Methods of treating melanocytosis

Abstract

Provided herein are novel compositions and methods for treating melanocytosis. Provided herein are novel compositions and methods for treating diseases caused by gain-of-function NRAS and BRAF variants, including cancer, particularly melanoma as well as congenital melanocytic nevi (CMN) and acquired melanocytic nevi (AMN).

Description

Technical Field

[0001] This invention relates to novel compositions and methods for treating melanocytic diseases. Specifically, it relates to novel compositions and methods for treating diseases caused by gain-of-function NRAS and BRAF variants, including cancers, particularly melanoma, congenital melanocytic nevi (CMN), and acquired melanocytic nevi (AMN). Background Technology

[0002] NRAS

[0003] The NRAS gene encodes a protein called N-Ras, which is primarily involved in regulating cell division. Signals transduced by NRAS indicate cell proliferation or differentiation. The N-Ras protein is a GTPase. To transmit signals, the N-Ras protein must be activated by binding to the molecule GTP. The N-Ras protein is inactivated by converting GTP to GDP. When the N-Ras protein binds to GDP, it does not transmit signals to the cell nucleus.

[0004] The NRAS gene belongs to a class of genes known as oncogenes. When mutated, oncogenes can turn normal cells into cancerous cells. The NRAS gene belongs to the Ras family of oncogenes, which also includes many other genes, including two other genes, HRAS and KRAS, which are very commonly mutated in cancer. All three proteins play important roles in cell division, cell differentiation, apoptosis, and other processes. Genetic mutations in the NRAS gene can cause various "RAS pathway diseases" syndromes, the most common being Noonan syndrome. Somatic mutations in this gene have been found in many cancers.

[0005] BRAF

[0006] BRAF is a human gene encoding a protein called B-Raf. This gene is also known as the proto-oncogene B-Raf and the v-Raf murine sarcoma virus oncogene homolog B. The protein is also known as the serine / threonine-protein kinase B-Raf. B-Raf is a member of the Raf kinase family of growth signal transduction protein kinases. This protein plays a role in regulating the MAP kinase / ERK signaling pathway, which influences cell division, differentiation, apoptosis, secretion, and other processes.

[0007] Genetic mutations in BRAF can cause cardiofacial skin syndrome, a condition characterized by heart defects, intellectual disability, and a distinctive facial appearance. Somatic mutations in this gene have been found in the following diseases: cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, papillary thyroid carcinoma, non-small cell lung cancer, lung adenocarcinoma, brain tumors, including glioblastoma and pleomorphic xanthoastrocytoma, and inflammatory diseases such as Erdheim-Chester disease.

[0008] Congenital melanocytic nevus (CMN)

[0009] Congenital melanocytic nevi (CMNs) can cover up to 80% of the body surface area, and large CMNs are present in 1 in 20,000 newborns. These large CMNs are often associated with multiple smaller nevi. CMNs can be associated with neurological abnormalities, sometimes referred to as neurocutaneous melanosis, although many of these abnormalities are not melanocytic, and therefore this term is now often replaced by CMN syndrome. The most common finding in the central nervous system (CNS) is the presence of lesions of melanin-producing cells within the brain parenchyma on magnetic resonance imaging in approximately 20% of children with multiple CMNs. Other neurological associations include communicating hydrocephalus, arachnoid cysts, syringomyelia, tumors (including astrocytomas, choroid plexus papillomas, ependymomas, and pineal germ cell tumors), and malformations such as Dandy-Walker or Arnold-Chiari malformations. Neurological symptoms may be present in patients with CMN without radiographic abnormalities, possibly because the lesions are below the resolution of MRI. The risk of neurological symptoms is most strongly associated with MRI CNS findings, rather than with skin phenotype.

[0010] Besides developmental abnormalities, CMN is a known risk factor for melanoma in life after birth. The absolute risk is associated with the severity of the neurocutaneous phenotype, particularly with the presence of MRI CNS findings, which is more strongly correlated with the skin phenotype. For patients with a severe skin phenotype, the risk peaks in childhood; outside of childhood, melanoma is extremely rare. Importantly, in cases where melanoma does occur, the primary tumor is not necessarily within the skin, but is usually located within the central nervous system (CNS), and occasionally elsewhere. Melanoma in these children is often highly aggressive and refractory to therapy. MEK inhibition has been shown to reduce symptoms of neuromelanoma and may also prolong life, but it is not curative and does not eliminate skin lesions.

[0011] In approximately 67% of cases (where nevi of all severity are grouped together), congenital melanocytic nevi are caused by postzygotic NRAS missense mutations (somatic mutations occurring in the uterus), and in approximately 7% of cases, by BRAF missense mutations occurring in the uterus. The disease phenotypes are extremely similar, with identical clinical diagnoses, clinical appearances, and clinical management. Minor differences exist in the phenotypes, with a slightly higher chance of multiple adipocyte nodules in BRAF-CMN compared to NRAS-CMN, but this does not lead to any difference in clinical outcomes, including the risk of childhood melanoma.

[0012] Acquired melanocytic nevus

[0013] Acquired melanocytic nevi (AMNs) are caused by the same oncogene mutations as congenital melanocytic nevi, although the frequency may be reversed. In this case, BRAF mutations are more common than NRAS mutations and are clinically indistinguishable in appearance, histology, and outcome. Acquired nevi are caused by somatic mutations in melanocytes or melanocyte stem cells in the skin (i.e., occurring after birth). The mechanisms of nevus development can be very similar between CMNs and AMNs because the mutations are the same, and there is significant histological overlap between congenital and acquired nevi. In particular, in both cases, the abnormal cells are referred to as nevus cells. In both cases, the nevi are prone to melanoma formation, with an estimated 50% of melanomas in the normal population developing from acquired melanocytic nevi. Therefore, the proposed therapies can be considered as reversing / treating nevi, and not only for reversing / treating nevi but also for preventing melanoma development. Furthermore, these therapies have potential applications in the cosmetic industry, where nevi can be reversed for cosmetic reasons if desired.

[0014] sporadic melanoma

[0015] Melanomas in the normal population are most commonly driven by the aforementioned BRAF and NRAS mutations at the stated frequencies. These melanomas may arise de novo from melanocytes or melanocyte stem cells in the skin, resulting in new melanocytic lesions, or from existing congenital or more commonly acquired melanocytic nevi. Melanoma itself requires not only BRAF or NRAS missense mutations but also additional gene mutations (possibly before or after the NRAS or BRAF mutation) to become cancerous. However, the driver mutations are fundamental to the process and disease development. Summary of the Invention

[0016] This invention relates to a composition comprising two nucleic acid molecules, wherein a first nucleic acid molecule targets variant NRAS and a second nucleic acid molecule targets variant BRAF. Such compositions can be advantageously used to treat, reduce, or remove acquired nevi (common nevi). Acquired nevi express either variant NRAS or variant BRAF (i.e., the acquired nevi do not carry mutations in either variant). The inventors have utilized this expression pattern by providing a composition that can target both variant NRAS and variant BRAF. This avoids the need for initial sequencing analysis to determine which variants are present in the nevus, as the composition can target both NRAS and BRAF variants. This composition is advantageous because genotyping is not required prior to application. Treatment, reduction, or removal of acquired nevi can also provide benefits in the prevention of cancers such as melanoma.

[0017] Therefore, the present invention provides a composition comprising a first nucleic acid molecule and a second nucleic acid molecule, wherein the first nucleic acid molecule comprises a first strand consisting of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding NRAS; and wherein the second nucleic acid molecule comprises a first strand consisting of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding BRAF.

[0018] In some embodiments, the first strand contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding a gain-of-function variant of NRAS or BRAF. In some embodiments, the first strand contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding NRAS. In some embodiments, the first strand contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding a gain-of-function variant of NRAS. In some embodiments, the first strand contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding BRAF. In some embodiments, the first strand contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding a gain-of-function variant of BRAF.

[0019] In some embodiments, the first chain consists of 10 to 40 linked nucleosides. In some embodiments, the first chain consists of 10 to 30 linked nucleosides. In some embodiments, the first chain consists of 15 to 30 linked nucleosides. In some embodiments, the first chain consists of 15 to 25 linked nucleosides. In some embodiments, the first chain consists of 15 to 20 linked nucleosides. In some embodiments, the first chain consists of 10 to 20 linked nucleosides. In some embodiments, the first chain consists of 20 to 30 linked nucleosides. In some embodiments, the first chain consists of 20 to 25 linked nucleosides. In some embodiments, the first chain consists of 21 linked nucleosides.

[0020] In some embodiments, the first strand comprises a sequence completely complementary to a sequence having at least 95% identity with an isolength portion encoding the mRNA of variant NRAS p.(G60R), p.(G60V), p.(G60E), or p.(G60D). In some embodiments, the first strand comprises a sequence completely complementary to a sequence having 100% identity with an isolength portion encoding the mRNA of variant NRAS p.(G60R), p.(G60V), p.(G60E), or p.(G60D). In some embodiments, the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p.(G60R / V / E / D) by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. In some embodiments, the nucleic acid molecule inhibits the expression of variant NRAS p.(G60R / V / E / D) to a greater extent in vitro than it inhibits the expression of wild-type NRAS in vitro. In some embodiments, the nucleic acid molecule is able to partially or completely rescue abnormal cell differentiation signaling in cells expressing the variant NRAS p.(G60R / V / E / D).

