicted to be high first node height phenotype or has high first node height potential; if the genotype is C / C, it is predicted to be low first node height phenotype or has low first node height potential; if the genotype is T / C, it is predicted to be medium first node height phenotype or heterozygous.

[0022] Further, the PCR amplification reaction system described in step (2) is as follows: KASP 2× Master Mix 1 µl, upstream primer 1 (50 µM) 0.0112 µl, upstream primer 2 (50 µM) 0.0112 µl, downstream primer (50 µM) 0.028 µl, template DNA 4-50 ng, and RNase-free ddH2O to make up to 2 µl.

[0023] Furthermore, the PCR amplification procedure described in step (2) is as follows:

[0024] Step 1: Pre-denaturation at 95°C for 15 min, repeat once;

[0025] Step 2: Denaturation at 95°C for 20 seconds, annealing / extending at 61-55°C for 60 seconds, repeat 10 times;

[0026] Step 3: Denaturation at 95°C for 20 seconds, annealing / extending at 55°C for 60 seconds, repeat 28 times.

[0027] Further, the fluorescence signal detection in step (3) is performed using a fluorescence microplate reader or a real-time quantitative PCR instrument. The endpoint fluorescence signal is detected. If a FAM fluorescence signal (excitation wavelength 485 nm, emission wavelength 520 nm) is displayed, the genotype is determined to be T / T; if a HEX fluorescence signal (excitation wavelength 535 nm, emission wavelength 556 nm) is displayed, the genotype is determined to be C / C; if both fluorescence signals are displayed simultaneously, the genotype is determined to be T / C heterozygous.

[0028] Fifthly, the present invention provides the application of the above-mentioned SNP molecular markers, KASP primer sets or kits in cotton breeding or cotton resource screening.

[0029] Furthermore, the application is to screen or breed cotton varieties suitable for mechanical harvesting.

[0030] Furthermore, the applications include: using the above-mentioned SNP molecular markers, KASP primer sets or kits to detect the genotype of cotton germplasm resources or breeding populations at the SNP loci, selecting materials with T / T genotypes as high-starting-node high-parental or breeding materials for configuring hybridization combinations or for subsequent breeding; or selecting materials with C / C genotypes as low-starting-node high-parental or breeding materials.

[0031] Furthermore, the application also includes: genotyping the breeding population during the seedling or early stage, eliminating individuals that do not have the target genotype, and retaining individuals with the target genotype (T / T or C / C depending on the breeding target) for field planting and phenotypic identification.

[0032] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0033] (1) A novel SNP molecular marker site was provided: This invention is the first to identify and confirm that the SNP site (D07_03) located at position 8,943,574 of chromosome D07 in upland cotton is significantly associated with the first node height trait (P<0.001). The discovery of this site fills the gap in the existing technology for the lack of molecular markers specific to first node height, and provides a novel molecular target for cotton plant type improvement and the breeding of varieties suitable for machine harvesting.

[0034] (2) The detection method is efficient and accurate: The KASP marker primer set (KASP_PIEP-F1 / F2 / R) developed based on this SNP site can accurately distinguish different genotypes (T / T, T / C, C / C). KASP technology has the advantages of high genotyping accuracy (>99.5%), simple operation, flexible throughput, low cost, and low requirements for DNA quality, and is suitable for large-scale breeding screening.

[0035] (3) Significant verification of the technical effect: Independent verification in F2:3 segregating population (100 accessions) and natural population (66 accessions) showed that there was a highly significant difference between the genotype detected by the marker and the initial node height phenotype (P<0.01). Among them, the T / T genotype material showed high initial node height, and the C / C genotype material showed low initial node height. The correspondence between genotype and phenotype was clear and stable.

[0036] (4) High breeding application value: This invention enables early and rapid genotypic screening of the first node height trait during the cotton seedling stage, without waiting for the plants to mature for field measurement. This significantly shortens the breeding cycle, improves selection efficiency, and reduces the workload and cost of field screening, making it particularly suitable for large-scale, high-efficiency breeding projects of suitable machine-harvested cotton varieties. Attached Figure Description

[0037] Figure 1Differences in the first segment height trait between the two parents, scatter plot of the KASP marker genotype developed by D07_03, and phenotypic differences between the two genotypes.

[0038] Figure 2 Scatter plots of natural population materials were created using the initial segment height phenotype combined with KASP marker genotypes. One-way ANOVA was used, with ** representing highly significant differences. Detailed Implementation

[0039] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0040] Example 1: Obtaining and Verifying SNP Sites

[0041] 1.1 Experimental Materials

[0042] Using upland cotton materials Z3-146 (high initial node height) and Z3-147 (low initial node height) with significant differences in initial node height phenotype as parents, a segregating F2 population was constructed. From this population, 30 offspring with extremely high initial node height and 30 offspring with extremely low initial node height were selected to construct an extreme mixed population (BSA population).

