A tNGS technology-based porcine rotavirus group a typing detection method and application

CN122521909APending Publication Date: 2026-08-07湖北省动物疫病预防控制中心 +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
湖北省动物疫病预防控制中心
Filing Date
2026-04-24
Publication Date
2026-08-07

AI Technical Summary

Technical Problem

本发明的目的在于提供一种基于tNGS技术的猪轮状病毒A群分型检测方法及应用,以克服现有技术中检测通量低、无法同步分型、难以发现混合感染等缺陷,实现猪轮状病毒A群的高效、精准、高通量检测与分型

Benefits of technology

本发明通过对猪轮状病毒A群通用基因NSP2及其主要致病基因型G1、G3、G4、G5、G9、G12、G26的VP7基因的保守区域进行深入分析和引物设计,提供了一套可一次性实现8个靶标(1个通用+7个分型)同步扩增的引物组合。该引物组合经过优化,在多重PCR体系中扩增效率均衡,非特异性扩增少,具有检测通量高、特异性强的技术优势。

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The application discloses a porcine rotavirus group A typing detection method based on a tNGS technology and application, relates to the high-throughput technology field of target gene typing detection. The primer group provided by the application can realize specific amplification of the VP7 genes of the porcine rotavirus group A and seven genotypes G1, G3, G4, G5, G9, G12 and G26 at one time. The application combines specific primer targeted amplification with high-throughput sequencing technology, establishes a method capable of synchronous detection and accurate typing, has the technical advantages of rapidity and high efficiency, strong target specificity, high specificity, high throughput, synchronous identification of mixed infection and variation, and the like, and is suitable for accurate diagnosis, typing and epidemiological monitoring of porcine rotavirus infection in pig farms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of high-throughput technology for target gene typing detection, and more specifically, to a method and application for typing porcine rotavirus group A based on targeted next-generation sequencing (tNGS) technology. Background Technology

[0002] Porcine rotavirus (PRV) is one of the main pathogens causing viral diarrhea in piglets. Group A porcine rotavirus (GARV) is the most common in clinical practice. It is highly infectious and pathogenic, and can cause severe diarrhea, dehydration, and even death in piglets, resulting in huge economic losses to the global pig industry.

[0003] Typing of group A porcine rotavirus is primarily based on the gene sequence differences of its coat proteins VP7 and VP4. VP7 is currently the most widely used typing basis, and it can be divided into multiple G serotypes / genotypes. Common pathogenic genotypes include G1, G3, G4, G5, G9, G12, and G26. Different G genotypes of group A porcine rotavirus exhibit significant differences in epidemiological distribution, pathogenicity, and antigenicity. Therefore, rapid and accurate typing of these genotypes is crucial for the precise diagnosis, epidemiological surveillance, vaccine development, and the formulation of control strategies for porcine rotavirus infection.

[0004] Currently, the main methods used for genotyping detection of group A porcine rotavirus include traditional virus isolation and culture, serological detection, and molecular biological detection techniques. Virus isolation and culture methods are cumbersome and time-consuming (usually requiring 3-7 days) and have low sensitivity, making them difficult to meet the needs of rapid clinical testing. While serological detection methods such as enzyme-linked immunosorbent assay (ELISA) are relatively simple to perform, they carry the risk of cross-reactivity, have poor genotyping specificity, and cannot effectively distinguish between different G genotypes.

[0005] Molecular biology detection techniques such as polymerase chain reaction (PCR) and quantitative real-time PCR (qPCR) are widely used due to their high sensitivity and specificity. However, conventional PCR methods typically can only detect one or a few genotypes at a time, leading to the problem of "multiple detections for one disease" and low detection efficiency. While multiplex PCR methods can detect multiple targets simultaneously, their throughput is still limited by the number of fluorescence channels. Furthermore, these methods cannot detect unknown genotypes or variants, making them unsuitable for the needs of complex epidemiological surveys and the identification of mixed infections.

[0006] Targeted next-generation sequencing (tNGS) is an innovative technology that combines ultra-multiplex PCR amplification with high-throughput sequencing. It aims to accurately detect dozens to hundreds of known pathogenic microorganisms and their virulence and resistance genes in samples. Addressing the pain points of traditional whole-genome high-throughput sequencing, such as data redundancy, strong host nucleic acid interference, and insufficient sensitivity, tNGS utilizes a highly specific primer construction system to enrich target nucleic acids before sequencing. This effectively avoids interference from non-target sequences, significantly improving detection sensitivity and specificity, and meeting the needs of rapid clinical diagnosis.

[0007] tNGS mainly includes two technical routes: multiplex primer amplification and probe capture. Among them, multiplex primer amplification tNGS (amplifier sequencing) has significant advantages and is more widely used. Amplifier sequencing relies on the highly specific complementary binding of primers to the target gene. After efficient PCR amplification of the target fragment, high-throughput sequencing is performed. The product contains only the target sequence, which can reduce interference from the source and rapidly enrich a large number of target fragments. It exhibits excellent sequencing efficiency and accuracy.

[0008] In contrast, probe capture sequencing has significant drawbacks, requiring a large initial amount of template DNA and being prone to non-specific binding and signal interference, resulting in significantly insufficient detection sensitivity. Amplicon sequencing precisely fills these gaps, demonstrating irreplaceable advantages over probe capture sequencing and traditional technologies in key scenarios such as low-load pathogen detection and rapid clinical diagnosis, showcasing outstanding technological innovation and application value.

[0009] However, there is currently no specific typing detection method based on tNGS technology for the G1, G3, G4, G5, G9, G12, and G26 genotypes of group A porcine rotavirus. Therefore, developing an efficient and accurate tNGS-based typing detection method for group A porcine rotavirus is of great significance for filling this gap in the field and improving the level of porcine rotavirus prevention and control. Summary of the Invention The purpose of this invention is to provide a method and application for genotyping detection of porcine rotavirus group A based on tNGS technology, so as to overcome the defects of existing technologies such as low detection throughput, inability to perform simultaneous genotyping, and difficulty in detecting mixed infections, and to achieve efficient, accurate, and high-throughput detection and genotyping of porcine rotavirus group A.

[0010] This invention is implemented as follows: In a first aspect, the present invention provides a primer set for universal detection of porcine rotavirus group A and VP7 genotyping using tNGS technology.