[0021] In some embodiments, the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion encoding the mRNA of the variant NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P). In some embodiments, the first strand comprises a sequence that is completely complementary to a sequence having 100% identity with an isolength portion encoding the mRNA of the variant NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P). In some embodiments, the nucleic acid molecule is capable of inhibiting the expression of the variant NRAS p.(Q61K / R / H / L / P) by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. In some embodiments, the nucleic acid molecule inhibits the expression of variant NRAS p.(Q61K / R / H / L / P) to a greater extent in vitro than it inhibits the expression of wild-type NRAS in vitro. In some embodiments, the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signaling in cells expressing variant NRAS p.(Q61K / R / H / L / P).

[0022] In some embodiments, the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding variants NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V). In some embodiments, the first strand comprises a sequence that is completely complementary to a sequence having 100% identity with an isolength portion of the mRNA encoding variants NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V). In some embodiments, the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p. (G12R / S / D / P / C / A / V) by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. In some embodiments, the nucleic acid molecule inhibits the expression of variant NRAS p. (G12R / S / D / P / C / A / V) to a greater extent in vitro than it inhibits the expression of wild-type NRAS. In some embodiments, the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signaling in cells expressing variant NRAS p. (G12R / S / D / P / C / A / V).

[0023] In some embodiments, the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isoplethora of the mRNA encoding variants NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F), or p.(G13Y). In some embodiments, the first strand comprises a sequence that is completely complementary to a sequence having 100% identity with an isoplethora of the mRNA encoding variants NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F), or p.(G13Y). In some embodiments, the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p. (G13V / D / A / S / C / R / F / Y) by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. In some embodiments, the nucleic acid molecule inhibits the expression of variant NRAS p. (G13V / D / A / S / C / R / F / Y) to a greater extent in vitro than it inhibits the expression of wild-type NRAS. In some embodiments, the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signaling in cells expressing variant NRAS p. (G13V / D / A / S / C / R / F / Y).

[0024] In some embodiments, the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion encoding the mRNA of variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). In some embodiments, the first strand comprises a sequence that is completely complementary to a sequence having 100% identity with an isolength portion encoding the mRNA of variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). In some embodiments, the nucleic acid molecule is capable of inhibiting the expression of variant BRAF p.(V600G / M / D / R / K / E) by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. In some embodiments, the nucleic acid molecule inhibits the expression of variant BRAF p. (V600G / M / D / R / K / E) to a greater extent in vitro than it inhibits the expression of wild-type BRAF in vitro. In some embodiments, the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signaling in cells expressing variant BRAF p. (V600G / M / D / R / K / E).

[0025] In some embodiments, the nucleic acid molecule is a single-stranded nucleic acid molecule. In some embodiments, the nucleic acid molecule is a double-stranded nucleic acid molecule.

[0026] In some embodiments, the double-stranded nucleic acid molecule comprises a second strand consisting of 10 to 50 linked nucleosides, wherein the second strand is at least partially complementary to the first strand. In some embodiments, the second strand is at least 80% complementary to the first strand. In some embodiments, the second strand is at least 90% complementary to the first strand. In some embodiments, the second strand is at least 95% complementary to the first strand. In some embodiments, the second strand is completely complementary to the first strand.

[0027] In some embodiments, the second chain consists of 10 to 50 linked nucleosides. In some embodiments, the second chain consists of 10 to 40 linked nucleosides. In some embodiments, the second chain consists of 10 to 30 linked nucleosides. In some embodiments, the second chain consists of 15 to 30 linked nucleosides. In some embodiments, the second chain consists of 15 to 25 linked nucleosides. In some embodiments, the second chain consists of 15 to 20 linked nucleosides. In some embodiments, the second chain consists of 10 to 20 linked nucleosides. In some embodiments, the second chain consists of 20 to 30 linked nucleosides. In some embodiments, the second chain consists of 20 to 25 linked nucleosides. In some embodiments, the second chain consists of 21 linked nucleosides.

[0028] In some embodiments, the first strand is longer than the second strand. In some embodiments, the nucleic acid molecule includes a protrusion at the 3' end of the first strand composed of one, two, three, four, five, or more nucleotides. In some embodiments, the nucleic acid molecule includes a protrusion at the 3' end of the first strand composed of two nucleotides. In some embodiments, the nucleic acid molecule includes a protrusion at the 5' end of the first strand composed of one, two, three, four, five, or more nucleotides. In some embodiments, the nucleic acid molecule includes a protrusion at the 5' end of the first strand composed of two nucleotides. In some embodiments, the nucleic acid molecule includes a second strand that is longer than the first strand. In some embodiments, the nucleic acid molecule includes a protrusion at the 3' end of the second strand composed of one, two, three, four, five, or more nucleotides. In some embodiments, the nucleic acid molecule includes a protrusion at the 3' end of the second strand composed of two nucleotides. In some embodiments, the nucleic acid molecule includes a 5' end composed of one, two, three, four, five, or more nucleotides at the 5' end of the second strand. In some embodiments, the nucleic acid molecule includes a 5' end composed of two nucleotides at the 5' end of the second strand. In some embodiments, the nucleic acid molecule includes a 5' end and a 3' end composed of one, two, three, four, five, or more nucleotides at both the 5' and 3' ends of the first strand. In some embodiments, the nucleic acid molecule includes a 5' end and a 3' end composed of two nucleotides at both the 5' and 3' ends of the first strand.

[0029] In some embodiments, the protrusion comprises two thymine nucleotides (TT).

[0030] In some embodiments, the second chain comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of:

[0031] SEQ ID NO: 92-110; SEQ ID NO: 130-148; SEQ ID NO: 168-186; SEQ ID NO: 206-224; SEQ ID NO: 244-262; SEQ ID NO: 282-300; SEQ ID NO: 320-338; SEQ ID NO: 358-376; SEQ ID NO: 396-414; SEQ ID NO: 434-452; SEQ ID NO: 472-490; SEQ ID NO: 510-528; SEQ ID NO: 548-566; SEQ ID NO: 587-606; SEQ ID NO: 626-644; SEQ ID NO: 664-682; SEQ ID NO: 702-720; SEQ ID NO: 740-758; SEQ ID NO: 778-796; SEQ ID SEQ ID NO: 857-876; SEQ ID NO: 896-914; SEQ ID NO: 934-952; SEQ ID NO: 972-990; SEQ ID NO: 1011-1030; SEQ ID NO: 1052-1072; SEQ ID NO: 1092-1110; SEQ ID NO: 1130-1148; SEQ ID NO: 1168-1186; SEQ ID NO: 1207-1226; SEQ ID NO: 1247-1266; SEQ ID NO: 1287-1306; or SEQ ID NO: 1326-1344.

[0032] In some implementations, the second chain comprises sequences selected from the group consisting of:

[0033] SEQ ID NO: 92-110; SEQ ID NO: 130-148; SEQ ID NO: 168-186; SEQ ID NO: 206-224; SEQ ID NO: 244-262; SEQ ID NO: 282-300; SEQ ID NO: 320-338; SEQ ID NO: 358-376; SEQ ID NO: 396-414; SEQ ID NO: 434-452; SEQ ID NO: 472-490; SEQ ID NO: 510-528; SEQ ID NO: 548-566; SEQ ID NO: 587-606; SEQ ID NO: 626-644; SEQ ID NO: 664-682; SEQ ID NO: 702-720; SEQ ID NO: 740-758; SEQ ID NO: 778-796; SEQ ID SEQ ID NO: 857-876; SEQ ID NO: 896-914; SEQ ID NO: 934-952; SEQ ID NO: 972-990; SEQ ID NO: 1011-1030; SEQ ID NO: 1052-1072; SEQ ID NO: 1092-1110; SEQ ID NO: 1130-1148; SEQ ID NO: 1168-1186; SEQ ID NO: 1207-1226; SEQ ID NO: 1247-1266; SEQ ID NO: 1287-1306; or SEQ ID NO: 1326-1344.

[0034] In some implementations, the second chain consists of sequences selected from the group consisting of:

[0035] SEQ ID NO: 92-110; SEQ ID NO: 130-148; SEQ ID NO: 168-186; SEQ ID NO: 206-224; SEQ ID NO: 244-262; SEQ ID NO: 282-300; SEQ ID NO: 320-338; SEQ ID NO: 358-376; SEQ ID NO: 396-414; SEQ ID NO: 434-452; SEQ ID NO: 472-490; SEQ ID NO: 510-528; SEQ ID NO: 548-566; SEQ ID NO: 587-606; SEQ ID NO: 626-644; SEQ ID NO: 664-682; SEQ ID NO: 702-720; SEQ ID NO: 740-758; SEQ ID NO: 778-796; SEQ ID NO: 817-836; SEQ ID NO: 857-876; SEQ ID NO: 896-914; SEQ ID NO: 934-952; SEQ ID NO: 972-990; SEQ ID NO: 1011-1030; SEQ ID NO: 1052-1072; SEQ ID NO: 1092-1110; SEQ ID NO: 1130-1148; SEQ ID NO: 1168-1186; SEQ ID NO: 1207-1226; SEQ ID NO: 1247-1266; SEQ ID NO: 1287-1306; or SEQ ID NO: 1326-1344.

