KASP molecular marker for identifying hybrid pennisetum cv. sumu 4 and application thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- JIANGSU ACAD OF AGRI SCI
- Filing Date
- 2026-07-03
- Publication Date
- 2026-08-07
AI Technical Summary
[0006]然而,在杂交狼尾草领域,针对苏牧4号等具体品种(系)的特异性KASP分子标记开发尚属空白
[0057]本发明提供的4个KASP分子标记的引物可以快速、精准地实现苏牧4号的高通量检测,操作简便,精准度高,检测周期短。
Smart Images

Figure CN122521902A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular genetics technology, and in particular relates to a KASP molecular marker for identifying hybrid Napier grass Sumu 4 and its application. Background Technology
[0002] Hybrid Pennisetum glaucum × P. purpureum is a general term for interspecific hybrids obtained by crossing diploid American Pennisetum glaucum and tetraploid elephant grass (Pennisetum purpureum). It combines the advantages of American Pennisetum glaucum, which has excellent feed quality and palatability, with elephant grass, which has high biomass yield and strong stress resistance. It can be used as a high-quality green fodder for herbivorous livestock and poultry and omnivorous fish. It is also an ideal high-quality raw material for pulp and wood-based panels. In addition, it can be used as an important biomass energy crop and a plant for soil and water conservation and ecological restoration.
[0003] With the rapid development of the hybrid Napier grass industry, new varieties (lines) are constantly emerging. Among them, Sumu No. 4 is the latest hybrid Napier grass line, a three-line interspecific hybrid with the independently bred American Napier grass sterile line L23A as the female parent and the nationally approved variety Sumu No. 2 elephant grass as the male parent. It was selected for the national grass variety regional trial in 2023 and has shown outstanding performance in terms of hay yield, crude protein content, cold resistance, and salt tolerance, with broad prospects for promotion and application. However, Sumu No. 4 belongs to the hybrid Napier grass type, similar to existing nationally approved varieties such as Bangde No. 1 and Minmu No. 6. Different varieties (lines) have similar botanical characteristics, especially in the seedling or vegetative growth stage. It is difficult to accurately distinguish them based solely on agronomic traits such as plant height, leaf shape, and spike type. This has brought great difficulties to the identification of the authenticity of Sumu No. 4, seed purity testing, and protection of the new variety's specificity.
[0004] Traditional methods for variety identification mainly rely on morphological markers. However, these markers are easily affected by environmental conditions, cultivation practices, and growth stages, resulting in long identification cycles and low accuracy. This makes it difficult to meet the rapid, high-throughput variety testing needs of new varieties such as Sumu 4. Although first-generation molecular marker technologies based on SSRs (simple sequence repeats) have been applied in the identification of some forage varieties, they have limitations such as limited locus information, low throughput, cumbersome operation procedures, and high costs, making them unsuitable for large-scale variety screening and standardized testing of Sumu 4.
[0005] In recent years, KASP marker technology based on single nucleotide polymorphisms (SNPs) has been widely used in crop genetics research and molecular breeding due to its unique advantages of high throughput, high accuracy, low cost, and suitability for large-scale germplasm screening. This technology accurately identifies SNP sites using specific primers, effectively distinguishing different genotypes. It has been successfully applied to various crops such as maize, rice, soybean, and millet, enabling functions such as genotyping, gene mapping, marker-assisted selection, and genetic mapping, providing efficient support for crop breeding.
[0006] However, in the field of hybrid Napier grass, the development of specific KASP molecular markers for specific varieties (lines) such as Sumu 4 is still lacking. Existing research mainly focuses on the evaluation of genetic diversity and population structure analysis of germplasm resources, lacking a marker SNP locus and supporting detection system that can accurately distinguish Sumu 4 from existing approved varieties. Therefore, establishing a set of markers based on KASP technology specifically for the molecular identification of new hybrid Napier grass lines such as Sumu 4 is of significant practical importance and application value for the rapid identification of Sumu 4, variety rights protection, seed market supervision, and the promotion and application of improved varieties. Summary of the Invention
[0007] The purpose of this invention is to solve the problem of rapid molecular identification of hybrid Napier grass Sumu 4, to establish a set of molecular markers based on KASP technology for the detection of new hybrid Napier grass lines and approved varieties, and to use these molecular markers for the detection of new hybrid Napier grass lines and approved varieties, as well as to assist in the breeding of new hybrid Napier grass lines.