[0011] In a preferred embodiment of the present invention, the primer set is used to amplify the universal target gene NSP2 of porcine rotavirus group A and the VP7 target gene corresponding to genotypes G1, G3, G4, G5, G9, G12, and G26.

[0012] In a preferred embodiment of the present invention, the primer set consists of primers with nucleotide sequences as shown in SEQ ID NO.1 to SEQ ID NO.16, wherein the odd-numbered sequences of SEQ ID NO.1 to SEQ ID NO.16 are upstream primers and the even-numbered sequences are downstream primers.

[0013] In a preferred embodiment of the present invention, the nucleotide sequence of the universal target gene NSP2 is shown in SEQ ID NO. 24.

[0014] In a preferred embodiment of the present invention, the nucleotide sequence of the VP7 target gene corresponding to the G1 genotype is shown in SEQ ID NO.17.

[0015] In a preferred embodiment of the present invention, the nucleotide sequence of the VP7 target gene corresponding to the G3 genotype is shown in SEQ ID NO.18.

[0016] In a preferred embodiment of the present invention, the nucleotide sequence of the VP7 target gene corresponding to the G4 genotype is shown in SEQ ID NO.19.

[0017] In a preferred embodiment of the present invention, the nucleotide sequence of the VP7 target gene corresponding to the G5 genotype is shown in SEQ ID NO.20.

[0018] In a preferred embodiment of the present invention, the nucleotide sequence of the VP7 target gene corresponding to the G9 genotype is shown in SEQ ID NO.21.

[0019] In a preferred embodiment of the present invention, the nucleotide sequence of the VP7 target gene corresponding to the G12 genotype is shown in SEQ ID NO.22.

[0020] In a preferred embodiment of the present invention, the nucleotide sequence of the VP7 target gene corresponding to the G26 genotype is shown in SEQ ID NO.23.

[0021] These target genes contain subtype-specific hypervariable regions and species-conserved regions, making them core targets for subtype typing. By deeply analyzing the sequence characteristics of these genes and designing primers from highly conserved and subtype-specific regions, the specificity and accuracy of amplification can be ensured.

[0022] In a preferred embodiment of the present invention, in order to adapt to the library construction requirements of different high-throughput sequencing platforms, a first adapter sequence for constructing a sequencing library is attached to the 5' end of each upstream primer.

[0023] In a preferred embodiment of the present invention, a second adapter sequence for constructing a sequencing library is attached to the 5' end of each downstream primer.

[0024] In a preferred embodiment of the present invention, the first adapter sequence can be selected from a variety of sequences suitable for different sequencing platforms. For example, the first adapter sequence suitable for the MGISEQ series platform of BGI Genomics can be selected from SEQ ID NO.25 (GACATGGCTACGATCCGACTT) or other P5 adapter sequence variants known in the art.

[0025] In a preferred embodiment of the present invention, the second adapter sequence can be selected from a variety of sequences suitable for different sequencing platforms. For example, the second adapter sequence suitable for the MGISEQ series platform of BGI Genomics can be selected from SEQ ID NO.26 (CGCTTGGCCTCCGACTT) or other P7 adapter sequence variants known in the art.

[0026] In a preferred embodiment of the present invention, the first adapter sequence and the second adapter sequence are adapted to the same high-throughput sequencing platform to ensure the smooth progress of library construction and sequencing.

[0027] In a preferred embodiment of the present invention, the high-throughput sequencing platform can be selected from any one of the MGISEQ series, Illumina series, Thermo Fisher Ion Torrent series, or MGISEQ series. Different platforms have different requirements for adapter sequences, and those skilled in the art can select the appropriate adapter sequence for primer modification according to the actual sequencing platform used.

[0028] In a particularly preferred embodiment of the present invention, the nucleotide sequence of the first adapter sequence is shown in SEQ ID NO. 25, and the nucleotide sequence of the second adapter sequence is shown in SEQ ID NO. 26. This adapter sequence combination is perfectly compatible with the library preparation system of the MGISEQ-200 sequencing platform manufactured by BGI Genomics.

[0029] Secondly, the present invention provides a multiplex PCR reagent for universal and typing detection of porcine rotavirus group A.

[0030] In a preferred embodiment of the present invention, the multiplex PCR reagent includes a first PCR reagent and a second PCR reagent.

[0031] In a preferred embodiment of the present invention, the first PCR reagent contains all the upstream primers in the primer set described above.

[0032] In a preferred embodiment of the present invention, the second PCR reagent contains all the downstream primers in the primer set described above.

[0033] Packaging upstream and downstream primers separately can effectively prevent non-specific binding between primers during storage, thus avoiding the formation of primer dimers and improving the stability of the reagents and the specificity of the amplification reaction.

[0034] In a preferred embodiment of the present invention, the final concentration of each upstream primer in the first PCR reagent can be independently controlled within the range of 1-50 nmol / μL.

[0035] In a preferred embodiment of the present invention, the final concentration of each upstream primer is preferably 5-20 nmol / μL. This concentration range can ensure amplification efficiency while avoiding non-specific amplification caused by excessively high primer concentrations.

[0036] In a preferred embodiment of the present invention, the final concentration of each upstream primer is more preferably 8-12 nmol / μL.

[0037] In a particularly preferred embodiment of the present invention, the final concentration of each upstream primer is preferably 10 nmol / μL. This concentration has been experimentally verified to achieve the best balance between amplification efficiency and specificity in a multiplex PCR system.

[0038] In a preferred embodiment of the present invention, the final concentration of each downstream primer in the second PCR reagent can be independently controlled within the range of 1-50 nmol / μL.

[0039] In a preferred embodiment of the present invention, the final concentration of each downstream primer is preferably 5-20 nmol / μL.

[0040] In a preferred embodiment of the present invention, the final concentration of each downstream primer is more preferably 8-12 nmol / μL.

[0041] In a particularly preferred embodiment of the present invention, the final concentration of each downstream primer is preferably 10 nmol / μL.

[0042] In a preferred embodiment of the present invention, the molar ratio of the upstream primer in the first PCR reagent to the downstream primer in the second PCR reagent can be adjusted within the range of 1:2 to 2:1.

[0043] In a preferred embodiment of the present invention, the molar concentration ratio is preferably 1:1.5 to 1.5:1. An appropriate primer ratio is crucial for ensuring the balanced amplification of each target.