[0036] In some embodiments, the nucleic acid molecule specifically targets DNA sequences selected from the list consisting of: SEQ ID NO: 7 (NRAS_c.178G>C_p.G60R), SEQ ID NO: 9 (NRAS_c.179G>T_p.G60V), SEQ ID NO: 11 (NRAS_c.179G>A_p.G60E), SEQ ID NO: 13 (NRAS_c.181C>A_p.Q61K), SEQ ID NO: 15 (NRAS_c.182A>G_p.Q61R), SEQ ID NO: 17 (NRAS_c.182A>T_p.Q61L), SEQ ID NO: 19 (NRAS_c.182A>C_p.Q61P), SEQ ID NO: 21 (NRAS_c.183A>C_p.Q61H), SEQ ID NO: 23 (NRAS_c.183A>T_p.Q61H), SEQ ID NO: 25 (NRAS_c.35G>T_p.G12V), SEQ ID NO: 27 (NRAS_c.34G>C_p.G12R), SEQ ID NO: 29 (NRAS_c.35G>A_p.G12D), SEQ ID NO: 31 (NRAS_c.34G>A_p.G12S), SEQ ID NO: 33 (NRAS_c.34_35G>C_ p.G12P), SEQ ID NO: 35 (NRAS_c.34G>T_p.G12C), SEQ ID NO: 37 (NRAS_c.35G>C_p.G12A), SEQ ID NO: 39 (NRAS_c.37G>A_p.G13S), SEQ ID NO: 41 (NRAS_c.37G>T_p.G13C), SEQ ID NO: 43 (NRAS_c.37G>C_p.G13R), SEQ ID NO: 45 (NRAS_c.37_38delinsTT_ p.G13F), SEQ ID NO: 47 (NRAS_c.37_38delinsTA_ p.G13Y), SEQ ID NO: 49 (NRAS_c.38G>T_p.G13V), SEQ ID NO: 51 (NRAS_c.38G>A_p.G13D), SEQ ID NO: 53 (NRAS_c.38G>C_p.G13A), SEQ ID NO: 55 (NRAS_c.180_181delinsTA), SEQ ID NO: 57 (NRAS_c.181_183delinsAAG), SEQ ID NO: 59 (BRAF_c.1799T>GpV600G), SEQ ID NO: 61 (BRAF_c.1798G>ApV600M), SEQ ID NO: 63 (BRAF_c.1799_1800delisAT_p.V600D), SEQ ID NO: 65 (BRAF_c.1798_1799delisCG_p.V600R), SEQ ID NO: 67 (BRAF_c.1798_1799delisAA_p.V600K), SEQ ID NO: 69 (BRAF_c.1799_1800delisAA_p.V600E) and SEQ ID NO: 71 (BRAF_c.1799T>ApV600E). .

[0037] This invention provides a compound comprising a nucleic acid molecule and a targeting moiety according to the invention. In some embodiments, the targeting moiety comprises lipid nanoparticles, liposomes, exosomes, antibodies or fragments thereof, antigen-binding domains or fragments thereof, peptides, cell-penetrating peptides, conjugate groups, or any combination thereof. In some embodiments, the targeting moiety comprises a conjugate group, and wherein the conjugate group comprises one or more carbohydrates.

[0038] In some cases, the present invention provides a compound comprising a nucleic acid molecule and nanoparticles according to the present invention. The nanoparticles may be receptor-targeting nanoparticles (RTNPs). Receptor-targeting nanoparticles typically exhibit specificity for specific receptors, cell types, tissues, organs, etc. Therefore, receptor-targeting nanoparticles allow for targeted delivery of the nucleic acid molecule of the present invention. The nucleic acid molecule may be encapsulated within the nanoparticles or the receptor-targeting nanoparticles. Receptor-targeting nanoparticles usable in the present invention may contain a peptide sequence that binds to a receptor. The receptor may be a KIT receptor. For example, the receptor-targeting nanoparticles may contain a peptide sequence having at least 50%, at least 65%, at least 80%, or at least 100% identity with the sequence ISVYMM (SEQ ID NO: 1349). The receptor-targeting nanoparticles may contain a peptide sequence having at least 50%, at least 65%, at least 80%, or at least 100% identity with the sequence NRVTNN (SEQ ID NO: 1350). The receptor may be an integrin. For example, the receptor-targeting nanoparticles may contain a peptide sequence having at least 50%, at least 65%, at least 80%, or at least 100% identity with the sequence CRGDCL (SEQ ID NO: 1351). The receptor-targeting nanoparticles may contain a peptide sequence having at least 50%, at least 65%, at least 80%, or at least 100% identity with the sequence CDGRCL (SEQ ID NO: 1352).

[0039] In some embodiments, the conjugation group comprises monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, polysaccharides, modified polysaccharides, mannose, galactose, mannose derivatives, galactose derivatives, D-mannylpyranose, L-mannylpyranose, D-arabinose, L-galactose, D-xylfuranose, L-xylfuranose, D-glucose, L-glucose, D-galactose, L-galactose, aD-mannylfuranose, β-D-mannylfuranose, etc. -Mannofragranose, α-D-Mannofragranose, β-D-Mannofragranose, α-D-Glucose Pyranopyranose, β-D-Glucose Pyranopyranose, α-D-Fructose Pyranopyranose, α-D-Fructose Pyranopyranose, α-D-Galactopyranose, β-D-Galactopyranose, α-D-Galactopyranose, β-D-Galactopyranose, Glucosamine, Sialic acid, α-D-Galactosamine, N - Acetylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-carboxamido-2,3-di-O-methyl-D-mannpyranose, 2-deoxy-2-sulfonamido-D-glucopyranose, N-hydroxyacetyl-α-neuraminic acid, 5-thio-β-D-glucopyranose Methyl 2,3,4-tri-O-acetyl-1-thio-6-O-triphenylmethyl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-aD-glucopyranoside, 2,5-dehydrated-D-allylonitrile, ribose, D-ribose, D-4-thioribose, L-ribose, or L-4-thioribose.

[0040] In some embodiments, the targeting portion is connected to the 3' end of the second chain. In some embodiments, the targeting portion is connected to the 5' end of the second chain. In some embodiments, the targeting portion is connected to the 5' end of the first chain. In some embodiments, the targeting portion is connected to the 3' end of the first chain.

[0041] In some embodiments, at least one nucleoside comprises a modified sugar. In some embodiments, at least one internucleotide bond is a modified internucleotide bond. In some embodiments, the modified internucleotide bond is a thiophosphate or dithiophosphate internucleotide bond. In some embodiments, the nucleic acid molecule comprises 1 to 40 thiophosphate or dithiophosphate internucleotide bonds. In some embodiments, the nucleic acid molecule comprises 1 to 30 thiophosphate or dithiophosphate internucleotide bonds. In some embodiments, the nucleic acid molecule comprises 1 to 20 thiophosphate or dithiophosphate internucleotide bonds. In some embodiments, the nucleic acid molecule comprises 1 to 10 thiophosphate or dithiophosphate internucleotide bonds.

[0042] This invention provides a composition comprising at least one of a single-stranded nucleic acid molecule or compound or a salt thereof according to the invention, and a pharmaceutically acceptable carrier or diluent. This invention also provides a prodrug comprising the nucleic acid molecule or compound of the invention.

[0043] The present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes with a target sequence in a cell, and wherein the target sequence encodes a variant allele of NRAS or BRAF.

[0044] This invention provides a CRISPR nuclease system comprising one or more vectors, wherein the one or more vectors comprise:

[0045] (a) A promoter operatively linked to at least one nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes to a target DNA sequence in the subject's cells, and wherein the target sequence encodes a variant allele of NRAS or BRAF; and

[0046] (b) A nucleotide sequence encoding a nuclease, such as a Cas nuclease, wherein components (a) and (b) are located on the same or different vectors of the system.

[0047] The gRNA targets and hybridizes with the target DNA sequence, and the nuclease cleaves the target sequence to alter the expression of the variant allele of the NRAS or BRAF.

[0048] In some embodiments, the CRISPR nuclease system is packaged into a single adeno-associated virus (AAV) particle. In some embodiments, the nuclease is codon-optimized for expression in the cells. In some embodiments, the promoter is operatively linked to at least one, two, three, four, five, six, seven, eight, nine, or ten gRNAs.

[0049] In some embodiments, the DNA sequence of the gRNA targeting coding variant NRAS p.(G60R), p.(G60V), p.(G60E), or p.(G60D) is included. In some embodiments, the DNA sequence of the gRNA targeting coding variant NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P) is included. In some embodiments, the DNA sequence of the gRNA targeting coding variant NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V) is included. In some embodiments, the gRNA targets the DNA sequence of the encoding variant NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F), or p.(G13Y). In some embodiments, the gRNA targets the DNA sequence of the encoding variant BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E). In some embodiments, the gRNA comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1345-1347. In some embodiments, the gRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1345-1347. In some embodiments, the gRNA consists of sequences selected from the group consisting of: SEQ ID NO: 1345-1347.

