KASP molecular markers and their use in tomato fruit soluble solids content

Abstract

The application discloses a KASP molecular marker and its use in soluble solid content of tomato fruits. The KASP molecular marker is located at position 50724660 of chromosome 2 of a tomato genome, and the allele of the base at the position 50724660 is T or A. By using the KASP molecular marker, rapid, accurate and high-throughput detection of the soluble solid content of the tomato fruits can be realized, so that tomato materials with high soluble solid content can be identified and screened, the breeding period is shortened, and the breeding efficiency is improved.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding, specifically relating to a KASP molecular marker and its use in the soluble solids content of tomato fruit. Background Technology

[0002] Tomatoes are annual herbaceous plants belonging to the genus *Solanum* of the Solanaceae family, widely cultivated worldwide. The flavor quality of tomato fruit is mainly determined by its soluble solids content and volatile aromatic compounds. Changes in sugar content, acidity, and sugar-acid ratio primarily affect the soluble solids content of tomato fruit, thus influencing its flavor (Jennifer, 2014). Soluble solids (SSC) refers to the percentage of solutes in tomato juice, mainly including soluble sugars, organic acids, vitamins, minerals, and volatile substances. The main sugars are glucose, fructose, and sucrose, while the main organic acids are malic acid and citric acid (Baldet et al, 2006). Factors related to sugar and acid metabolism pathways can affect soluble solids content (Fabien et al, 2009). As an important trait for tomato flavor and processing quality, high soluble solids content not only enhances the taste of fresh tomatoes for consumers but also increases processing yield and reduces consumption during processing. For processing tomatoes, a 1% increase in soluble solids content is equivalent to a 25% increase in total yield. Therefore, identifying key genes that regulate the soluble solids content of tomato fruits and elucidating their molecular mechanisms of action is an important aspect of high-quality tomato breeding.

[0003] Genome-wide association study (GWAS) is a method of locating target trait genes and mutation sites by studying the relationship between genetic variation and corresponding traits at the whole-genome level in a large sample. Sauvage et al. used GWAS technology to perform whole-genome sequencing on 163 natural tomato accessions, mining genotypic information for 5995 SNP loci, and finally identifying 44 candidate SNP loci associated with 19 substances in fruit metabolism, including sucrose, glucose, and vitamin C (Sauvage et al, 2014).

[0004] Kompetitive allele-specific PCR (KASP) uses allele-specific primers for PCR amplification and detects the amplified products using fluorescent dyes. It can detect multiple sites in the same reaction system and has advantages such as rapid, accurate and high-throughput detection, and is widely used in breeding work.

[0005] Soluble solids content in tomato fruit is a quantitative trait controlled by multiple genes. Discovering and identifying more KASP molecular markers related to it is of great theoretical and practical significance for the breeding of high-quality new tomato varieties. Summary of the Invention

[0006] In view of the technical problems existing in the prior art, the present invention provides a KASP molecular marker and its use in the soluble solids content of tomato fruit.

[0007] The first aspect of the present invention protects a KASP molecular marker, which is associated with the soluble solids content of tomato fruit and is located at position 50724660 on chromosome 2 of the tomato genome, wherein the allele of the base at position 50724660 is T or A.

[0008] In some implementations, the full genome sequence version of the tomato genome is Solanum lycopersicumITAG3.2.

[0009] A second aspect of the present invention protects a primer set for detecting the KASP molecular marker as described above, the primer set comprising an upstream primer F1, an upstream primer F2, and a downstream universal primer R, wherein the nucleotide sequence of the upstream primer F1 comprises the sequence shown in SEQ ID NO:2, the nucleotide sequence of the upstream primer F2 comprises the sequence shown in SEQ ID NO:3, and the nucleotide sequence of the downstream universal primer R comprises the sequence shown in SEQ ID NO:4.

[0010] In some embodiments, the 5' end of the upstream primer F1 or upstream primer F2 is independently connected to a fluorescent reporter group.

[0011] In some embodiments, the fluorescent reporter group is selected from one or more of FAM, JOE, ROX, TET, TAMRA, HEX, VIC, CY3, CY5 and TexasRed.

[0012] In some specific implementations, the 5' end of the upstream primer F1 is connected to FAM, and the 5' end of the upstream primer F2 is connected to HEX.

[0013] A third aspect of the present invention protects a detection kit comprising the primer set described above.

[0014] In some implementations, the kit also includes 2×KASP Master Mix.