[0044] In a particularly preferred embodiment of the present invention, the molar concentration ratio is preferably 1:1. When the upstream and downstream primer concentrations are equal, primer bias can be minimized, ensuring that the amplification efficiency of each target gene is relatively consistent.

[0045] In a preferred embodiment of the present invention, the multiplex PCR reagent may further include other components required for the PCR reaction.

[0046] In a preferred embodiment of the present invention, the multiplex PCR reagent further includes at least one of the following components: PCR buffer, dNTPs, DNA polymerase, Mg²⁺, PCR enhancer, and stabilizer.

[0047] In a preferred embodiment of the present invention, the DNA polymerase is preferably a hot-start DNA polymerase. Hot-start DNA polymerase is activated only at high temperatures, effectively avoiding non-specific amplification during the reaction setup stage and improving the specificity and sensitivity of the reaction.

[0048] In a preferred embodiment of the present invention, the PCR enhancer may be selected from at least one of betaine, DMSO, formamide, glycerol, or BSA. These enhancers can improve the amplification efficiency of complex templates and reduce the inhibitory effect of secondary structures on PCR.

[0049] In a preferred embodiment of the present invention, the stabilizer may be selected from at least one of trehalose, sucrose, gelatin, or PEG. The addition of the stabilizer can improve the storage stability of the reagent.

[0050] Thirdly, the present invention provides a kit for the universal and genotyping detection of porcine rotavirus group A.

[0051] In a preferred embodiment of the present invention, the kit includes the primer set described above or the multiplex PCR reagent described above.

[0052] In a preferred embodiment of the present invention, the kit further includes at least one of the following components: nucleic acid extraction reagent, reverse transcription reagent, PCR premix, DNA polymerase, dNTPs, purification magnetic beads, library construction reagent, sequencing reagent, positive control and negative control.

[0053] In a preferred embodiment of the present invention, the reverse transcription reagent includes at least one of reverse transcriptase, random primers, Oligo(dT) primers, or gene-specific primers. For the detection of RNA viruses, efficient and stable reverse transcription is crucial to ensuring detection sensitivity.

[0054] In a preferred embodiment of the present invention, the library construction reagents include a second-round PCR primer and enzyme mixture for adding sequencing adapters and sample tag sequences. These reagents can be selected and optimized according to different sequencing platforms.

[0055] In a preferred embodiment of the present invention, the positive control is a recombinant plasmid or pseudovirus containing at least one of the sequences shown in SEQ ID NO. 17-24. The positive control can be used to monitor the effectiveness of the entire testing process.

[0056] In a preferred embodiment of the present invention, the negative control is nuclease-free water or porcine genomic DNA known to be negative for porcine rotavirus group A. The negative control can be used to monitor for cross-contamination during the experiment.

[0057] Fourthly, this invention provides the application of the above-mentioned primer set, multiplex PCR reagent or kit in the preparation of porcine rotavirus group A detection products.

[0058] In a preferred embodiment of the present invention, the application includes its use in constructing a tNGS amplicon sequencing library for universal and genotyping detection of porcine rotavirus group A.

[0059] In a preferred embodiment of the present invention, the application includes its use in the detection of porcine rotavirus group A tNGS amplicon sequencing.

[0060] In a preferred embodiment of the present invention, the application includes the detection of porcine rotavirus group A common genotypes and G1, G3, G4, G5, G9, G12, and G26 genotypes in the sample to be tested.

[0061] Fifthly, this invention provides a method for detecting porcine rotavirus group A based on tNGS technology.

[0062] In a preferred embodiment of the present invention, the method includes the following steps: (1) extracting nucleic acid from the sample to be tested and performing reverse transcription to obtain a cDNA template.

[0063] In a preferred embodiment of the present invention, in step (1), the sample to be tested includes at least one of the following: pig intestinal tissue, feces, anal swabs, nasal swabs, oral fluid, environmental samples, or feed samples. The nucleic acid extraction methods and template dosages may need to be adjusted appropriately for different sample types.

[0064] In a preferred embodiment of the present invention, in step (1), the nucleic acid extraction is performed using any one of the following methods: magnetic bead extraction, centrifugation column extraction, or boiling lysis extraction. The extracted total nucleic acid includes DNA and RNA.

[0065] In a preferred embodiment of the present invention, in step (1), the primers used in the reverse transcription reaction are selected from at least one of random primers, Oligo(dT) primers, or gene-specific primers. For the detection of viral RNA, random primers or gene-specific primers generally yield better results.

[0066] In a preferred embodiment of the present invention, the temperature of the reverse transcription reaction can be controlled between 37-55°C and the time is 30-90 min.

[0067] In one specific embodiment of the present invention, the conditions for the reverse transcription reaction are: incubation at 55°C for 60 min, followed by heating at 85°C for 5 min to terminate the reaction.

[0068] In a preferred embodiment of the present invention, the method further includes step (2): using the cDNA obtained in step (1) as a template, performing a first round of multiplex PCR amplification using the primer set or multiplex PCR reagent of the present invention to obtain the first round of amplification products.

[0069] In a preferred embodiment of the present invention, in step (2), the reaction system of the first round of multiplex PCR amplification contains: 1×PCR buffer, 200-400μM dNTPs, 1-4mM Mg²⁺, 0.5-2.5U DNA polymerase, 50-500nM for each upstream primer, 50-500nM for each downstream primer, and 1-10μL cDNA template.

[0070] In a preferred embodiment of the present invention, the total volume of the reaction system is 20-50 μL. An appropriate reaction volume can be selected according to actual needs.

[0071] In a preferred embodiment of the present invention, in step (2), the reaction program for the first round of multiplex PCR amplification is as follows: pre-denaturation at 90-98℃ for 1-5 min; denaturation at 90-98℃ for 10-30 s; annealing and extension at 55-70℃ for 3-10 min; and 20-35 cycles.

[0072] In a preferred embodiment of the present invention, the reaction procedure is preferably: pre-denaturation at 95°C for 2 min; denaturation at 98°C for 20 s; annealing and extension at 60-68°C for 7 min; and repeated 22-28 times.

[0073] In one specific embodiment of the present invention, the reaction procedure is as follows: pre-denaturation at 95°C for 2 min; denaturation at 98°C for 20 s; annealing extension at 66°C for 7 min, for a total of 25 cycles. The long extension time in this procedure ensures that amplicon of different lengths can be effectively enriched.