[0050] In some embodiments, the target DNA sequence is selected from the group consisting of: SEQ ID NO: 7 (NRAS_c.178G>C_p.G60R), SEQ ID NO: 9 (NRAS_c.179G>T_p.G60V), SEQ ID NO: 11 (NRAS_c.179G>A_p.G60E), SEQ ID NO: 13 (NRAS_c.181C>A_p.Q61K), SEQ ID NO: 15 (NRAS_c.182A>G_p.Q61R), SEQ ID NO: 17 (NRAS_c.182A>T_p.Q61L), SEQ ID NO: 19 (NRAS_c.182A>C_p.Q61P), SEQ ID NO: 21 (NRAS_c.183A>C_p.Q61H), SEQ ID NO: 23 (NRAS_c.183A>T_p.Q61H), SEQ ID NO: 25 (NRAS_c.35G>T_p.G12V), SEQ ID NO: 27 (NRAS_c.34G>C_p.G12R), SEQ ID NO: 29 (NRAS_c.35G>A_p.G12D), SEQ ID NO: 31 (NRAS_c.34G>A_p.G12S), SEQ ID NO: 33 (NRAS_c.34_35G>C_ p.G12P), SEQ ID NO: 35 (NRAS_c.34G>T_p.G12C), SEQ ID NO: 37 (NRAS_c.35G>C_p.G12A), SEQ ID NO: 39 (NRAS_c.37G>A_p.G13S), SEQ ID NO: 41 (NRAS_c.37G>T_p.G13C), SEQ ID NO: 43 (NRAS_c.37G>C_p.G13R), SEQ ID NO: 45 (NRAS_c.37_38delinsTT_ p.G13F), SEQ ID NO: 47 (NRAS_c.37_38delinsTA_ p.G13Y), SEQ ID NO: 49 (NRAS_c.38G>T_p.G13V), SEQ ID NO: 51 (NRAS_c.38G>A_p.G13D), SEQ ID NO: 53 (NRAS_c.38G>C_p.G13A), SEQ ID NO: 55 (NRAS_c.180_181delinsTA), SEQ ID NO: 57 (NRAS_c.181_183delinsAAG), SEQ ID NO: 59 (BRAF_c.SEQ ID NO: 61 (BRAF_c.1798G>ApV600M), SEQ ID NO: 63 (BRAF_c.1799_1800delisAT_p.V600D), SEQ ID NO: 65 (BRAF_c.1798_1799delisCG_p.V600R), SEQ ID NO: 67 (BRAF_c.1798_1799delisAA_p.V600K), SEQ ID NO: 69 (BRAF_c.1799_1800delisAA_p.V600E), and SEQ ID NO: 71 (BRAF_c.1799T>ApV600E), or combinations thereof.

[0051] This invention provides a method for treating a patient suffering from a disease or condition associated with or driven by overexpression of NRAS, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention. This invention also provides a method for treating a patient suffering from a disease or condition associated with or driven by a variant of NRAS, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention.

[0052] This invention provides a method for treating a patient suffering from a disease or condition associated with or driven by overexpression of BRAF, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention. This invention also provides a method for treating a patient suffering from a disease or condition associated with or driven by a variant of BRAF, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention.

[0053] The present invention provides a method for treating a patient suffering from melanocytosis, disease, or lesion, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention.

[0054] This invention provides a method for treating a patient with congenital melanocytic nevus (CMN), the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention. This invention also provides a method for treating a patient with acquired melanocytic nevus (AMN), the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention.

[0055] This invention provides a method for treating a patient with a mosaic disorder, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention. This invention also provides a method for treating a patient with cancer, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention.

[0056] In some embodiments, the cancer is selected from the list of the following: melanoma, adrenal cancer, autonomic ganglion cancer, biliary tract cancer, bone cancer, breast cancer, central nervous system cancer, cervical cancer, endometrial cancer, eye cancer, fallopian tube cancer, female reproductive tract cancer, gastrointestinal cancer, reproductive tract cancer, hematopoietic system cancer, lymphoma, kidney cancer, colorectal cancer, liver cancer, lung cancer, meningeal cancer, esophageal cancer, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, perineal cancer, peritoneal cancer, pituitary cancer, placental cancer, pleural cancer, prostate cancer, salivary gland cancer, skin cancer, small intestine cancer, soft tissue cancer, stomach cancer, testicular cancer, thymic cancer, thyroid cancer, upper respiratory and digestive tract cancer, urethral cancer, uterine adnexal cancer, vaginal cancer, and vulvar cancer. In some embodiments, the cancer is melanoma. In some embodiments, the cancer is a blood cancer, meningeal cancer, adrenal cancer, or thyroid cancer.

[0057] This invention provides a method for treating a subject with a benign tumor, the method comprising administering to the subject a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention. Benign lesions, particularly benign tumors such as colonic polyps and thyroid nodules, have been shown to be associated with mutations in NRAS and BRAF (Marotta, V., Bifulco, M. and Vitale, M. Significance of RAS Mutations in Thyroid Benign Nodules and Non-Medullary Thyroid Cancer. Cancers (Basel) 13 (2021); DosSantos, W. et al. Somatic targeted mutation profiling of colorectal cancerprecursor lesions. BMC Med Genomics 15, 143 (2022)). Benign tumors may be associated with or driven by variants in NRAS and / or overexpression of NRAS. In some cases, the method comprises administering to the subject a compound or composition that specifically targets variant alleles of NRAS. In some embodiments, the variant allele of the NRAS contains a mutation causing a p.(Q61K / R / H / L / P) substitution. In some embodiments, the variant allele of the NRAS contains a mutation causing a p.(G12R / S / D / P / C / A / V) substitution. In some embodiments, the variant allele of the NRAS contains a mutation causing a p.(G13V / D / A / S / C / R / F / Y) substitution. In some embodiments, the variant allele of the NRAS contains a mutation causing a p.(G60R / E / D / V) substitution. Benign tumors may be associated with or driven by variants in BRAF and / or overexpression of BRAF. In some cases, the method comprises administering to the subject a compound or composition that specifically targets a variant allele of BRAF.

[0058] The present invention provides a method for treating polyps, such as colonic polyps, in a subject, the method comprising administering to the subject a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention.

[0059] The present invention provides a method for treating thyroid nodules in a subject, the method comprising administering to the subject a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention.

[0060] In some embodiments, the nucleic acid molecule, the compound, the composition, or the prodrug according to the invention is administered in combination with a second therapeutic agent.

[0061] This invention provides a method for treating a patient with congenital melanocytic nevus (CMN), the method comprising administering to the patient a compound or composition specifically targeting a variant allele of the NRAS. This invention also provides a method for treating a patient with cancer, the method comprising administering to the patient a compound or composition specifically targeting a variant allele of the NRAS. In some embodiments, the variant allele of the NRAS contains a mutation causing a p.(Q61K / R / H / L / P) substitution. In some embodiments, the variant allele of the NRAS contains a mutation causing a p.(G12R / S / D / P / C / A / V) substitution. In some embodiments, the variant allele of the NRAS contains a mutation causing a p.(G13V / D / A / S / C / R / F / Y) substitution. In some embodiments, the variant allele of the NRAS contains a mutation causing a p.(G60R / E / D / V) substitution.

[0062] This invention provides a method for treating a patient with congenital melanocytic nevus (CMN), the method comprising administering to the patient a compound or composition specifically targeting a variant allele of BRAF. This invention also provides a method for treating a patient with cancer, the method comprising administering to the patient a compound or composition specifically targeting a variant allele of BRAF. In some embodiments, the variant allele of BRAF contains a mutation causing a p.(V600G / M / D / R / K / E) substitution.

[0063] This invention provides an expression construct comprising a nucleic acid molecule encoding the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention. This invention provides an isolated nucleic acid molecule encoding the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention. This invention provides a vector comprising the isolated nucleic acid molecule of the invention. In some embodiments, the vector is a viral vector, retroviral vector, expression cassette, or plasmid. In some embodiments, the vector further comprises an RNA polymerase III or RNA polymerase II promoter. In some embodiments, the RNA polymerase III promoter is a U6 or H1 promoter.

[0064] This invention provides a host cell comprising the nucleic acid molecule, the compound, the composition, the prodrug, or the CRISPR nuclease system according to the invention, the isolated nucleic acid molecule according to the invention, or the vector according to the invention. In some embodiments, the host cell is a mammalian host cell. In some embodiments, the host cell is a human host cell.