[0015] The fourth aspect of this invention protects the use of the KASP molecular marker described above, or the primer set described above, or the kit described above, in any of the following: (1) Its use in identifying the soluble solids content of tomato fruit; (2) Its use in improving tomato germplasm resources.

[0016] In some implementations, the improved tomato germplasm resources are used to increase the soluble solids content of tomato fruits.

[0017] The fifth aspect of this invention protects a method for identifying the soluble solids content of tomato fruit, comprising the following steps: Using the genomic DNA of the tomato sample as a template, the template was amplified by real-time quantitative PCR using the primer set or kit described above. After the PCR amplification was completed, the fluorescence signal was read, the converted fluorescence signal was analyzed, the genotype was identified, and the soluble solids content of the tomato fruit was determined based on the genotype. If the genotype at position 50724660 is TT, then the soluble solids content of the tomato fruit will be low. If the genotype at position 50724660 is AA, then the tomato fruit will have a high content of soluble solids.

[0018] In some implementations, the forward primer F1, forward primer F2, and universal reverse primer R are mixed in a volume ratio of 12:12:30 in the real-time PCR reaction system (e.g., 10 μL total system: 0.14 μL of mixed primers, 5 μL of 2×KASPMaster Mix (e.g., brand Beijing Kejieda Biotechnology Co., Ltd., catalog number 2503003), 4 μL of genomic DNA, and 0.86 μL of ddH2O).

[0019] In some implementation methods, the reaction conditions for quantitative real-time PCR are as follows: pre-denaturation at 95℃ for 10 min (1 cycle); denaturation at 95℃ for 20 s (10 cycles); annealing / extension at 62-55℃ for 40 s (10 cycles); denaturation at 95℃ for 20 s (32 cycles); annealing / extension at 55℃ for 60 s (32 cycles); incubation at 37℃ for 20 s; and single-point acquisition of fluorescence signals.

[0020] Compared with the prior art, the present invention has the following beneficial effects: KASP molecular markers can be used to sensitively, efficiently, and cost-effectively identify and screen tomato varieties with high soluble solids content, thus improving the overall nutritional value of tomatoes. Simultaneously, KASP molecular marker technology allows for genotyping at early stages of tomato growth (such as the seedling stage), enabling rapid screening of individuals with superior traits, significantly shortening the breeding cycle and improving breeding efficiency. Furthermore, the KASP molecular markers described in this application allow for genotyping of large numbers of samples in a short time without requiring complex experimental equipment and expensive reagents, helping to reduce the production cost of tomato breeding and improve economic benefits. Attached Figure Description

[0021] Figure 1 This study examines the diversity of soluble solids content in the fruits of the three subpopulations (currant tomato, cherry tomato, and cultivated tomato) within the GWAS population in Example 1.

[0022] Figure 2 This is a Manhattan plot of the soluble solids content GWAS in Example 1. The red line indicates a significance threshold of -log 10 (P value)≥6.

[0023] Figure 3 This study analyzed the SNPs associated with the soluble solids content of tomato fruit in Example 1.

[0024] Figure 4 This is a phenotypic diagram showing the isometric variation of soluble solids content at the Ch02_50724660 marker site in 243 materials in Example 1.

[0025] Figure 5 The image shows the KASP genotyping results in Example 3, where blue represents the TT genotype, red represents the AA genotype, and gray represents the blank control. Detailed Implementation

[0026] The present invention will be further described below with reference to specific embodiments. The following examples are merely specific embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It should be noted that the following detailed descriptions are exemplary and are only some embodiments of the present invention, not all embodiments.

[0027] Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0028] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. Experimental methods not specifying detailed conditions are performed according to standard experimental methods or the supplier's recommended operating instructions.

[0029] In the following embodiments of this application, currant tomatoes, cherry tomatoes, and cultivated tomatoes were purchased from the Asian Vegetable Center for the World (materials used in Example 1) or from high-generation inbred lines bred by the research group (materials used in Example 3).

[0030] Example 1: Identification of SNP sites significantly associated with soluble solids content in tomato fruit This embodiment measures the soluble solids content of 243 tomato samples (33 currant tomatoes, 55 cherry tomatoes, and 155 cultivated tomatoes) from the research base of Zhejiang University's Huajiachi Campus using a handheld Abbe refractometer. The results are shown in [Figure number missing]. Figure 1 .

[0031] from Figure 1 It can be seen that, compared with cherry tomatoes, currant tomatoes have a higher soluble solids content, while cultivated tomatoes have a lower soluble solids content.