[0074] In a preferred embodiment of the present invention, the method further includes step (3): purifying the first round of amplification products, adding sequencing adapters and tag sequences for a second round of PCR amplification, and constructing an amplicon dsDNA library.

[0075] In a preferred embodiment of the present invention, in step (3), the purification is carried out by magnetic bead purification method, and the volume ratio of magnetic beads to the first round PCR product is 0.8:1 to 1.2:1.

[0076] In one specific embodiment of the present invention, the volume ratio of the magnetic beads to the first-round PCR product is 1:1. This ratio can effectively remove primer dimers and small molecule non-specific products.

[0077] In a preferred embodiment of the present invention, in step (3), the second round of PCR amplification is used to add sequencing platform-specific complete adapter sequences and sample tag sequences.

[0078] In a preferred embodiment of the present invention, the reaction program for the second round of PCR amplification is as follows: 37℃ for 3-10 min; 95℃ for 8-12 min; 95℃ for 15-25 s; 60-68℃ for 30-90 s; 72℃ for 20-40 s; 25-30 cycles; extension at 72℃ for 1-5 min.

[0079] In one specific embodiment of the present invention, the reaction program is as follows: 37℃ for 5 min; 95℃ for 10 min; 95℃ for 20 s; 64℃ for 1 min; 60℃ for 1 min; 72℃ for 30 s, for a total of 27 cycles.

[0080] In a preferred embodiment of the present invention, the method further includes step (4): purifying, quantifying and mixing the amplicon dsDNA library, and constructing an amplicon ssDNA library by denaturation, circularization and enzyme digestion.

[0081] In a preferred embodiment of the present invention, in step (4), when multiple amplicon dsDNA libraries are mixed in equal quantities, the total amount of the mixed libraries is 200-800 ng.

[0082] In a preferred embodiment of the present invention, the total amount of the mixed library is preferably 300-500 ng.

[0083] In one specific embodiment of the present invention, the total amount of the mixed library is preferably 400 ng. This total amount ensures that sufficient data can be obtained for subsequent sequencing.

[0084] In a preferred embodiment of the present invention, in step (4), the denaturation conditions are: heating at 90-98°C for 2-5 minutes, and then rapidly cooling at 0-4°C for 1-5 minutes.

[0085] In one specific embodiment of the present invention, the denaturation conditions are: heating at 95°C for 3 minutes, followed by an ice bath for 2 minutes.

[0086] In a preferred embodiment of the present invention, in step (4), the cyclization reaction is performed using a DNA ligase-mediated cyclization method.

[0087] In a preferred embodiment of the present invention, the cyclization reaction is performed at 30-40°C for 20-40 minutes.

[0088] In one specific embodiment of the present invention, the cyclization reaction is carried out at 37°C for 30 min.

[0089] In a preferred embodiment of the present invention, the method further includes step (5): preparing DNB from the amplicon ssDNA library and then sequencing it on a high-throughput sequencer.

[0090] In a preferred embodiment of the present invention, in step (5), the DNB preparation is performed using a rolling circle amplification method.

[0091] In a preferred embodiment of the present invention, the conditions for the rolling circle amplification are: reaction at 30°C for 20-30 min.

[0092] In one specific embodiment of the present invention, the conditions for the rolling circle amplification are: reaction at 30°C for 25 min.

[0093] In a preferred embodiment of the present invention, in step (5), the high-throughput sequencer can be selected from any one of MGISEQ-200, MGISEQ-2000, DNBSEQ-T7, Illumina MiSeq, NextSeq, or NovaSeq. Different sequencing platforms have different throughput and read lengths, and can be selected according to actual detection needs.

[0094] In a preferred embodiment of this invention, the sequencing is paired-end sequencing with a read length of 100-150 bp. Paired-end sequencing can obtain more accurate sequence information, which is beneficial to improving the accuracy of genotyping.

[0095] In a preferred embodiment of the present invention, the method further includes step (6): performing bioinformatics analysis on the sequencing data, and determining whether the sample is positive for porcine rotavirus group A and the specific G genotype based on the detection of the target gene.

[0096] In a preferred embodiment of the present invention, step (6) includes data quality control, removal of low-quality reads, removal of adapter sequences, alignment with a reference sequence, and quantification of target genes.

[0097] In a preferred embodiment of the present invention, the reference sequence is the sequence shown in SEQ ID NO.17-24.

[0098] In a preferred embodiment of the present invention, in step (6), the criterion for determining whether the sample is positive for porcine rotavirus group A is: the number of reads matched to SEQ ID NO.24 is ≥10.

[0099] In a preferred embodiment of the present invention, the judgment criterion is preferably: the number of reads matched to SEQ ID NO.24 is ≥50. Increasing the threshold can increase the specificity of the judgment.

[0100] In a preferred embodiment of the present invention, the judgment criterion is more preferably: the number of reads matched to SEQ ID NO.24 is ≥100. This threshold ensures both specificity and sensitivity.

[0101] In a preferred embodiment of the present invention, in step (6), the criterion for determining the specific G genotype is: the proportion of reads that match a specific SEQ ID NO.17-23 to the total number of VP7 reads is ≥50%.

[0102] In a preferred embodiment of the present invention, the ratio is preferably ≥70%.

[0103] In a preferred embodiment of the present invention, the proportion is more preferably ≥90%. When the proportion of reads of a certain genotype exceeds 90%, it can be clearly determined that the genotype is the main infection subtype.

[0104] In a preferred embodiment of the present invention, when the number of reads for two or more VP7 genotypes exceeds a set threshold, it can be determined as a mixed infection.

[0105] In a preferred embodiment of the present invention, the method is for non-disease diagnosis and treatment purposes. This method can be used for non-diagnostic purposes such as scientific research, epidemiological surveillance, and vaccine development.

[0106] The present invention has the following beneficial effects: This invention provides a primer combination capable of simultaneously amplifying eight targets (one universal and seven genotypes) in a single step. This combination is based on in-depth analysis and primer design of the conserved regions of the porcine rotavirus group A universal gene NSP2 and the VP7 gene of its major pathogenic genotypes G1, G3, G4, G5, G9, G12, and G26. The optimized primer combination exhibits balanced amplification efficiency and low non-specific amplification in multiplex PCR systems, offering advantages such as high throughput and strong specificity.