[0065] In some embodiments, the nucleic acid molecule, the compound, the composition, or the prodrug is formulated for delivery together with lipid-based nanoparticles, liposomes, exosomes, polymeric nanoparticles, inorganic nanoparticles, or polyelectrolyte nanocomplexes (RTNPs) co-delivered with ruxolitinib and thalidomide. In some embodiments, the nucleic acid molecule, the compound, the composition, the prodrug, or the CRISPR nuclease system is not packaged for delivery (gymnotic delivery). In some embodiments, the nucleic acid molecule, the compound, the composition, the prodrug, or the CRISPR nuclease system is administered by injection. In some embodiments, the nucleic acid molecule, the compound, the composition, the prodrug, or the CRISPR nuclease system is administered using microneedle injection. In some embodiments, the nucleic acid molecule, the compound, the composition, the prodrug, or the CRISPR nuclease system is administered topically. In some embodiments, the administration further comprises electroporation or ultrasound. Attached Figure Description

[0066] Figure 1- Identification of siRNAs using allele discrimination against the NRAS c.181C>A mutation. (a) Experimental design for selecting the optimal siRNA candidate targeting NRAS c.181C>A. (b) Design of siRNAs with the potential to knock down variant NRAS transcripts relative to the mutation of interest (vertical gray bar NRAS c.181C>A) using a "walking" approach. The 3' end of the siRNA complementary sequence is completed with two uracil nucleotides that have been reported to enhance its activity. Note that the sequences shown in the inset are transit chains for ease of interpretation of the corresponding nucleotides. siRNAs 1, 8, and 15 are color-coded for easy reference in other plots within this figure. (c) Effect of siRNA treatment on NRAS transcript expression investigated by qPCR. siRNA 8 (blue) and siRNA 15 (red) are selected based on their tendency to reduce variant NRAS transcripts rather than WTNRAS transcripts. siRNA1 (green) was included in these experiments as a control because it minimized both variant and WT NRAS expression. (d) Assessment of allele discrimination. Positive values ​​indicate specificity for the NRAS c.181C>AmRNA transcript, and negative values ​​indicate specificity for the NRAS WT mRNA transcript.

[0067] Figure 2 - Evaluation of candidate siRNA specificity. qPCR data from previous experiments were validated by RNA-seq to confirm that the selected candidates indeed selectively minimized the expression of variant NRAS in A) compared to B) WT NRAS (n=3, SEM), C) WT KRAS, and D) WT HRAS. E) Volcano plot demonstrating the effects of the siRNA candidates on the transcriptome of variant NRAS cells (E) and WT NRAS cells (F). Circles mark the locations of NRAS in this dataset. G) Analysis of RNA-seq data was refined to computationally predicted targets for each RNA. Sequences of each siRNA were blast-processed against a human cDNA database. Genes with close homology (i.e., predicted off-targets) were investigated in the RNA-seq dataset. Genes with the largest reduction in expression for each siRNA are shown (n=3, SEM).

[0068] Figure 3- In vitro growth of NRAS variant cells from patients with congenital melanocytic nevi (CMN). (a) In vitro culture of CMN patient-derived nevus cells without feeder cells. (b) Computed tomographic images of CMN patient-derived nevus cells. (c) Cell counts of CMN-derived nevus cell cultures from four patients over 24 hours. (d) Nuclear SOX10 expression and cytoplasmic tyrosinase expression in proliferating (EdU) nevus cells (d(i)) and undivided cells (EdU-) (ii). (e) Selective proliferation of CMN-derived nevus cells revealed somatic NRAS c.181C>A (patient number) or less common NRAS c.182A>G (patient number) as heterozygous reads on Sanger sequencing. (f) Variation of nevus cell morphologies ranging from nonpolar cells to increasingly complex and expanding multipolar cells. (g) Evaluation of the classification tool as a confusion matrix. (h) Scores for each cell morphology in four different patient cell lines.

[0069] Figure 4 -Use anti-NRAS Q61K Treatment of nevus cells with siRNA reduced MAPK activation and proliferation. (a) Used to evaluate the effects of anti-NRAS treatment. Q61K Experimental design for the proliferation of CMN patient-derived nevus cells after siRNA treatment. (b) In anti-NRAS Q61K NRAS after siRNA treatment WT (c) Relative levels of mRNA relative to untreated cells after normalization. Q61K NRAS after siRNA treatment Q61K (d) Relative levels of mRNA relative to untreated cells after normalization. Q61K (e) Normalized relative levels of total NRAS protein after siRNA treatment compared to untreated cells. Q61K (f) Relative activation of the MAPK signaling pathway after siRNA treatment relative to untreated cells, normalized to standard. Q61K Relative levels of total NRAS, pERK, total ERK, and plaque protein after siRNA treatment. (g) Computed tomography images of nevus cells during the second day of siRNA8 treatment. (h) Anti-NRAS Q61K Cell counts at siRNA-treated cells over 24 hours. (i) Trametinib and / or anti-NRAS Q61KEdU-positive nevus cells (SOX10 / tyrosinase) after siRNA treatment. (j) Trametinib and / or anti-NRAS Q61K Quantitative analysis of siRNA-treated EdU-positive nevus cells relative to untreated cells, normalized. All error bars = standard deviation. (bh) N = 4 patients. (ij) N = 3 patients.

[0070] Figure 5 - Treatment of CMN patient-derived nevus cells with anti-NRASQ61K siRNA and nevus cell characteristics (expression / morphology). (a) Fractions of each cell morphology in four different patient cell lines after treatment with anti-NRASQ61K siRNA8. (be) Effect of siRNA on nevus cell morphology, N=4, bar=SD, two-tailed t-test. (f) Effect of anti-NRASQ61K siRNA8 treatment on EdU-positive cells (N=9, bar=SD). (g) Effect of anti-NRASQ61K siRNA8 treatment on tyrosinase expression (N=9, bar=SD). (h) Effect of anti-NRASQ61K siRNA8 treatment on SOX10 expression (N=9, bar=SD). (i) Effect of anti-NRASQ61K siRNA8 treatment on MITF expression (N=9, bar=SD). (j) Effect of anti-NRASQ61K siRNA8 treatment on nestin expression (N=9, bar=SD).

[0071] Figure 6 - Intradermal delivery of siRNA-containing lipid nanoparticles to the site of nevus cells in human and mouse skin. (a) Injection of siRNA-containing lipid nanoparticles into the dermis of biopsies collected from individuals with CMN (NRASQ61K positive patients) using microneedles. (b) Control skin from the same patient. (c) Injection of siRNA-containing lipid nanoparticles into the dermis of a CMN mouse model (Tg(Tyr-NRAS*Q61K)1Bee) using microneedles. (d) Control skin from the same mouse.

[0072] Figure 7 - Identification of three sgRNAs covering the NRAS c.(181C>A) mutation. The wild-type allele c.(181C) is highlighted in red. The sgRNA sequence is colored in green, and the corresponding SaCas9 PAM sequence is colored in blue. The base c.(181) at the locus is highlighted in yellow to show the change from the wild-type allele c.(181C) to the variant of interest c.(181A).

[0073] Figure 8Enzymatic digestion confirmed the correct insertion of sgRNA1-3 into the plasmid vector px601. BciVI enzymatic digestion screening was used to confirm sgRNA1 or sgRNA2 insertion into three colonies in px601 plasmids (platinum 1, 2, and 3). This figure shows EarI enzymatic digestion screening used to confirm sgRNA3 insertion into four colonies in px601 plasmids (platinum 1 to 4). The negative control consisted of px601 plasmids without any attempted inserts. The positive control consisted of previously obtained plasmids containing sgRNA1 inserts, confirmed by sequencing. The expected fragment size (bp) is shown below the agarose gel image. Fragmentation sizes were derived using the Serial Cloner v.2.6.1 procedure.

[0074] Figure 9 - This shows BciVI enzymatic screening of the px601-GFP plasmid in all tested colonies where sgRNA1 and sgRNA2 were correctly inserted. The three plasmids were tested for insertion of either sgRNA1 or sgRNA2. The last lane contains a negative control with no insertion of px601-GFP. GFP sgRNA 1.1, 1.2, and 1.3 are three separate colonies selected for insertion of sgRNA1 into the px601-GFP plasmid. GFP sgRNA 2.1, 2.2, and 2.3 are three separate colonies selected for insertion of sgRNA2 into the px601-GFP plasmid. Fragmentation sizes were derived using the Serial Cloner v.2.6.1 procedure.

[0075] Figure 10 - This shows EarI screening for correct sgRNA3 insertion into the px601-GFP plasmids in all tested colonies. Three px601-GFP plasmids (GFP sgRNA 3.1, 3.2, and 3.3) were screened for sgRNA3 insertion. The last lane contains a negative control without the insert, px601-GFP. Fragmentation sizes were derived using the Serial Cloner v.2.6.1 program.

[0076] Figure 11-T7 illustrates the enzymatic digestion of the presence of allele-specific gene editing via px601-GFP-sgRNA2 in the HCT116-Q (NRAS variant) cell line. Digestion of the 827 bp PCR product with the T7 enzyme yielded two fragments of 372 bp and 455 bp in the presence of a positive result. The figure shows triplicate biological replicates of each sgRNA in both the HCT116-P and HCT116-Q cell lines; the first sample labeled HCT116-P 1.1 is the result of the first copy of px601-GFP-sgRNA1 transfection in the HCT116-P cell line. Cells were transfected with 250 ng DNA and 3 μL Lipofectamine® 2000 per well in a 24-well plate 48 hours prior to DNA extraction.