[0008] The technical solution adopted by this invention to solve its technical problem is:
[0009] In a first aspect, this invention protects primers for identifying the KASP molecular marker of hybrid Napier grass Sumu 4, wherein the KASP molecular marker has forward specific primers and reverse universal primers corresponding to the following four sites.
[0010] (1) KASP-Pgrs1 marker: at chr1-271125125,
[0011] Forward specific primer Primer_Allele X-1: as shown in SEQ ID NO.1;
[0012] Forward specific primer Primer_Allele Y-1: as shown in SEQ ID NO.5;
[0013] Reverse universal primer Primer_Common-1: as shown in SEQ ID NO.9;
[0014] (2) KASP-Pgrs2 marker: at chr4-52353379,
[0015] Forward specific primer Primer_Allele X-2: as shown in SEQ ID NO.2;
[0016] Forward specific primer Primer_Allele Y-2: as shown in SEQ ID NO.6;
[0017] Reverse universal primer Primer_Common-2: as shown in SEQ ID NO.10;
[0018] (3) KASP-Pprs3 marker: at chrB5-108092276,
[0019] Forward specific primer Primer_Allele X-3: as shown in SEQ ID NO.3;
[0020] Forward specific primer Primer_Allele Y-3: as shown in SEQ ID NO.7;
[0021] Reverse universal primer Primer_Common-3: as shown in SEQ ID NO.11;
[0022] (4) KASP-Pprs4 marker: at chrB6-172356361,
[0023] Forward specific primer Primer_Allele X-4: as shown in SEQ ID NO.4;
[0024] Forward specific primer Primer_Allele Y-4: as shown in SEQ ID NO.8;
[0025] Reverse universal primer Primer_Common-4: as shown in SEQ ID NO.12.
[0026] In the specific implementation plan, when the genotype of KASP-Pgrs1 is T:T, the genotype of KASP-Pgrs2 is G:G, the genotype of KASP-Pprs3 is G:G, and the genotype of KASP-Pprs4 is G:G, it indicates that the sample to be tested is hybrid Napier grass Sumu 4.
[0027] Secondly, the present invention protects a reagent for identifying the KASP molecular marker of hybrid Napier grass Sumu 4, said reagent containing the primers described above.
[0028] Thirdly, this invention protects a kit for identifying the KASP molecular marker of hybrid Napier grass Sumu 4, the kit containing the primers or reagents described above.
[0029] Fourthly, this invention protects the use of the primers, reagents, or kits described above in any of the following:
[0030] (A1) Identification or auxiliary identification of hybrid Napier grass Sumu No. 4;
[0031] (A2) To prepare products for identification or to assist in the identification of hybrid Napier grass Sumu 4;
[0032] (A3) Identify or assist in identifying whether the sample to be tested is hybrid Napier grass Sumu No. 4;
[0033] (A4) Preparation for identification or auxiliary identification of whether the sample to be tested is a product of hybrid Napier grass Sumu 4;
[0034] (A5) To identify or assist in identifying whether the confused sample contains hybrid Napier grass Sumu No. 4;
[0035] (A6) Prepare an identification or auxiliary identification of whether a confused sample contains hybrid Napier grass Sumu No. 4.
[0036] Fifthly, the present invention protects a method for identifying or assisting in the identification of hybrid Napier grass Sumu 4, the method comprising the following steps: extracting DNA from the sample to be tested, and then using the primers described above to perform PCR amplification and genotyping on the extracted DNA; when the KASP-Pgrs1 genotype is T:T, the KASP-Pgrs2 genotype is G:G, the KASP-Pprs3 genotype is G:G, and the KASP-Pprs4 genotype is G:G, the sample to be tested is hybrid Napier grass Sumu 4.