[0107] This invention combines ultra-multiplex PCR amplification with high-throughput sequencing technology, overcoming the throughput limitations of traditional PCR and quantitative real-time PCR. A single reaction is sufficient to detect porcine rotavirus group A in a large number of samples and accurately genotype the seven major G genotypes. Compared to qPCR, the tNGS method of this invention not only provides qualitative and quantitative analysis but also offers specific sequence information, giving it an irreplaceable advantage in discovering new variants and identifying mixed infections.

[0108] The primer set provided by this invention can be synthesized by adding corresponding adapter sequences according to the requirements of different sequencing platforms, exhibiting good platform adaptability and versatility. Users can select the appropriate adapter sequences for primer synthesis based on their existing sequencing platform without changing the core primer sequences.

[0109] The multiplex PCR reagent provided by this invention packages upstream and downstream primers separately, improving reagent stability. Simultaneously, by optimizing primer concentrations and ratios, it ensures the balanced amplification of each target in the multiplex PCR system, avoiding the impact of primer bias on detection results.

[0110] The detection method provided by this invention covers the entire process from sample processing, nucleic acid extraction, reverse transcription, multiplex PCR amplification, library construction to sequencing and data analysis, forming a complete solution. This method is standardized, has a clear workflow, and is easy to standardize and widely apply.

[0111] Experiments have demonstrated that, using the primer set and detection method provided in this invention, simultaneous detection and typing of porcine rotavirus group A was successfully achieved in 38 clinical samples. The sequencing data quality was high (Q30 ≥ 98.64%), and the detection results were highly consistent with the qPCR validation results. This method possesses advantages such as speed, efficiency, strong targeting, high specificity, and the ability to simultaneously identify mixed infections. It is suitable for the accurate diagnosis, epidemiological monitoring, and prevention and control strategy development of suspected porcine rotavirus infection in pig farms. Detailed Implementation

[0112] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0113] In this invention, the term "tNGS" refers to targeted high-throughput sequencing technology, which uses ultramultiplex PCR to enrich target genomic regions before high-throughput sequencing.

[0114] In this invention, the term "VP7 gene" encodes the viral capsid protein, which is the core target for genotyping of porcine rotavirus group A G.

[0115] In this invention, the term "NSP2 gene" encodes a non-structural protein that is highly conserved in porcine rotavirus group A and can serve as a universal detection target.

[0116] In this invention, the term "amplifier" refers to a specific DNA fragment obtained by PCR amplification.

[0117] In this invention, the term "connector sequence" refers to a known sequence added to the 5' end of a primer for subsequent library amplification and sequencing.

[0118] In this invention, the term "tag sequence" or "index" refers to a unique short sequence used to distinguish different samples, allowing multiple samples to be mixed together for simultaneous sequencing.

[0119] The features and performance of the present invention will be further described in detail below with reference to the embodiments. Unless otherwise specified, all reagents or instruments used are commercially available conventional products.

[0120] Example 1: Primer set design and synthesis This embodiment describes the design and screening of universal and typing primers for porcine rotavirus group A.

[0121] The VP7 gene sequences of each G genotype (G1, G3, G4, G5, G9, G12, G26) of porcine rotavirus group A and the NSP2 gene sequence of its universal target were obtained from the National Center for Biotechnology Information (NCBI) database. Primers were designed for highly conserved regions of each target gene using PrimerPremier5 and Oligo7 software. Two to three pairs of candidate primers were designed for each target gene, and BLAST alignment analysis was performed to ensure the specificity of the primers to porcine rotavirus group A and to avoid cross-reactions with the porcine genome and other common porcine pathogens (such as porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, and porcine circovirus).

[0122] The design principles include: primer length 18-25nt, GC content 40%-60%, Tm value 55-65℃, amplicon length 150-350bp, and avoiding the formation of hairpin structures and primer dimers by the primers themselves.

[0123] After sequence alignment analysis and preliminary singleton and multiplex PCR experiments, eight pairs of primers with high specificity and high amplification efficiency were finally identified, and their nucleotide sequences are shown in Table 1.

[0124] RVAG1 G1VP7 SEQ ID NO.17 SEQ ID NO.1~2 RVAG3 G3VP7 SEQ ID NO.18 SEQ ID NO.3~4 RVAG4 G4VP7 SEQ ID NO.19 SEQ ID NO.5~6 RVAG5 G5VP7 SEQ ID NO.20 SEQ ID NO.7~8 RVAG9 G9VP7 SEQ ID NO.21 SEQ ID NO.9~10 RVAG12 G12VP7 SEQ ID NO.22 SEQ ID NO.11~12 RVAG26 G26VP7 SEQ ID NO.23 SEQ ID NO.13~14 General NSP2 SEQ ID NO.24 SEQ ID NO.15~16 To adapt to the library construction requirements of the MGISEQ-200 sequencing platform of BGI Genomics, a first adapter sequence (SEQ ID NO.25: GACATGGCTACGATCCGACTT) was added to the 5' end of all upstream primers (odd-numbered), and a second adapter sequence (SEQ ID NO.26: CGCTTGGCCTCCGACTT) was added to the 5' end of all downstream primers (even-numbered). After HPLC purification and verification, a primer pool that could be directly used for tNGS library construction was obtained.

[0125] Equal molar mixtures of all upstream primers with adapter sequences were added and dissolved in TE buffer, named PrimerPool1 (i.e., the first PCR reagent). Equal molar mixtures of all downstream primers with adapter sequences were added and dissolved in TE buffer, named PrimerPool2 (i.e., the second PCR reagent). The final concentration of each primer was adjusted to 10 nmol / μL. After aliquoting, the primers were stored at -20℃ for later use.

[0126] Example 2: Establishment of a tNGS-based method for detecting porcine rotavirus group A typing This embodiment uses the primer pool prepared in Example 1 to test 38 porcine samples collected clinically, establishing a complete testing process.

[0127] Nucleic acid extraction and reverse transcription of samples Sample types included pig intestinal tissue, feces, anal swabs, and environmental swabs (sample information is shown in Table 2). Total nucleic acid was extracted from the samples using a commercial nucleic acid extraction kit (such as the Singuway nucleic acid extraction reagent from Shenzhen Xinsiwei Co., Ltd.) according to the instructions. After extraction, nucleic acid from tissue samples was diluted 1:5 with nuclease-free water; nucleic acid from other sample types did not require dilution.