[0077] Figure 12 - Sequencing data from single-cell colonies, showing gene editing performed only in the HCT116-Q cell line via sgRNA1 and sgRNA2. DNA sequences from all edited single-cell colonies were compared to both the NRAS wild-type sequence and the NRAS variant c.(181C>A) sequence. For the wild-type allele, the NRAS c.(181) locus is highlighted in red, and for the variant allele, it is highlighted in yellow. Cells highlighted in blue show the results of the gene editing events. The first shows all deletions performed in HCT116-Q via px601-GFP-sgRNA2. The second shows insertions performed in HCT116-Q in colony 12 via px601-GFP-sgRNA1; due to the size of the inserts, this result is shown above two lines, although this is a single sample. The third shows all deletions performed in HCT116-Q in colony 18 via px601-GFP-sgRNA1. The fourth image shows the insertion / deletion via px601-GFP-sgRNA1 in HCT116-Q within colony 16. Single-cell colonies without any gene editing are not shown.

[0078] Figure 13 - Effects of candidate siRNAs on the MAPK pathway. Compared to the NRAS wild-type cell line (c.181C, NRASWT), the siRNAs reduced p-ERK in the NRAS variant cell line (c.181C>A, NRASQ61K). Total ERK and GAPDH were included as comparative load controls.

[0079] Figure 14- Treatment of nevus cells with siRNA8. a, Relative proliferation rate as assessed by EdU incorporation during the last 24 hours (48 hours) of siRNA8 treatment. b, Relative proliferation of nevus cells using overlay imaging / analysis during the 48-hour treatment (hours 24–48). c, RNAseq-normalized counts of NRAS. The fractions of NRASWT and NRASQ61K transcripts were calculated based on reads covering positions of NRAS variants. d, Volcano plot showing fold changes and false discovery rates. Genes with very strong significance and fold changes were identified. e. Heatmap showing genes in pathways responding to siRNA8 (*Metascape WP2290 RALA downstream-regulated genes; M53 PID integrin 3 pathway; GO0007346 regulation of mitotic cell cycle; GO:0007272 neuronal sheath; GO:0008366 axonal sheath) and relatively unaffected melanocyte stem cell and differentiation-related genes. N=7 patients; bars = mean; error bars = SD, one-tailed unpaired t-test. N=4 patients; points = mean; error bars = SD, one-way ANOVA.

[0080] Figure 15 - Targeted NRAS variants from nevus cells in CMN patient tissues. a, Dose-dependent effects on NRASWT (gray) and NRASc.181C>A (black) transcript expression after 48 hours of treatment with different concentrations of siRNA8 (siNRASQ61K) on nevus cell expression. RNAiMAX was used as the delivery vector, and the arrows indicate the concentrations recommended in the manufacturer's protocol. Two patient-derived nevus cell lines were tested (separate circles at each time point), with the perforation line representing the mean of both. b, Western blots of protein lysates collected from all nevus patient cell cultures treated with either a small interference control (siCTRL) or siNRASQ61K for 48 hours. All images are from the same blot. Chemiluminescence imaging was required to detect NRAS protein levels because it is more sensitive than Odyssey. Odyssey (fluorescence) was required to assess pERK levels because it allows for the simultaneous measurement of total ERK and pERK using a second antibody conjugated to fluorophores of different wavelengths. c, d, Effects of 48-hour siNRASQ61K treatment on NRAS homologs KRAS (g) and HRAS (h) of nevus cells. e, The top 10 enriched pathways of genes whose expression was altered by 48-hour siNRASQ61K treatment of nevus cells (standards: >1-fold; <-1-fold; p≤0.05). f, The fraction of nevus cells in each stage of the cell cycle after 48-hour siNRASQ61K treatment (based on DNA content estimation).

[0081] Figure 16 - Treatment of nevus cells with siNRASQ61K induced endoplasmic reticulum (ER) stress and apoptosis. a, Local expression of ARL6IP1 in the ER of patient-derived nevus cells. be, After 48 hours of treatment with siNRASQ61K, ARL6IP1 mRNA expression decreased (b), ARL6IP1 protein expression decreased (c), ER stress sensor ERN1 (IRE1) expression increased (d), and anti-apoptotic survivin (BIRC5) expression decreased (e). f, Caspase 3 / 7 activity in cells treated with siNRASQ61K over 7 days. N=7 patients (b, d, e), N=8 patients (c), bars = mean, error bars = SD, one-tailed unpaired t-test. N=4, bars = mean, error bars = SD, two-way ANOVA (f).

[0082] Figure 17 - Gene expression and antibody reactivity in nevus cells (NRAS c.181C>A (p.Q61K)) treated with siNRASQ61K for 48 hours. RNA-seq data (normalized counts) and relative signal intensities of antibody reactivity from a, TYR, b, SOX10, c, MITF, d, NES, e, DCT, f, CDKN2A, g, P53, and h, ARL6IP1 (note the quantification of ARL6IP1 antibody reactivity in the text). N=7 (individual values), bars = mean, error bars = SD, paired t-test. i, Immunocytochemistry, which shows a decrease in ARL6IP1 (magenta) expression in response to 48 hours of siNRASQ61K treatment. ARL6IP1 was evaluated together with an antibody targeting ribosome-binding glycoprotein 1 (endoplasmic reticulum, green).

[0083] Figure 18- Genes of interest in the HCT116 dataset and endoplasmic reticulum stress-related genes in the nevus cell RNAseq dataset. ac, RNAseq expression data of HCT116 cells (c.181C>A, NRASQ61K) after 48 hours of treatment with siNRASQ61K. a, Volcano plot showing comparable reductions in ARL6IP1 (ARMER, an apoptosis regulator in the endoplasmic reticulum membrane) and NRAS expression. b, Reduced ARL6IP1 expression after siNRASQ61K treatment. c, Reduced survivin (BIRC5) expression after siNRASQ61K treatment. df, RNAseq expression data of the three major ER stress regulators ERN1 (IRE1) (d), EIF2AK3 (PERK) (e), and ATF6 (f) after 48 hours of siNRASQ61K treatment of nevus cells. g, qPCR validation of the EIF2AK3 results on RNAseq did not return statistically significant differences. N=7, bars = mean, error bars = SD, two-tailed unpaired t-test.

[0084] Figure 19 - Treatment of nevus cells with siNRASQ61K demonstrated efficacy and synergy with trametinib. A, Caspase 3 / 7 activity in patient nevus cells after 5 days of treatment with a combination of siNRASQ61K and two concentrations (5 nM and 12.5 nM) of trametinib. b, Caspase 3 / 7 activity in cells treated with (perforated line) or without (solid line) 12.5 nM trametinib in combination with siNRASQ61K for 5 days. N = 4 patients; (a) bar = mean, error bar = SD, one-way ANOVA. N = 5 technical replicas per patient, point = mean, error bar = SD, one-way ANOVA (b).

[0085] Figure 20 - Effect of low concentrations of trametinib and siRNA combined treatment on proliferation. Quantification of EdU in nevus cells (NRAS c.181C>A (p.Q61K)) (N=4) treated for 5 days with a combination of siNRASQ61K and low concentrations (5 nM and 12.5 nM) of trametinib. Cells were treated with EdU during the last 24 hours of the 5-day treatment.

[0086] Figure 21- In vivo delivery and knockdown of nevus cells causing NRAS variants using lipid nanoparticles loaded with siRNA8. A, Intradermal injection of siRNA-cy5 encapsulated in lipid nanoparticles into nevus patient biopsies. B, siRNA encapsulated in lipid nanoparticles can be delivered to dermal cells from nevus patient biopsies. C, A relatively small amount of siRNA not encapsulated in lipid nanoparticles was delivered to dermal cells from nevus patient biopsies. D, Nevus causing NRAS variant expression driven by melanocyte-specific tyrosinase promoters induced ectopic pigment cells in the dermis and subcutaneous tissue of Tyr::NRASQ61K mice. E, No ectopic pigment cells were found in the dermis or subcutaneous tissue of NRASWT mice. F, Intradermal injection of siRNA8 into Tyr::NRASQ61K mice reduced the expression of nevus cells causing NRAS variants. G, Intradermal injection of siRNA8 into Tyr::NRASQ61K mice did not reduce the expression of endogenous mouse NrasWT. N=8, data from two experiments combined, points = individual mice (closed circles = mice treated for 24 hours, open circles = mice treated for 48 hours), bars = mean, error bars = SD, unpaired one-tailed t-test (f, g).

[0087] Figure 22 - Lipid nanoparticles. The following aspects were evaluated for lipid nanoparticles formulated at different ratios: a) size (ζ-mean diameter), b) charge (ζ-potential), and c) siRNA encapsulation. d) Formulations of lipid nanoparticles at a 1:4:1 (lipid:peptide:siRNA) ratio provided better protection of siRNA from RNases than siRNA alone. e) Visualization and f) Particle size distribution of RTNPs calculated using a NanoSight instrument (Malvern). g, siRNA-cy5 was delivered to nevus cells together with RTNPs formulated using different peptides (KKKKKKKKKKKKKKGACXXXXXXCG) (SEQ ID NO: 1348) having the following targeting motifs (XXXXXX): ISVYMM (SEQ ID NO: 1349) (reported to bind to KIT), NRVTNN (SEQ ID NO: 1350) (predicted to bind to KIT), CRGDCL (SEQ ID NO: 1351) (reported to bind to α5β1, αvβ5 and αvβ3 integrins) and CDGRCL (SEQ ID NO: 1352) (no known target).