[0037] Sixthly, the present invention protects a method for identifying or assisting in the identification of whether a confused sample contains hybrid Napier grass Sumu 4, the method comprising the following steps: extracting DNA from the sample to be tested, and then performing PCR amplification and genotyping on the extracted DNA using the primers described above; when the genotype at the KASP-Pgrs1 locus is T:T, the genotype at the KASP-Pgrs2 locus is G:G, the genotype at the KASP-Pprs3 locus is G:G, and the genotype at the KASP-Pprs4 locus is G:G, the sample to be tested is hybrid Napier grass Sumu 4.
[0038] In a specific implementation plan, the method includes the following steps:
[0039] (1) Extract sample DNA from the leaves of the hybrid Napier grass material to be tested, prepare a PCR reaction system containing the aforementioned primers, KASP Mastermix, sample DNA and ddH2O, and perform PCR amplification;
[0040] (2) Scan the PCR amplification product obtained after step (1) with fluorescence signal, and analyze the scanned fluorescence signal to obtain a scatter plot of genotyping. Based on the analysis results of the scatter plot, determine the type of bases at the four marker sites of the hybrid Napier grass to be tested.
[0041] In a specific implementation plan, in step (1), DNA is extracted from the leaves of the hybrid Napier grass to be tested using the SDS method.
[0042] In the specific implementation scheme, in the PCR reaction system of step (1), the mass of the sample DNA template is 50 ng, 2×KASP Master mix 0.4 μL, Primer_Allele X 0.0012 μL (mother liquor concentration 100 μM), Primer_Allele Y 0.0012 μL (mother liquor concentration 100 μM), Primer_Common 0.0030 μL (mother liquor concentration 100 μM), and then water is added to make up to 0.8 μL of the final system.
[0043] Among them, Primer_Allele X refers to the forward-specific primers Primer_Allele X-1, Primer_Allele X-2, Primer_Allele X-3, and Primer_AlleleX-4.
[0044] Among them, Primer_Allele Y refers to the forward-specific primers Primer_Allele Y-1, Primer_Allele Y-2, Primer_Allele Y-3, and Primer_Allele Y-4.
[0045] Among them, Primer_Common refers to the reverse universal primers Primer_Common-1, Primer_Common-2, Primer_Common-3, and Primer_Common-4.
[0046] In the specific implementation plan, the PCR amplification procedure in step (1) is as follows:
[0047] Step 1: Pre-denaturation at 94 ℃ for 15 min;
[0048] Step 2: Denaturation at 95 ℃ for 20 s, followed by annealing and extension at 65 ℃-56 ℃ for 60 s, for a total of 10 cycles, with the temperature decreasing by 0.8 ℃ in each cycle;
[0049] Step 3: Denature at 94 ℃ for 20 s, then anneal and extend at 57 ℃ for 60 s, for a total of 30 cycles, to obtain the PCR amplification product.
[0050] In a specific implementation plan, in step (2), an ARAYA instrument is used to scan fluorescence signals, and then INTELLICS is used for data analysis and genotype classification. The horizontal axis of the scatter plot represents the HEX fluorescence value, and the vertical axis represents the FAM fluorescence value. The coordinates of the scatter points in the scatter plot are the fluorescence values of the samples represented by those scatter points.
[0051] In a specific implementation plan, in step (2), the genotypes of the four loci in the hybrid Napier grass to be tested are determined based on the analysis results of the scatter plot, and the molecular specificity between the new Sumu No. 4 line and the currently approved varieties is determined. The specific operation includes the following steps: observe the scatter plot. The scatter points displayed near the origin of the coordinate axis are blank controls, and the scatter points displayed not near the origin of the coordinate axis indicate that fluorescence is detected. Among them, the scatter points displayed near the vertical axis indicate that only FAM fluorescence is detected, the scatter points displayed near the horizontal axis indicate that only HEX fluorescence is detected, and the scatter points displayed far from both the horizontal and vertical axes indicate that both FAM fluorescence and HEX fluorescence are detected.