[0128] cDNA was synthesized by reverse transcription using extracted total nucleic acid as a template. The reaction system was 40 μL: 24 μL nucleic acid (4 μL nucleic acid + 20 μL water for tissue samples), 4 μL PrimerMix, 2 μL dNTPs (2.5 mMeach), 2 μL reverse transcriptase (HiFiVM-MLV(H-), CWBIO), and 8 μL 5× Buffer. Reaction conditions: incubation at 55℃ for 60 min, followed by heating at 85℃ for 5 min to terminate the reaction, yielding cDNA. The reverse transcription product was temporarily stored at 4℃ or stored long-term at -20℃.

[0129] First round of multiplex PCR amplification (target enrichment) Using the cDNA obtained in step 1 as a template, multiplex PCR amplification was performed using PrimerPool1 and PrimerPool2 prepared in Example 1. The reaction system consisted of 25 μL: 12.5 μL of 2× multiplex PCR premix (such as CWBIO's 2×TFPMultiplexPCRMix), 5 μL of PrimerPool1, 5 μL of PrimerPool2, and 2.5 μL of cDNA.

[0130] Reaction conditions: 95℃ pre-denaturation for 2 min; 98℃ denaturation for 20 s; 66℃ annealing extension for 7 min, for a total of 25 cycles. The long extension time of this procedure ensured the effective enrichment of amplicones of different lengths. After the reaction, 2 μL of the product was subjected to agarose gel electrophoresis to verify the amplification effect.

[0131] Construction of amplicon dsDNA library The first round of PCR products were purified using DNA purification magnetic beads (such as the BGI Genomics DNA Purification Magnetic Bead Kit). The magnetic beads were removed 30 minutes in advance and brought to room temperature, then vortexed to mix. 30 μL of the magnetic beads were added to a new 1.5 mL centrifuge tube, followed by 25 μL of the first round of PCR product. The mixture was gently pipetted 10 times to mix and incubated at room temperature for 5 minutes. The tube was then placed on a magnetic rack and allowed to stand for 2-5 minutes until the liquid became clear; the supernatant was discarded. 200 μL of 80% ethanol was added to rinse the magnetic beads, and the mixture was allowed to stand for 30 seconds before discarding the supernatant. This process was repeated once. The tubes were dried at room temperature until the surface of the magnetic beads was no longer reflective. 6.5 μL of TEBuffer was added to elute the beads, and the mixture was pipetted to mix. The tube was incubated at room temperature for 5 minutes. The supernatant was then transferred to a new PCR tube.

[0132] Using the purified first-round PCR product as a template, a second round of PCR was performed using BGI Genomics' ATOPlex DNA multiplex PCR universal library preparation module and single-tag primer module, with complete sequencing adapters and sample tag indexes added. The reaction volume was 25 μL, containing 12.5 μL PCREnzymeMix, 0.5 μL PCRCleanEnzyme, 0.5 μL PCRAdditive, 1 μL splintoligo, 4 μL PCRBarcodePrimerMix, and 6.5 μL DNA template.

[0133] Reaction program: 37℃ for 5 min; 95℃ for 10 min; 95℃ for 20 s; 64℃ for 1 min; 60℃ for 1 min; 72℃ for 30 s; 27 cycles in total; store at 4℃.

[0134] The second round of PCR products were purified again using magnetic beads, following the same steps as before. Finally, the products were eluted with 23 μL of TE Buffer to obtain the amplicon dsDNA library.

[0135] Construction of amplicon ssDNA library Each dsDNA library was quantified using a Qubit™ 4 Fluorometer. The libraries were required to have a final PCR product concentration ≥5 ng / μL. Based on the quantification results, 38 libraries with different indices were mixed in equal quantities, totaling 400 ng. For volumes less than 48 μL, TE buffer was used to bring the volume to 48 μL.

[0136] The mixed library was denatured at 95°C for 3 min on a PCR instrument, then quickly placed on ice for 2 min, and briefly centrifuged to form ssDNA.

[0137] Library circularization was performed using the MGIEAsy circularization kit. The reaction mixture consisted of 11.5 μL Splint Buffer, 0.5 μL DNA Rapid Ligase, and 48 μL ssDNA, for a total volume of 60 μL. The reaction was carried out at 37°C for 30 min. After the reaction, the sample was briefly centrifuged.

[0138] The cyclized product was digested with DigestionEnzyme to remove uncyclized linear molecules. 1.4 μL of DigestionBuffer and 2.6 μL of DigestionEnzyme were added to the above reaction solution, and the reaction was carried out at 37 °C for 30 min. After the reaction was completed, 7.5 μL of DigestionStopBuffer was added to terminate the reaction.

[0139] Finally, the cyclized product was purified using magnetic beads. 170 μL of magnetic beads were added to the reaction solution, mixed thoroughly by pipetting, and incubated at room temperature for 10 min. The mixture was allowed to stand on a magnetic rack until clear, and the supernatant was discarded. The product was washed twice with 500 μL of 80% ethanol and dried at room temperature. 22 μL of LTE Buffer was added for elution, and the mixture was incubated at room temperature for 10 min. The mixture was then allowed to stand on a magnetic rack, and 20 μL of the supernatant was transferred to a new PCR tube to obtain the amplicon ssDNA library.

[0140] DNB preparation and sequencing The ssDNA library and standard library were mixed at a ratio of 11:4, with a total volume of 60 fmol. DNA nanospheres (DNBs) were prepared using the MGISEQ-200RS high-throughput sequencing kit. Primer hybridization was performed first: 95℃ for 1 min, 65℃ for 1 min, and 40℃ for 1 min. Then, rolling circle amplification was performed: 40 μL of DNB reaction mixture I, 40 μL of DNB polymerase mixture I, and 4 μL of DNB polymerase mixture II were added, and the reaction was carried out at 30℃ for 25 min. After the reaction, 20 μL of DNB stop buffer was added, and the mixture was gently pipetted to mix.

[0141] Take 2 μL of DNB and use the QubitssDNAAssayKit to determine the concentration. The DNB concentration should be ≥8 ng / μL. After passing the quality control, perform paired-end 100 bp sequencing on an MGISEQ-200 sequencer.