[0088] Figure 23Intradermal delivery of siRNA Q61K in a mouse model of CMN. a, Tyr::NRASQ61K mice (Tg(Tyr-NRAS*Q61K)1Bee), where the expression of the disease-causing variant NRAS c.181C>A,p.(Q61K) is driven by an endogenous mouse tyrosinase promoter. b, Heterozygous mice for the transgene showed extensive hyperpigmentation of the skin and accumulation of melanocytes in the dermis, which largely summarizes the human phenotype of CMN. c, d, Biopsies of skin extracted one hour after a single intradermal injection of fluorescent siRNA-Cy5 within lipid nanoparticles c, or lipid nanoparticles only d.

[0089] Figure 24 - siRNA treatment of BRAF-mutant melanoma cell lines. A375 and SKMEL28 are homozygous mutant cell lines, and A2058 and G-361 are heterozygous cell lines. siSCRA was used as a negative control, and siUBB was used as a positive control for caspase activation. A) Proliferation analysis determined by percentage of confluence. Data are shown as mean ± SD of triplicate replication wells. B) Apoptosis analysis determined by caspase 3 / 7 activity. Data are shown as mean ± SD of triplicate replication wells. Statistical difference between siSCRA and siBRAFV600E was examined by unpaired t-test, p > 0.05.

[0090] Figure 25 - siRNA treatment of BRAF-mutant melanoma cell lines. Results and Figure 24 The results shown are the same, but the positive control siUBB is not shown to allow for a better view of the changes.

[0091] Figure 26 - siRNA therapy for leptomeningeal melanocytosis (LM). A) Confluence % of primary nevus cell cultures isolated from LM patient biopsies and treated with siRNA8 targeting the NRAS variant. B) Caspase 3 / 7 activation in primary nevus cell cultures isolated from LM patient biopsies and treated with siRNA8 targeting the NRAS variant. ****p<0.0001.

[0092] Figure 27 - In melanoma cell lines with siNRAS Q61K During co-transfection, siBRAF V600E BRAF performed V600E The degree of variant-specific knockdown was maintained. BRAF V600E knockdown in the A2058 melanoma cell line using siRNA combination: RT-qPCR data of RNA levels 48 hours after transfection with a single dose of siRNA. A) siBRAF alone.V600E B) siBRAF transfected in combination with a small interference control V600E C) with siNRAS Q61K Combination transfection of siBRAF V600E The statistical difference between the small interfering control and the targeted siRNA was examined using an unpaired two-tailed t-test. All transfections were performed in triplicate.

[0093] Figure 28 - alone or with siNRAS Q61K When the combination is transfected to the same extent, a single dose of siBRAF V600E Significant apoptosis was induced in the A2058 melanoma cell line (heterozygous). siBRAF V600E induced apoptosis in A2058 cells, both alone and in combination. Apoptosis was determined by caspase 3 / 7 activity. Statistical differences compared to small interference controls were examined using two-dimensional ANOVA; *p<0.05, **p<0.01, ***p<0.001.

[0094] Figure 29 -A series of concentrations of siBRAF used in combination V600E and siNRAS Q61K In the relevant cell line (a heterozygous BRAF cell line for cutaneous melanoma A2058) V600E The study achieved fairly variant-specific knockdown of BRAF or NRAS. BRAF knockdown was performed via siRNA transfection. A) BRAF WT expression. B) BRAF V600E expression. Statistical differences between small interfering controls and the designed siRNA were examined by an unpaired two-tailed t-test. All transfections were performed in triplicate. *p<0.05, **p<0.01, ***p<0.001.

[0095] Figure 30 - In the A2058 melanoma cell line (heterozygous), different concentrations of siBRAF were used. V600E and different concentrations of siNRAS Q61K The combined transfection with different concentrations of siBRAF V600E and siNRAS significantly induced apoptosis. Q61K The effect of the combination of [factors] on apoptosis in A2058 cells. Apoptosis analysis determined by caspase 3 / 7 activity. Statistical differences compared to small interference controls were examined using two-dimensional ANOVA, *p<0.05, **p<0.01, ***p<0.001.

[0096] Figure 31Combination transfection with siNRASQ61K + siBRAFV600E did not impair NRASQ61K variant-specific knockdown in benign melanocytic nevus cell lines and dysplastic leptomeningeal melanocytic cell lines with multiple NRASQ61K variants. Individual and combined siRNA transfections in patient cell lines with three NRASQ61K variants. Statistical differences between small interfering controls and designed siRNAs were examined by an unpaired two-tailed t-test. All transfections were performed in triplicate. *p<0.05, **p<0.01, ***p<0.001.

[0097] Figure 32 - via siBRAF V600E , siNRAS Q61K The reduced expression of ARL6IP1 after siRNA knockdown of the combination of the two demonstrated its effectiveness in various primary nevus cell lines (NRAS). Q61K Mechanism of apoptosis induction in heterozygous NRAS Q61K nevus cells. ARL6IP1 expression levels in NRAS Q61K nevus cells treated with siNRASQ61K alone or in combination with siBRAF V600E. A) Expression of wild-type NRAS and NRAS Q61K. B) Expression of ARL6IP1. Statistical differences between small interfering controls and designed siRNAs, examined by unpaired two-tailed t-test. All transfections were performed in triplicate. *p<0.05, **p<0.01, ***p<0.001.

[0098] Figure 33 - In the primary nevus cell line (NRAS) Q61K Heterozygous) and melanoma cell line (BRAF) V600E In heterozygous and homozygous combinations of siBRAF V600E and siNRAS Q61K The reduction in ARL6IP1 expression after siRNA knockdown was greater than that after knockdown with a single siRNA. ARL6IP1 expression levels in BRAF V600E melanoma cell lines treated with siBRAF V600E alone or in combination with siNRAS Q61K. A) Expression of BRAF wild-type and BRAFV600E in heterozygous A2058s and homozygous SKMEL-28. B) ARL6IP1 expression. Statistical differences between small interfering controls and the designed siRNAs were examined by an unpaired two-tailed t-test. All transfections were performed in triplicate. *p<0.05, **p<0.01, ***p<0.001. Detailed Implementation

[0099] definition

[0100] The following provides some definitions of the terms, techniques, and implementation schemes used in this article.

[0101] As used herein, the term “chimerism” or “genetic chimerism” refers to a condition in which a single organism in a multicellular organism has more than one genotype due to a gene mutation in a single cell during embryonic or fetal development. The offspring of that cell then all carry the same mutation, which will then be present only in those cells. The recent consensus definition is that by birth, an individual derived from a single zygote has more than one genotype coexisting and produces a disease phenotype [1], although the phenotype may not appear until any time after birth. Genetic chimerism can be caused by many different molecular mechanisms and results in chimerism at different levels of inheritance—for example, chimerism may be associated with single-point mutations or whole-chromosome aneuploidy. An embryonic chimeric variant can be passed on to offspring as a germline heterozygous mutation if both conditions are met—first, it affects germ cells (which is usually not definitively known), and second, if the mutation is compatible with life in the germline (which is usually but not always known from epidemiological studies) [1,2,3]. Chimerism is also sometimes used to describe the coexistence of two genotypes in an individual, in which case the variant or mutation appears after birth.

[0102] As used herein, the term "gain-of-function variant" refers to any variant of a gene in which the protein encoded by said gene (i.e., the variant protein) has a variant that confers new or enhanced functions on the protein in terms of its intrinsic function or its role in the interaction of molecules or cascades of molecular interactions, said gain-of-function variant itself acting by alteration of the protein's intrinsic activity or by alteration of its interactions with other molecules. A gain-of-function variant can be a deletion, insertion, or substitution of one or more nucleotides in a gene that causes a change in the function of the encoded protein. In one embodiment, a gain-of-function variant alters the function of the variant protein or alters its interactions with other proteins. In another embodiment, a gain-of-function mutation results in a reduction or removal of the normal wild-type protein, for example, through the interaction of the altered variant protein with said normal wild-type protein. In yet another embodiment, a gain-of-function variant causes an increase or decrease in the normal function of a protein, such that its activity or some or all of its downstream effects are compositionally increased or exaggerated or aggravated in response to relevant physiological stimuli.

[0103] The term "variant" can encompass both disease-causing gene mutations and benign mutations that have no effect on gene function. All types of DNA changes that produce the aforementioned protein alterations are included, such as the deletion, addition, or substitution of one or more nucleotides in a gene that cause a change in the amino acid sequence of the encoded protein.

[0104] "Expression constructs" can be, for example, viral vectors, retroviral vectors, expression cassettes, or plasmids. Expression constructs may also have an RNA polymerase II promoter sequence or an RNA polymerase II promoter sequence, such as the U6 snRNA promoter of the H1 promoter. The expression constructs of this invention include any construct suitable for a suitable expression system, and include, but are not limited to, retroviral vectors, linear expression cassettes, plasmids, and viruses or virus-derived vectors as known in the art. Such expression constructs may include one or more inducible promoters, RNA Pol III promoter systems (such as the U6 snRNA promoter or the HIRNA polymerase III promoter), or other promoters known in the art. Constructs may include one or both strands of siRNA. Expression constructs expressing two strands may also include a loop structure connecting the two strands, or each strand may be transcribed separately from a separate promoter within the same construct. Each strand may also be transcribed from a separate expression construct.