[0032] Genome-wide association study (GWAS) was performed on the soluble solids content of 243 ripe tomato accessions using a mixed linear model (MLMM) (see Vincent Segura et al., An efficient multi-locus mixed-model approach for genome-wide association studies in structured populations, Nature Genetics. 44, (2012):825–830). Results are shown in […]. Figure 2 .

[0033] from Figure 2 The GWAS analysis showed that there were loci on chromosome 2 of tomato that were significantly associated with soluble solids content.

[0034] Furthermore, a search was conducted within a 200kb range upstream and downstream of the highest associated site (i.e., chromosome 2). Combining the annotation information from the tomato reference genome *Solanum lycopersicum* ITAG3.2, gene expression differential analysis, and previous literature reports, a T>A polymorphism was identified at position 50724660 (Ch02_50724660) of the full-length sequence of chromosome 2 in the tomato genome. Figure 3 This marker is located on the promoter of the aldose-epimerase gene Solyc02g087810 (Aldose 1-epimerase, Al1e).

[0035] Furthermore, five plants were planted from each of the 243 tomato samples. After the fruit matured, five fruits were randomly selected from each sample to measure the soluble solids content, with three biological replicates. The soluble solids content was measured using a handheld Abbe refractometer. The results are shown below. Figure 4 ,in This indicates that p < 0.001, which is highly significant.

[0036] from Figure 4 It can be seen that when the genotype of the above marker is TT, the soluble solids content of tomatoes is low, and when the genotype is AA, the soluble solids content of tomatoes is high. Figure 4 ).

[0037] Example 2: Development of KASP-labeled specific primers Based on the above site information, the full genome sequence of the tomato genome, version Solanum lycopersicum ITAG3.2, was downloaded from the Phytozome database. The sequences upstream and downstream of the Ch02_50724660 marker site (i.e., partial fragments of the Al1e gene) were downloaded. The bolded and underlined sequences represent the SNP site Ch02_50724660 (T / A): CATTAAGATACAGGAGTTGACTATGTTTTCAAAGATTAGTTTG TTCTTCTGTTTGTTCTTCATTCTTCACCTGTTGGCTGCCGATAGTGTAACAGGCCAT T / AThe KASP primer set designed for AGATAGGAATTTATGAGATCAAAAAAGGAGATTTCTCTGTTAAGGTCACTAATTATGGTGCCACAATCATCTCCGTTCTTCTTCCTGATAAGAATGGTAA (SEQ ID NO:1) includes two specific forward primers F1 and F2, and one universal reverse primer R. The 5' ends of the two specific forward primers are respectively attached with fluorescent tag sequences carrying the FAM group and fluorescent tag sequences carrying the HEX group, as shown below: Forward primer F1: FAM-GAAGGTGACCAAGTTCATGCT-GCCGATAGTGTAACAGGCCATT (SEQ ID NO:2) Forward primer F2: HEX-GAAGGTCGGAGTCAACGGATT-GCCGATAGTGTAACAGGCCATA (SEQ ID NO:3) Universal reverse primer R (COM): GAAGAACGGAGATGATTGTGGCAC (SEQ ID NO:4) The product amplified by the above primer set is 124 bp in size, containing a 21 bp tag sequence.

[0038] DNA was extracted from the leaves of the test material using the DNAsecure novel plant genomic DNA extraction kit (brand: TIANGEN, catalog number: DP320).

[0039] The quantitative real-time PCR reaction system consists of: 4 μL DNA template (concentration 5–50 ng / μL), 5 μL 2×KASP Master Mix (brand: Beijing Kejieda Biotechnology Co., Ltd., catalog number 2503003), 0.14 μL primer mixture (prepared by mixing specific forward primer F1, specific forward primer F2, universal reverse primer R, and ddH2O at a stock concentration of 100 μM in a volume ratio of 12:12:30:46 to prepare a 72× primer mixture), and ddH2O to bring the total volume to 10 μL.

[0040] PCR amplification program: 95℃ pre-denaturation for 10 min (1 cycle); 95℃ denaturation for 20 s (10 cycles), 62℃... Annealing / extending at 55℃ for 40s (10 cycles), denaturation at 95℃ for 20s (32 cycles), annealing / extending at 55℃ for 40s (32 cycles), holding at 37℃ for 20s, and collecting fluorescence signals at a single point.

[0041] Amplification was performed using the Roche Lightcycler 96 real-time quantitative PCR instrument according to the above procedure. After the reaction was completed, the fluorescence signal was read, and then the fluorescence data was plotted and analyzed using GraphPad software.