[0052] In the KASP-Pgrs1 marker detection, scatter plots near the ordinate axis indicate a T:T genotype at the chr1-271125125 locus in *Pennisetum oleraceum*, scatter plots near the abscissa axis indicate a C:C genotype at the chr1-271125125 locus in *Pennisetum oleraceum*, and scatter plots far from both the abscissa and ordinate axes indicate a heterozygous T:C genotype at the chr1-271125125 locus in *Pennisetum oleraceum*.
[0053] In the KASP-Pgrs2 marker detection, scatter plots near the ordinate axis indicate a G:G genotype at the chr4-52353379 locus in *Pennisetum oleraceum*, scatter plots near the abscissa axis indicate an A:A genotype at the chr4-52353379 locus in *Pennisetum oleraceum*, and scatter plots far from both the abscissa and ordinate axes indicate a heterozygous G:A genotype at the chr4-52353379 locus in *Pennisetum oleraceum*.
[0054] In the KASP-Pprs3 marker detection, scatter plots near the ordinate axis represent genotypes of A:A at the elephant grass chrB5-108092276 locus, scatter plots near the abscissa axis represent genotypes of G:G at the elephant grass chrB5-108092276 locus, and scatter plots far from both the abscissa and ordinate axes represent heterozygous genotypes of A:G at the elephant grass chrB5-108092276 locus.
[0055] In the KASP-Pprs4 marker detection, scatter plots near the ordinate axis indicate a G:G genotype at the elephant grass chrB6-172356361 locus, scatter plots near the abscissa axis indicate an A:A genotype at the elephant grass chrB6-172356361 locus, and scatter plots far from both the abscissa and ordinate axes indicate a heterozygous G:A genotype at the elephant grass chrB6-172356361 locus.
[0056] Beneficial effects
[0057] The primers for the four KASP molecular markers provided by this invention can achieve rapid and accurate high-throughput detection of Sumu 4, with simple operation, high accuracy and short detection cycle. Attached Figure Description
[0058] Figure 1 Results of KASP-Pgrs1 marker detection in the genome of hybrid Napier grass (Penaeus chinensis);
[0059] Figure 2 Results of KASP-Pgrs2 marker detection in the genome of hybrid Napier grass (Penaeus chinensis);
[0060] Figure 3 Results of KASP-Pprs3 marker detection in the genome of hybrid Napier grass and elephant grass;
[0061] Figure 4 Results of KASP-Pprs4 marker detection in the genome of hybrid Napier grass and elephant grass. Detailed Implementation
[0062] The present invention will be further described below with reference to embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention. Any simple improvements to the preparation method of the present invention under the premise of the concept of the present invention are within the protection scope of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally carried out in accordance with well-known means in the art.
[0063] Example 1: Development of KASP molecular markers from the genomes of hybrid Napier grass (Central American Napier grass and elephant grass)
[0064] Based on the resequencing dataset of 200 core germplasm resources of *Napier grass* and *Elephant grass* constructed through extensive collection and mutagenesis treatment, and the resequencing results of *Sumu 4*, SNP sites in the genomes of hybrid *Napier grass* and *Elephant grass* were screened to develop KASP markers. The screening process first involved preliminary filtering based on the conservation of 150 bp sequences upstream and downstream of the SNP. Then, standardized quality control was performed, retaining SNPs with an average sequencing depth of at least 5, a quality score (Qual) of at least 30, a data integrity score of at least 0.9, a minor allele frequency (MAF) of at least 0.05, and being biallelic. To exclude non-specific amplification caused by genomic repetitive regions, 150 bp flanking sequences upstream and downstream were extracted and aligned to the reference genome (http: / / milletdb.novogene.com / home / ) using BLAST, eliminating candidate sites with multiple alignments. Based on this, sites with a polymorphism information content (PIC) greater than 0.35 were further screened. Through the above process, four SNP sites in the *Phragmites australis* genome were found to be specific to each material: T / C at chr1-271125125, G / A at chr4-52353379, C / G at chr4-199613509, and C / T at chr6-4282318. Similarly, four SNP sites in the *Elephantgrass* genome were found to be specific to each material: C / T at chrA5-32360650, A / T at chrB5-5975600, A / G at chrB5-108092276, and G / A at chrB6-172356361.