[0043] 1.2 BSA-seq localization

[0044] Genomic DNA was extracted from parental plants and mixed pool materials using the CTAB method. After testing the purity and integrity of the DNA, libraries were constructed and high-throughput sequencing was performed. Sequencing data were quality-controlled and compared with the upland cotton standard reference genome (TM-1). QTL localization was performed using SNP index association analysis.

[0045] 1.3 Location Results

[0046] A QTL associated with the initial segment height trait was located and named qFBH7, located at positions 8,379,614 to 10,628,581 on chromosome D07 (based on the TM-1 reference genome). Ten candidate sites based on SNP variations were developed within this QTL region.

[0047] 1.4 Screening of key SNP sites

[0048] Using the aforementioned 10 SNP loci as targets, KASP genotyping primers were designed to perform genotyping on the parental Z3-146, Z3-147, and F2 progeny materials. A single SNP locus was ultimately identified, located at position 8,943,574 of chromosome D07 (named D07_03), exhibiting significant polymorphism among the parents: the genotype at this locus was T / T for Z3-146 and C / C for Z3-147. The genotype of this locus in the BSA-seq sequencing data was completely consistent with the KASP marker detection results, indicating that the sequencing data was accurate and that this locus could be used for subsequent molecular marker development.

[0049] The nucleotide sequence of the SNP site D07_03 (150 bp upstream and downstream, 301 bp in total) is shown in SEQ ID NO:1, wherein the 151st base is T (high-initial-membered high-associated allele) or C (low-initial-membered high-associated allele).

[0050] Example 2: Design and Synthesis of KASP-Labeled Primers

[0051] 2.1 Primer Design

[0052] Using SNP site D07_03 as the core, flanking sequences of 150 bp upstream and downstream were obtained. Three specific primers were designed using DNAMAN software and the online primer design tool Primer3, following the KASP marker primer design principles:

[0053] The first upstream primer (KASP_PIEP-F1): The 3' end base of this primer matches the T allele, and the 5' end is connected to the universal adapter sequence of the FAM fluorescent group (GAAGGTGACCAAGTTCATGCT).

[0054] The second upstream primer (KASP_PIEP-F2): The 3' end of this primer matches the C allele, and the 5' end is connected to the universal adapter sequence of the HEX fluorescent group (GAAGGTCGGAGTCAACGGATT).

[0055] Downstream primer (KASP_PIEP-R): Universal reverse primer, without fluorescent label.

[0056] 2.2 Primer Sequences

[0057] The specific nucleotide sequences of the three primers are as follows:

[0058] 2.3 Primer Synthesis

[0059] The primers were synthesized by General Biotech Co., Ltd. (Anhui, China), purified by HPLC, and stored as lyophilized powder. Before use, they were diluted with TE buffer (pH 8.0) to the working concentration (50 μM for each upstream primer and 50 μM for each downstream primer), aliquoted, and stored at -20℃ protected from light.

[0060] Example 3: Validation of KASP markers in an F2:3 segregating population

[0061] 3.1 Experimental Materials

[0062] One hundred families from an F2:3 segregating population constructed using high-initial-node high-parental Z3-146 (T / T) and low-initial-node high-parental Z3-147 (C / C) were used as validation materials.

[0063] 3.2 DNA Extraction

[0064] Young leaves from various cotton seedling lines were collected during the seedling stage. Genomic DNA was extracted using the "High-Efficiency Plant Genomic DNA Extraction Kit (DP350)" from Tiangen Biotech (Beijing) Co., Ltd., following the manufacturer's instructions. The extracted DNA was examined for integrity using 1% agarose gel electrophoresis (clear main band without tailing) and purity was determined using a spectrophotometer (OD260 / OD280 between 1.8 and 2.2, OD260 / OD230 ≥ 1.0). Qualified DNA samples were diluted to the working concentration (5-50 ng / μl) and stored at -20℃ for later use.

[0065] 3.3 KASP Reaction System

[0066] KASP 2× Master Mix (containing Taq DNA polymerase, FAM / HEX universal fluorescent probe, dNTPs, buffer, MgCl2, and ROX reference dye, purchased from LG Chemical) was used. A 2 μl reaction mixture was prepared in each well of a 96-well plate as follows:

[0067]

[0068] Set up a blank control (NTC) without template DNA, and set up 3 technical replicates for each sample.

[0069] 3.4 PCR Amplification Program

[0070] Place the prepared reaction system in an ABI StepOnePlus real-time quantitative PCR instrument and amplify according to the following program: Step 1: Pre-denaturation 95°C 15 min cycle 1; Step 2: Denaturation 95°C 20 s cycle 10, Annealing / Extension 61-55°C 60 s cycle 10; Step 3: Denaturation 95°C 20 s cycle 28, Annealing / Extension 55°C 60 s cycle 28.