[0142] Example 3: Sequencing Data Analysis and Result Validation After sequencing, the instrument was cleaned according to the MGISEQ-200 cleaning instructions, and all sample sequencing data were copied for analysis and statistical analysis. The sequencing report showed that the Q30 of the results was ≥98.64%, and the data quality met the analysis requirements.

[0143] The data was split according to the sample index to obtain sequencing data for each sample. The raw data underwent quality control to remove low-quality reads and adapter sequences.

[0144] The clean reads of each sample were compared with the target gene reference sequences (SEQ ID NO.17-24). Based on the comparison results of each target gene, the number of specific reads for each target was counted to determine the infection status and genotype of the sample.

[0145] Judgment criteria: If the number of reads matched to SEQ ID NO.24 (NSP2) is ≥50, it is judged as positive for porcine rotavirus group A; if the number of reads matched to a specific VP7 gene (such as SEQ ID NO.19, G4 type) accounts for ≥70% of the total number of VP7 reads, it is judged as that genotype being the main infection subtype; if there are two or more VP7 genotypes with ≥100 reads each and the proportion of each genotype is ≥20%, it is judged as a mixed infection.

[0146] The test results of 38 samples are shown in Table 2. The results showed that porcine rotavirus group A was successfully detected in all samples, and its G genotype was identified. Specifically, 3 cases were G1, 6 cases were G3, 11 cases were G4, 3 cases were G5, 8 cases were G9, 1 case was G12, and 2 cases were G26. The number of NSP2 reads (the universal target) was low in samples PHS, 0512-C, and 0825A (<200), but still above the positive threshold, demonstrating the high sensitivity of the universal test. A small number of reads were also detected in the corresponding VP7 gene, which can be identified as the corresponding subtype. Samples F71, F81, F82, 1-5, and BY1 showed predominantly G12 reads, but also a small number of other subtype reads, suggesting possible mixed infection or background interference, requiring further clinical evaluation.

[0147] The tNGS typing results were compared with the detection results of commercial qPCR kits (such as the porcine rotavirus group A nucleic acid detection kit from Shanghai GeneoBio), and the concordance rate between the two was extremely high (e.g., samples F71, F81, F82, BY1, ...). (CF, 0402-A, etc.), demonstrating the accuracy and reliability of the method of the present invention. Some samples (such as sample PHS, sample 0512-C, and sample 0825A) showed no Ct value or a very high Ct value (>35) in qPCR results, but tNGS could still detect a small number of specific reads, indicating that the sensitivity of the tNGS method is superior to qPCR.

[0148] F71 anal swab Huanggang, Hubei 25347 G4(24567) 28.38 F81 Environmental samples Huanggang, Hubei 620 G4(306) 35.12 F82 organize Huanggang, Hubei 272891 G4(260254) 21.05 1-5 Environmental samples Suizhou, Hubei 6622 G12(8119) 31.66 BY1 organize Suizhou, Hubei 306988 G3(281643) 19.64 CF Environmental samples Xiangyang, Hubei 5816 G9(4096) 32.51 0402-A stool Xiangyang, Hubei 26642 G9(23651) 28.31 PHS Environmental samples Xiangyang, Hubei 156 G1(296) No Ct value 12-3 stool Xianning, Hubei 81891 G5(77019) 25.90 13-21 Environmental samples Xianning, Hubei 4632 G5(5061) 33.46 0415-A1 anal swab Suizhou, Hubei 16226 G4(14327) 29.37 0415-A2 organize Suizhou, Hubei 78167 G4(68075) 22.65 0512-C Environmental samples Yichang, Hubei 183 G3(229) No Ct value 0514-G1 stool Tianmen, Hubei 10081 G1(9803) 30.17 ZY-16 organize Xiangyang, Hubei 44680 G9(42023) 24.83 ZY-17 anal swab Xiangyang, Hubei 7845 G9(8032) 31.09 0610-E1 Environmental samples Wuhan, Hubei 301 G4(388) 37.58 0610-E2 organize Wuhan, Hubei 50067 G4(51492) 24.16 0610-E1 anal swab Huanggang, Hubei 10328 G3(9722) 29.60 0610-E2 stool Huanggang, Hubei 38227 G3(36193) 25.62 0706-A organize Tianmen, Hubei 21504 G1(24610) 21.69 0706-B organize Enshi, Hubei 136157 G9(112064) 18.54 0511-A stool Huanggang, Hubei 11453 G5(9637) 30.07 0511-B anal swab Suizhou, Hubei 815 G4(723) 34.23 0508-A Environmental samples Xiaogan, Hubei 2007 G3(1927) 33.29 0827B organize Tianmen, Hubei 68916 G4(60337) 21.06 0823B organize Xiaogan, Hubei 29146 G26(26330) 20.08 0825A anal swab Suizhou, Hubei 331 G4(108) No Ct value 0909C organize Xiaogan, Hubei 56319 G1(53166) 22.59 0914-B anal swab Tianmen, Hubei 25330 G9(22181) 27.32 0916-E stool Huanggang, Hubei 13259 G26(16275) 29.17 2-3-1 Diarrhea anal swab Xiangyang, Hubei 26708 G3(22469) 26.02 2-3-2 diarrhea anal swab Xiangyang, Hubei 24388 G3(21105) 27.33 0916-D Environmental samples Xiaogan, Hubei 364 G5(589) 36.29 10-22 organize Xianning, Hubei 99623 G4(101227) 21.43 0609-B1 organize Wuhan, Hubei 63211 G9(58796) 24.16 0609-B2 anal swab Wuhan, Hubei 49872 G9(51236) 25.06 Weaning 1 stool Yichang, Hubei 50269 G4(46582) 23.10 Example 4: Method Sensitivity Test This embodiment evaluates the sensitivity of the established tNGS detection method.

[0149] A known concentration of G4 porcine rotavirus group A positive sample (qPCR Ct value 21.05) was serially diluted 10-fold using a negative sample matrix to obtain 10 0 10 -1 10 -2 10 -3 10 -4 10 -5Samples from six dilution gradients. Each dilution gradient sample was tested three times, following the method described in Example 2.

[0150] The results showed that in 10 -3 At dilution (corresponding to a qPCR Ct value of approximately 31.2), specific reads were detected in all three replicates (NSP2 reads > 100, G4VP7 reads > 50); at 10 -4 At dilution (corresponding to a qPCR Ct value of approximately 34.5), specific reads were detectable in 2 out of 3 replicates (NSP2 read count > 50); at 10 -5 The dilution was such that only one replicate detected a very small number of reads (NSP2 read count < 20). Therefore, the detection sensitivity of this method can reach 10. -4 The dilution is equivalent to a qPCR Ct value of approximately 34-35, which is superior to the detection limit of conventional qPCR methods.