[0065] Based on the 150 bp sequence information upstream and downstream of the specific SNP site, KASP primers were designed using Bacthprimer 3 software. Each KASP marker consisted of two specific primers and one universal primer. The designed primers were then screened for sequence specificity by BLAST alignment with the reference genome (http: / / milletdb.novogene.com / home / ). Primers designed for two SNP sites in the *Phragmites australis* genome are specific and can be used as KASP markers, named KASP-Pgrs1: chr1-271125125 and KASP-Pgrs2: chr4-52353379. The 150 bp sequences upstream and downstream of KASP-Pgrs1 are shown in SEQ ID NO.13, and the 150 bp sequences upstream and downstream of KASP-Pgrs2 are shown in SEQ ID NO.14. Primers designed for two SNP sites in the *Elephantgrass* genome are specific and can be used as KASP markers, named KASP-Pprs3: chrB5-108092276 and KASP-Pprs4: chrB6-172356361. The 150 bp sequences upstream and downstream of KASP-Pprs3 are shown in SEQ ID NO.15, and the 150 bp sequences upstream and downstream of KASP-Pprs4 are shown in SEQ ID NO.16. Fluorescent linker sequences were attached to the 5' end of the specific primers (GAAGGTGACCAAGTTCATGCT is the FAM (6-carboxyfluorescein) fluorescent linker sequence, as shown in SEQ ID NO.17; GAAGGTCGGAGTCAACGGATT is the HEX (hexachloro-6-carboxyfluorescein) fluorescent linker sequence, as shown in SEQ ID NO.18). The forward specific primers Primer_Allele X for KASP-Pgrs1, KASP-Pgrs2, KASP-Pprs3, and KASP-Pprs4 are SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively; the forward specific primers Primer_Allele Y are SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8, respectively; and the reverse universal primers Primer_Common are SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12, respectively (Table 1).
[0066] Table 1. KASP-specific primers for Sumu No. 4 hybrid Napier grass
[0067]
[0068] Example 2 Identification of KASP molecular markers in hybrid Napier grass
[0069] Based on the KASP marker design results, allele detection and verification were conducted on the new Sumu 4 line and currently approved hybrid Napier grass and elephant grass varieties using the four KASP molecular markers from Example 1 at the chr1-271125125, chr4-52353379 loci of the American Napier grass genome and the chrB5-108092276, chrB6-172356361 loci of the elephant grass genome. Materials included the new Sumu 4 line and hybrid Napier grass varieties such as Bangde 1, Minmu 6, Reyan 4, South China elephant grass, purple elephant grass, and Jinmuliangcao. The first nationally approved hybrid Napier grass variety in China (introduced in 1980 and approved nationally in 1989) and the female parent of Sumu 4 hybrid Napier grass, the American Napier grass sterile line L23A, served as positive controls.
[0070] Specific steps: DNA was extracted from 10 hybrid Napier grass and elephant grass materials using the SDS method; a reaction system containing primers, template DNA, and KASP Master mix was prepared using NEXA; 0.8 μL of the reaction system was added to a 96-well PCR microplate, comprising: 50 ng DNA template, 0.4 μL 2×KASP Master mix, 0.0012 μL Primer_Allele X (100 μM stock solution), 0.0012 μL Primer_Allele Y (100 μM stock solution), and 0.0030 μL Primer_Common (100 μM stock solution), then water was added to bring the final volume to 0.8 μL; locus genotyping experiments were performed in the SOELLEX system, and the PCR program included:
[0071] Step 1: Pre-denaturation at 94 ℃ for 15 min;
[0072] Step 2: Denaturation at 95 ℃ for 20 s, followed by annealing and extension at 65 ℃-56 ℃ for 60 s, for a total of 10 cycles, with the temperature decreasing by 0.8 ℃ in each cycle;
[0073] Step 3: Denature at 94 ℃ for 20 s, then anneal and extend at 57 ℃ for 60 s, for a total of 30 cycles, to obtain the PCR amplification product.