[0042] When using primers Ch02_50724660 for genotyping to detect the soluble solids content of tomato fruits, When the SNP site contains TT alleles, the sample to be tested binds to the forward primer F1 and releases a blue fluorescent gene, which can be used to determine its low soluble content by fluorescence color (the KASP tag genotyping result is defined as: TT).

[0043] When the alleles of the SNP site are all AA, the sample to be tested binds to the forward primer F2 and releases a red fluorescent gene, so that its high soluble content can be determined by the fluorescence color (the genotyping result of KASP marker is defined as: AA).

[0044] Example 3: Identification of SNP genotypes in different tomato materials using KASP molecular markers and its application in identifying the soluble solids content of tomato fruits. Forty-eight tomato samples were genotyped using the primer set and quantitative real-time PCR amplification method described in Example 2. Furthermore, the soluble solids content of the forty-eight tomato samples was determined using an Abbe refractometer. The genotyping results are shown below. Figure 5 The data on the genotype and soluble solids content phenotype of tomato materials detected by KASP molecular markers are shown in Table 1.

[0045] Table 1. Genotypes and soluble solids content phenotypes of 48 tomato materials

[0046] from Figure 5 As shown in Table 1, when all alleles of the SNP loci were TT, the sample bound to the forward primer F1 (carrying FAM) and released blue fluorescence, with an average soluble solids content of 3.65%. When all alleles of the SNP loci were AA, the sample bound to the forward primer F2 (carrying HEX) and released red fluorescence, with an average soluble solids content of 7.92%. The soluble solids content of the AA genotype was significantly higher than that of the TT genotype (p = 1.6 × 10⁻⁶). -11 This indicates that the above primer set can be used to successfully genotype SNP sites.

[0047] In summary, this invention conducted genome-wide association analysis on a natural tomato population and, combined with haplotype analysis, screened for the significantly associated SNP locus Ch02_50724660 (T / A) related to the soluble solids content of tomato fruit, subsequently developing the corresponding KASP marker. The soluble solids content of the AA genotype at this locus was significantly higher than that of the TT genotype. Applying this marker to marker-assisted breeding for genetic improvement of tomato quality, combined with conventional breeding methods, can accelerate the breeding process for tomatoes with high soluble solids content.

[0048] This invention is not limited to the specific textual description above. Various changes can be made to this invention within the scope outlined in the claims, and all such changes are within the scope of this invention.

Claims

1. The application of a molecular marker associated with the soluble solids content of tomato fruit in identifying the soluble solids content of tomato fruit, wherein the molecular marker is located at position 50724660 on chromosome 2 of the tomato genome, and the allele of the base at position 50724660 is T or A; if the genotype at position 50724660 is TT, the soluble solids content of the tomato fruit is low; if the genotype at position 50724660 is AA, the soluble solids content of the tomato fruit is high.

2. The application as described in claim 1, characterized in that, The primer set for detecting the molecular marker as described in claim 1 includes an upstream primer F1, an upstream primer F2, and a downstream universal primer R, wherein the nucleotide sequence of the upstream primer F1 comprises the sequence shown in SEQ ID NO:2, the nucleotide sequence of the upstream primer F2 comprises the sequence shown in SEQ ID NO:3, and the nucleotide sequence of the downstream universal primer R comprises the sequence shown in SEQ ID NO:

4.

3. The application according to claim 2, characterized in that, The 5' end of either upstream primer F1 or upstream primer F2 is independently connected to a fluorescent reporter group.

4. The application according to claim 3, characterized in that, The fluorescent reporter group is selected from one or more of FAM, JOE, ROX, TET, TAMRA, HEX, VIC, CY3, CY5 and TexasRed.

5. The application according to claim 1 further includes its application in improving tomato germplasm resources.

6. The application according to claim 5, characterized in that, The improved tomato germplasm resources are intended to increase the soluble solids content of tomato fruits.

7. A method for identifying the soluble solids content of tomato fruit, characterized in that, Includes the following steps: Using the genomic DNA of the tomato sample to be tested as a template, the template is amplified by real-time PCR using the primer set described in any one of claims 2-6. After the PCR amplification is completed, the fluorescence signal is read, the converted fluorescence signal is analyzed, the genotype is identified, and the soluble solids content of the tomato fruit is determined based on the genotype. If the genotype at position 50724660 is TT, then the soluble solids content of the tomato fruit will be low. If the genotype at position 50724660 is AA, then the tomato fruit will have a high content of soluble solids.

Images