[0151] Example 5: Method Specificity Test This embodiment evaluates the specificity of the established tNGS detection method.

[0152] Positive samples of common porcine pathogens, including porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine circovirus type 2 (PCV2), porcine reproductive and respiratory syndrome virus (PRRSV), porcine pseudorabies virus (PRV), and genomic DNA of healthy pigs, were selected and tested according to the method described in Example 2.

[0153] The results showed that the number of reads for NSP2 and each VP7 target in all non-porcine rotavirus A pathogen samples and healthy pig genomic DNA were 0 or very low (<5), far below the positive threshold. This indicates that the tNGS detection method established in this invention has high specificity for porcine rotavirus A and no cross-reactivity with other common porcine pathogens.

[0154] Example 6: Compatibility verification with different sequencing platforms This embodiment verifies the compatibility of the primer set of the present invention with different sequencing platforms.

[0155] In addition to the primers with the MGI Tech platform adapter synthesized in Example 1, another set of primers with the Illumina platform adapter was synthesized: the upstream primer had an Illumina P5 adapter sequence added to its 5' end, and the downstream primer had an Illumina P7 adapter sequence added to its 5' end. Using the same positive samples, libraries were constructed using both sets of primers, and then sequencing was performed on the corresponding sequencing platforms (MGISEQ-200 and IlluminaMiSeq).

[0156] The results showed that both primer sets successfully constructed libraries, and the sequencing data quality was good (Q30 > 90%). The detection results were consistent, accurately detecting porcine rotavirus group A and its G4 genotype in the samples. This demonstrates that the core primer set of this invention has good platform adaptability, and the adapter sequences can be changed to adapt to different sequencing platforms as needed.

[0157] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application, and are not intended to limit them. Although this application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of this application.

Claims

1. A primer set for universal detection of porcine rotavirus group A and VP7 genotyping using tNGS technology, characterized in that, The primer set is used to amplify the universal target gene NSP2 of porcine rotavirus group A and the VP7 target gene corresponding to genotypes G1, G3, G4, G5, G9, G12, and G26. The primer set consists of primers with nucleotide sequences as shown in SEQ ID NO.1 to SEQ ID NO.16, wherein the odd-numbered sequences in SEQ ID NO.1 to SEQ ID NO.16 are upstream primers and the even-numbered sequences are downstream primers.

2. The primer set according to claim 1, characterized in that, The nucleotide sequence of the universal target gene NSP2 is shown in SEQ ID NO.24; the nucleotide sequences of the VP7 target genes corresponding to the G1, G3, G4, G5, G9, G12, and G26 genotypes are shown in SEQ ID NO.17 to SEQ ID NO.23, respectively.

3. The primer set according to claim 1 or 2, characterized in that, The upstream primer has a first adapter sequence for constructing a sequencing library attached to its 5' end, and the downstream primer has a second adapter sequence for constructing a sequencing library attached to its 5' end.

4. A multiplex PCR reagent for universal and genotyping detection of porcine rotavirus group A, characterized in that, It includes a first PCR reagent and a second PCR reagent; The first PCR reagent comprises all the upstream primers in the primer set according to any one of claims 1-4; The second PCR reagent comprises all downstream primers in the primer set according to any one of claims 1-4.

5. The multiplex PCR reagent according to claim 4, characterized in that, The multiplex PCR reagent also includes at least one of the following components: PCR buffer, dNTPs, DNA polymerase, Mg²⁺, PCR enhancer, and stabilizer; Preferably, the DNA polymerase is a hot-start DNA polymerase; Preferably, the PCR enhancer is selected from at least one of betaine, DMSO, formamide, glycerol, or BSA.

6. A kit for universal and genotyping detection of porcine rotavirus group A, characterized in that, It includes the primer set as described in any one of claims 1-3 or the multiplex PCR reagent as described in any one of claims 4-5.

7. The use of the primer set according to any one of claims 1-3, the multiplex PCR reagent according to any one of claims 4-5, or the kit according to claim 6 in the preparation of a porcine rotavirus group A detection product, wherein the use includes at least one of the following: (a) Application in constructing tNGS amplicon sequencing libraries for universal and genotyping detection of porcine rotavirus group A; (b) Application in the detection of porcine rotavirus group A tNGS amplicon sequencing; (c) Application in detecting porcine rotavirus group A and genotypes G1, G3, G4, G5, G9, G12 and G26 in test samples.

8. A method for detecting porcine rotavirus group A based on tNGS technology, characterized in that, The method includes the following steps: (1) Extract nucleic acid from the sample to be tested and perform reverse transcription to obtain cDNA template; (2) Using the cDNA obtained in step (1) as a template, a first round of multiplex PCR amplification is performed using the primer set described in any one of claims 1-4 or the multiplex PCR reagent described in any one of claims 5-9 to obtain the first round of amplification products. (3) The first round of amplification products were purified, and sequencing adapters and tag sequences were added for a second round of PCR amplification to construct an amplicon dsDNA library. (4) The amplicon dsDNA library was purified, quantified and mixed, and then denatured, circularized and digested with enzymes to construct the amplicon ssDNA library; (5) Prepare DNB for the amplicon ssDNA library and then sequence it on a high-throughput sequencer; (6) Perform bioinformatics analysis on the sequencing data, and determine whether the sample is positive for porcine rotavirus group A and the specific G genotype based on the detection of target genes.

9. The method according to claim 8, characterized in that, In step (6), the bioinformatics analysis includes data quality control, removal of low-quality reads, removal of adapter sequences, alignment with reference sequences, and quantification of target genes; Preferably, the reference sequence is the sequence shown in SEQ ID NO.17-24.

10. The method according to claim 8, characterized in that, In step (6), the criterion for determining whether the sample is positive for porcine rotavirus group A is: the number of reads matched to SEQ ID NO.24 is ≥10; Preferably, the judgment criterion is: the number of reads matched to SEQ ID NO.24 is ≥50; More preferably, the judgment criterion is: the number of reads matched to SEQ ID NO.24 is ≥100.