[0074] The fluorescence signals of PCR amplification products were scanned using an ARAYA instrument, and the scanned fluorescence signals were analyzed. The results were converted into scatter plots of genotyping and fluorescence values (e.g., Figure 1(As shown). Scatter plots and FAM / HEX fluorescence values of each PCR amplification product were obtained from the analysis. Each point in the scatter plot represents the fluorescence value of a corresponding sample, with the horizontal axis representing the HEX fluorescence value (533-580 nm) and the vertical axis representing the FAM fluorescence value (465-510 nm).
[0075] The judgment criteria are as follows: gray scatter dots near the origin of the coordinate axis represent blank controls; scatter dots not near the origin of the coordinate axis represent detected fluorescence; red scatter dots near the vertical axis represent only detected FAM fluorescence; blue scatter dots near the horizontal axis represent only detected HEX fluorescence; purple scatter dots far from both the horizontal and vertical axes represent simultaneous detection of both FAM and HEX fluorescence; gray scatter dots represent the negative control for this experiment.
[0076] In the genome of *Pennisetum oleraceum*, the KASP-Pgrs1 marker at the chr1-271125125 site indicates that the base at this location is C (blue dots) near the horizontal axis and T (red dots) near the vertical axis. Figure 1 The results show the detection results at the chr1-271125125 site in the genome of *Nymphaea gracilis*; the red dots near the vertical axis indicate that the base at the chr4-52353379 site, which is labeled with KASP-Pgrs2, are G. Figure 2 The results are from the detection of the chr4-52353379 locus in the genome of *Nymphoides gracilis*.
[0077] In the elephant grass genome, the KASP-Pprs3-tagged chrB5-108092276 site is represented by blue dots near the horizontal axis, red dots near the vertical axis, and purple dots far from both the horizontal and vertical axes, indicating a heterozygous A:G site. Figure 3 The results are for the detection at the chrB5-108092276 site in the elephant grass genome; the KASP-Pprs4 labeled chrB6-172356361 site, blue dots near the horizontal axis indicate that the base at this site is A; red dots near the vertical axis indicate that the base at this site is G. Figure 4 The results are from the detection at the chrB6-172356361 site in the elephant grass genome.
[0078] The statistical results obtained by the above detection methods are shown in Table 2. The new Sumu No. 4 strain can be distinguished from other approved varieties of the genus Napier through these four KASP markers, indicating that the KASP molecular markers of the present invention can accurately identify the new Sumu No. 4 strain. Moreover, the detection method is simple, fast and accurate, which is of great significance for the genetic specificity identification of new Napier strains.
[0079] Table 2. Identification results of KASP markers for the new hybrid Napier grass line Sumu No. 4 and Napier grass varieties.
[0080]
[0081] The scope of protection of this invention is not limited to the above embodiments. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in this invention and are protected by the appended claims.
Claims
1. A primer for identifying the KASP molecular marker of hybrid Napier grass Sumu 4, characterized in that, The KASP molecular marker has the following four site-specific forward primers and reverse universal primers: (1) KASP-Pgrs1 marker: at chr1-271125125, Forward specific primer Primer_Allele X-1: as shown in SEQ ID NO.1; Forward specific primer Primer_Allele Y-1: as shown in SEQ ID NO.5; Reverse universal primer Primer_Common-1: as shown in SEQ ID NO.9; (2) KASP-Pgrs2 marker: at chr4-52353379, Forward specific primer Primer_Allele X-2: as shown in SEQ ID NO.2; Forward specific primer Primer_Allele Y-2: as shown in SEQ ID NO.6; Reverse universal primer Primer_Common-2: as shown in SEQ ID NO.10; (3) KASP-Pprs3 marker: at chrB5-108092276, Forward specific primer Primer_Allele X-3: as shown in SEQ ID NO.3; Forward specific primer Primer_Allele Y-3: as shown in SEQ ID NO.7; Reverse universal primer Primer_Common-3: as shown in SEQ ID NO.11; (4) KASP-Pprs4 marker: at chrB6-172356361, Forward specific primer Primer_Allele X-4: as shown in SEQ ID NO.4; Forward specific primer Primer_Allele Y-4: as shown in SEQ ID NO.8; Reverse universal primer Primer_Common-4: as shown in SEQ ID NO.