[0071] After amplification, the endpoint fluorescence signal was detected using a fluorescence microplate reader or a real-time quantitative PCR instrument. FAM was used for excitation at 485 nm and emission at 520 nm; HEX was used for excitation at 535 nm and emission at 556 nm; ROX was used as an internal reference with excitation at 585 nm and emission at 610 nm.

[0072] 3.5 Genotype determination

[0073] Determine the sample genotype based on the type of endpoint fluorescence signal:

[0074] T / T homozygous: Only FAM fluorescence signal was detected (blue / green, depending on the instrument display setting);

[0075] C / C homozygous: Only HEX fluorescence signal (red) was detected;

[0076] T / C hybrid: Simultaneous detection of FAM and HEX fluorescence signals (orange / mixed color);

[0077] NTC / Invalid: No fluorescence signal or weak signal.

[0078] 3.6 Phenotypic Survey

[0079] After the cotton boll opening stage, 10 representative plants were selected consecutively from each plot in the field, and the height from the cotyledon node to the first fruiting branch was measured. The average value was taken as the initial node height of the material (unit: cm). A uniform standard was maintained during measurement to avoid human error.

[0080] 3.7 Results Analysis

[0081] Genotype and phenotypic data were organized using Excel 2021, and independent samples t-tests were performed using SPSS 25.0 software to compare the significance of the difference in initial segment height between the T / T genotype group and the C / C genotype group.

[0082] 3.8 Verification Results

[0083] KASP genotyping results showed that the fluorescence signal aggregation at the D07_03 locus was good in 100 F2:3 families, and the genotypes were clear. Three genotypes were detected: T / T, C / C, and T / C. Among them, there were 32 T / T families, 41 C / C families, and 27 T / C families.

[0084] Phenotypic data analysis showed that the mean initial node height was 22.36 ± 2.15 cm in T / T genotype families, 13.85 ± 1.92 cm in C / C genotype families, and 18.22 ± 1.76 cm in T / C heterozygous families. Independent samples t-tests indicated that the difference in initial node height between the T / T and C / C genotypes was statistically significant (P < 0.001, ***). These results demonstrate that the SNP locus D07_03 is highly significantly associated with the initial node height trait in cotton, and the developed KASP marker can effectively distinguish materials with different initial node height phenotypes (see [link to relevant documentation]). Figure 1 ).

[0085] Example 4: Validation of KASP markers in natural populations

[0086] 4.1 Experimental Materials

[0087] We collected 66 representative germplasm resources of natural upland cotton populations, including main varieties cultivated in Xinjiang, inland varieties, and imported materials, covering different plant types and ranges of initial node height.

[0088] 4.2 DNA extraction and genotyping

[0089] Following the methods in Examples 3.2 and 3.3-3.5, leaf DNA was extracted from 66 materials, and genotyping was performed using the KASP primer set designed in Example 2.

[0090] 4.3 Phenotypic Survey

[0091] Similar to Example 3.6, the initial node height of each material was measured under the same field conditions (randomized block design, 3 replicates), and the average value was taken.

[0092] 4.4 Statistical Analysis

[0093] One-way ANOVA was used to compare the differences in initial segment height among different genotype groups.

[0094] 4.5 Verification Results

[0095] Among the 66 natural populations, three genotypes were detected: 21 T / T genotype materials, 30 C / C genotype materials, and 15 T / C heterozygous materials. The genotyping results were good, with concentrated fluorescence signals and no discrete points. The 66 natural populations mainly originated from the inland cotton-growing areas of Northwest China, and all were major upland cotton varieties cultivated in recent years, including Xinluzhong, Xinluzao series, Tahe No. 2, and J8031.

[0096] Phenotypic analysis showed that the average initial node height was 20.85 ± 2.43 cm for the T / T genotype, 12.36 ± 1.88 cm for the C / C genotype, and 16.47 ± 2.01 cm for the T / C heterozygous material. One-way ANOVA showed that the differences in initial node height among the three groups were highly significant (P < 0.01, **) (see [link to ANOVA]). Figure 2 ).

[0097] The above results further confirm that the SNP molecular marker D07_03 is significantly associated with the first node height trait under different genetic backgrounds, and has good universality and stability.

[0098] Example 5: Application of KASP markers in cotton breeding

[0099] 5.1 Screening for high-strength, high-return materials (suitable for machine mining)

[0100] Using 200 cotton germplasm resources to be screened as materials, leaf DNA was extracted and KASP genotyping was performed using the method described in Example 3. Materials with the T / T genotype at the D07_03 locus were selected as candidate materials for high-first-node high-yield varieties. Compared with traditional field phenotypic selection, this method can complete screening at the seedling stage (3-4 leaf stage), eliminating the need to wait for boll opening before measurement, thus saving time and field space. The screened T / T materials can be directly used as high-first-node high-yield parents for hybridization or directly entered into variety comparison trials.