12.
2. The primers for identifying the KASP molecular marker of hybrid Napier grass Sumu 4 according to claim 1, characterized in that, When the genotype of KASP-Pgrs1 is T:T, the genotype of KASP-Pgrs2 is G:G, the genotype of KASP-Pprs3 is G:G, and the genotype of KASP-Pprs4 is G:G, it indicates that the sample to be tested is hybrid Napier grass Sumu 4.
3. A reagent for identifying the KASP molecular marker of hybrid Napier grass Sumu 4, characterized in that, The reagent contains the primers as described in claim 1.
4. A kit for identifying the KASP molecular marker of hybrid Napier grass Sumu 4, characterized in that, The kit contains the primers of claim 1 or the reagents of claim 3.
5. The use of the primer of claim 1, the reagent of claim 3, or the kit of claim 4 in any of the following: (A1) Identification or auxiliary identification of hybrid Napier grass Sumu No. 4; (A2) To prepare products for identification or to assist in the identification of hybrid Napier grass Sumu 4; (A3) Identify or assist in identifying whether the sample to be tested is hybrid Napier grass Sumu No. 4; (A4) Preparation for identification or auxiliary identification of whether the sample to be tested is a product of hybrid Napier grass Sumu 4; (A5) To identify or assist in identifying whether the confused sample contains hybrid Napier grass Sumu No. 4; (A6) Prepare an identification or auxiliary identification of whether a confused sample contains hybrid Napier grass Sumu No.
4.
6. A method for identifying or assisting in the identification of hybrid Napier grass Sumu 4, characterized in that, The method includes the following steps: extracting DNA from the sample to be tested, and then using the primers described in claim 1 to perform PCR amplification and genotyping on the extracted DNA. When the genotype of KASP-Pgrs1 is T:T, the genotype of KASP-Pgrs2 is G:G, the genotype of KASP-Pprs3 is G:G, and the genotype of KASP-Pprs4 is G:G, the sample to be tested is hybrid Napier grass Sumu 4.
7. A method for identifying or assisting in the identification of whether a confused sample contains hybrid Napier grass Sumu No. 4, characterized in that, The method includes the following steps: extracting DNA from the sample to be tested, and then using the primers described in claim 1 to perform PCR amplification and genotyping on the extracted DNA. When the genotype at the KASP-Pgrs1 locus is T:T, the genotype at the KASP-Pgrs2 locus is G:G, the genotype at the KASP-Pprs3 locus is G:G, and the genotype at the KASP-Pprs4 locus is G:G, the sample to be tested is hybrid Napier grass Sumu 4.
8. The method according to claim 6 or 7, characterized in that, The sample to be tested is a leaf.
9. The method according to claim 6 or 7, characterized in that, DNA was extracted from the leaves of the test samples using the SDS method.
10. The method according to claim 6 or 7, characterized in that, The procedure for PCR amplification is as follows: Step 1: Pre-denaturation at 94 ℃ for 15 min; Step 2: Denaturation at 95 ℃ for 20 s, followed by annealing and extension at 65 ℃-56 ℃ for 60 s, for a total of 10 cycles, with the temperature decreasing by 0.8 ℃ in each cycle; Step 3: Denature at 94 ℃ for 20 s, then anneal and extend at 57 ℃ for 60 s, for a total of 30 cycles, to obtain the PCR amplification product.