[0101] 5.2 Auxiliary selection of low initial section high material

[0102] In early generations of breeding (such as F2 or BC1F2 populations), seedling KASP genotyping is performed on individual plants from the segregating population. If the breeding goal is low initial node height (e.g., for special plant type research), then individual plants with genotype C / C are selected for retention and subsequent planting, while T / T and most T / C individuals are eliminated, which can significantly reduce the scale of field planting and the workload of phenotypic identification.

[0103] 5.3 Result Validation

[0104] An application trial in an F2 segregating population (300 plants) showed that the 30 T / T homozygous plants selected using this marker at the seedling stage had an average first node height of 21.8 cm (range 18.5-24.2 cm) after fluffing, achieving 96.7% consistency with the high first node height phenotype in the field; the 45 C / C homozygous plants selected had an average first node height of 12.1 cm (range 9.8-14.5 cm), achieving 93.3% consistency with the low first node height phenotype. These results indicate that this marker has extremely high selection accuracy and application value.

[0105] Example 6: Specificity and stability verification of KASP markers

[0106] 6.1 Specificity Validation

[0107] Fifty materials with known extreme primordial height phenotypes were selected (25 with high primordial height and 25 with low primordial height), and blind testing was performed using the KASP marker of this invention. The results showed that among the 25 high primordial height materials, 24 were T / T genotypes, 1 was T / C heterozygous, and none were C / C genotypes; among the 25 low primordial height materials, 23 were C / C genotypes, 2 were T / C heterozygous, and none were T / T genotypes. The sensitivity (true positive rate) was 96%, the specificity (true negative rate) was 92%, and the overall concordance rate was 94%. For the T / C heterozygous materials, the intermediate phenotype also met expectations.

[0108] 6.2 Repeatability Validation

[0109] Twenty samples were randomly selected and KASP tests were performed three times independently by different operators at three different time points. The results showed that the genotype determination results of all samples were completely consistent three times (100% repetition rate), demonstrating that this marker has good technical stability.

[0110] 6.3 Platform Suitability Verification

[0111] The KASP marker of this invention was validated on three different models of real-time quantitative PCR instruments: ABI StepOnePlus, Roche LightCycler 480, and Bio-Rad CFX96. The results showed that the genotyping effect was good and the fluorescence signal aggregation was clear, indicating that the marker has good instrument platform universality.

[0112] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with cotton initial node height, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1, wherein the base at position 151 is either T or C.

2. The SNP molecular marker according to claim 1, characterized in that, The SNP molecular marker is located at position 8,943,574 on chromosome D07 of upland cotton, and its polymorphism is T / C.

3. A KASP primer set for detecting the SNP molecular marker of claim 1 or 2, characterized in that, The primer set includes: The first upstream primer has the nucleotide sequence shown in SEQ ID NO:2; The second upstream primer has the nucleotide sequence shown in SEQ ID NO:3; The downstream primer has the nucleotide sequence shown in SEQ ID NO:

4.

4. A reagent kit for identifying or assisting in the identification of the initial node height of cotton, characterized in that, It includes the KASP primer set as described in claim 3.

5. A method for determining the height of the first node in cotton, characterized in that, Includes the following steps: (1) Extract genomic DNA from the cotton sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using the KASP primer set described in claim 3; (3) Detect the fluorescence signal of the PCR amplification product and determine the genotype of the cotton sample to be tested at the SNP site D07_03 based on the fluorescence signal; (4) Predict the first node height phenotype of the cotton to be tested based on genotype: if the genotype is T / T, it is predicted to be high first node height phenotype or has high first node height potential; if the genotype is C / C, it is predicted to be low first node height phenotype or has low first node height potential; if the genotype is T / C, it is predicted to be medium first node height phenotype or heterozygous.

6. The method according to claim 5, characterized in that, The PCR amplification reaction system in step (2) is a mixture of KASP2× Master Mix, primer set and template DNA; the PCR amplification program includes: pre-denaturation at 95°C for 15 min; 10 cycles of denaturation at 95°C for 20 s, annealing / extension at 61-55°C for 60 s; and 28 cycles of denaturation at 95°C for 20 s, annealing / extension at 55°C for 60 s.

7. The application of the SNP molecular marker of claim 1 or 2, or the KASP primer set of claim 3, or the kit of claim 4 in cotton breeding or cotton resource screening.

8. The application according to claim 7, characterized in that, The application is to screen or breed cotton varieties suitable for mechanical harvesting.

Images