[0105] As used herein, when applied to one or more values ​​of interest, the term “approximately” or “about” means a value similar to the stated reference value. In some embodiments, the term “approximately” or “about” means a range of values ​​falling within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%), 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value, unless otherwise stated or otherwise apparent from the context (except where this amount would exceed 100% of the possible values).

[0106] As used herein, the term “improvement” refers to a disease biomarker that prevents, reduces, or alleviates a state, or improves the condition, severity, or outcome of a subject. Improvement includes, but does not require, complete recovery from or complete prevention of disease symptoms.

[0107] As used herein, the term "comparable" means a system, condition group, effect, or result that is sufficiently similar to the test system, condition group, effect, or result to allow for a scientifically reasonable comparison. Those skilled in the art will understand and appreciate which systems, condition groups, effects, or results are "comparable" to any particular test system, condition group, effect, or result as described herein.

[0108] As used herein, the term "correlation" has its general meaning of "showing a correlation with...". Those skilled in the art will understand that two features, items, or values ​​together show a trend of occurrence and / or change, indicating a correlation between them. In some embodiments, a correlation is statistically significant when the p-value is less than 0.05; in some embodiments, a correlation is statistically significant when the p-value is less than 0.01. In some embodiments, correlation is assessed by regression analysis. In some embodiments, correlation is a correlation coefficient.

[0109] As used herein, the terms “improvement,” “increase,” or “decrease,” or their grammatical equivalents, refer to values ​​relative to a reference (e.g., baseline) measurement, such as a measurement extracted under the equivalent conditions described herein (e.g., in the same individual prior to initiation of the treatment described herein, or in a control individual (or multiple control individuals) without treatment).

[0110] As used herein, generally speaking, a "peptide" is a string of at least two amino acids linked together by peptide bonds. In some embodiments, a polypeptide may comprise at least 3-5 amino acids, each of which is linked together by at least one peptide bond. Those skilled in the art will understand that polypeptides may sometimes optionally include "non-natural" amino acids or other entities that can still be incorporated into the polypeptide chain.

[0111] As used herein, the term "protein" refers to a polypeptide (i.e., a string of at least two amino acids linked together by peptide bonds). Proteins may include portions other than amino acids (e.g., glycoproteins, proteoglycans, etc.) and / or may be otherwise processed or modified. Those skilled in the art will understand that a "protein" can be a complete polypeptide chain (with or without a signal sequence), such as those produced by cells, or it can be a characteristic portion thereof. Those skilled in the art will understand that proteins may sometimes include more than one polypeptide chain, for example, more than one polypeptide chain linked by one or more disulfide bonds or otherwise associated. Polypeptides may contain L-amino acids, D-amino acids, or both, and may contain any of the various amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, etc. In some embodiments, proteins may contain native amino acids, non-native amino acids, synthetic amino acids, and combinations thereof. The term "peptide" is generally used to refer to polypeptides with a length of less than about 100 amino acids, less than about 50 amino acids, less than about 20 amino acids, or less than about 10 amino acids.

[0112] As used herein, the terms “subject,” “individual,” or “patient” refer to any organism to which embodiments of the invention may be used or applied, for example, for experimental, diagnostic, preventive, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.). In a preferred embodiment of the invention, the subject is a human.

[0113] As used herein, the terms "target cell" or "target tissue" refer to any cell, cell type, tissue, or organism. In a preferred embodiment, the target cell or target tissue is a vascular cell, melanocyte, and / or any other cell type containing a mutation.

[0114] As used herein, the term "treatment regimen" refers to any method for partially or completely alleviating, improving, reducing, suppressing, preventing, or delaying the onset of one or more symptoms or features of a disease, symptom, and / or condition, reducing the severity of one or more symptoms or features, and / or reducing the incidence of one or more symptoms or features. It may include administering one or more doses, optionally spaced at regular or varying time intervals. In some embodiments, a treatment regimen is a scheme whose performance is designed to achieve (e.g., within a population of relevant cells, tissues, or organisms) a specific effect (e.g., reduction or elimination of a harmful symptom or disease) and / or associated with achieving said specific effect. In some embodiments, treatment includes administering one or more therapeutic agents simultaneously, sequentially, or at different times, for the same or different durations. In some embodiments, "treatment regimen" includes genetic methods such as gene therapy, gene ablation, or other methods known to induce or reduce expression (e.g., transcription, processing, and / or translation of a specific gene product, such as a primary transcript or mRNA).

[0115] As used herein, the term "therapeutic effective amount" refers to the amount of a therapeutic agent that imparts a therapeutic effect to a treated subject at a reasonable benefit / risk ratio applicable to any medical treatment. This therapeutic effect can be objective (i.e., measurable by some test or biomarker) or subjective (i.e., indicated or perceived by the subject). In some embodiments, "therapeutic effective amount" refers to the amount of a therapeutic agent or composition that effectively treats, improves, or prevents an associated disease or symptom (e.g., delays the onset of an associated disease or symptom or reduces the risk of an associated disease or symptom) and / or exhibits a detectable therapeutic or preventive effect, such as by improving disease-related symptoms, preventing or delaying the onset of a disease, and / or also reducing the severity or frequency of disease symptoms. Therapeutic effective amounts are typically administered in a dosing regimen that may contain multiple unit doses. For any particular therapeutic agent, the therapeutic effective amount (and / or the appropriate unit dose within an effective dosing regimen) can vary, for example, depending on the route of administration or when combined with other therapeutic agents. Alternatively or additionally, the specific therapeutically effective amount (and / or unit dose) for any particular patient may depend on a variety of factors, including the activity of the specific therapeutic agent used; the specific composition used; the patient's age, weight, general health condition, sex, and diet; the timing, route of administration, and / or rate of excretion or metabolism of the specific therapeutic agent used; the duration of treatment; and similar factors well known in the medical field.

[0116] As used herein, the term "treatment" (also "treat" or "treating") refers to any administration of a therapeutic agent according to a treatment regimen to achieve a desired effect, since the therapeutic agent partially or completely relieves, improves, reduces, inhibits, delays the onset of one or more symptoms or features of a particular disease, condition, and / or symptom, reduces the severity of one or more symptoms or features, and / or reduces the incidence of one or more symptoms or features. In some embodiments, the administration of a therapeutic agent according to a treatment regimen is associated with the achievement of the desired effect. This treatment may be for subjects who do not show signs of the relevant disease, condition, and / or symptom and / or for subjects who show only early signs of the disease, condition, and / or symptom. Alternatively or additionally, this treatment may be for subjects who show one or more identified signs of the relevant disease, condition, and / or symptom. In some embodiments, treatment may be for subjects who have been diagnosed with the relevant disease, condition, and / or symptom. In some implementations, treatment may be directed at subjects who are known to have one or more susceptibility factors that are statistically associated with an increased risk of developing a related disease, condition, and / or symptom.

[0117] As used herein, “antisense compound” refers to an oligomeric compound that can hybridize with a target nucleic acid via hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds such as antisense oligonucleotides, siRNA, shRNA, ssRNA, and occupation-based compounds.

[0118] As used in this article, “antisense inhibition” means the reduction in the level of the target nucleic acid in the presence of an antisense compound that is complementary to the target nucleic acid, compared to the level of the target nucleic acid in the absence of an antisense compound.

[0119] As used herein, “antisense mechanism” refers to all those mechanisms involving hybridization of a compound with a target nucleic acid, where the result or effect of hybridization is target degradation or target occupancy, accompanied by the stagnation of cellular mechanisms such as transcription or splicing. “Antisense oligonucleotide” refers to a single-stranded oligonucleotide having a nucleobase sequence that allows hybridization with a corresponding region or segment of the target nucleic acid.

[0120] As used herein, “part” means a defined number of consecutive (i.e., linked) nucleobases of a nucleic acid. In some embodiments, a part is a defined number of consecutive nucleobases of the target nucleic acid. In some embodiments, a part is a defined number of consecutive nucleobases of the antisense compound.

[0121] As used in this article, “prevention” means delaying or preventing the onset, development, or progression of a disease, condition, or symptom for a period of time ranging from minutes to indefinite. “Prevention” also means reducing the risk of developing a disease, condition, or symptom.

[0122] As used herein, "nucleoside" refers to a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (such as those found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate ester moiety.

[0123] As used herein, “chemically modified” or “chemically altered” refers to a chemical difference between a compound and its naturally occurring counterpart. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleotide bond modifications. For oligonucleotides, chemical modifications do not include differences in the nucleobase sequence alone.

[0124] As used herein, "furanosyl" refers to a structure containing a 5-membered ring comprising four carbon atoms and one oxygen atom.

[0125] As used herein, “naturally occurring sugar moiety” means a furanyl ribosome present in naturally occurring RNA or a deoxyfuranyl ribosome present in naturally occurring DNA. As mentioned herein, “naturally occurring sugar moiety” is also referred to as “unmodified sugar moiety.” Specifically, as mentioned herein, this “naturally occurring sugar moiety” or “unmodified sugar moiety” has a -H (DNA sugar moiety) or -OH (RNA sugar moiety) at the 2' position of the sugar moiety, particularly a -H (DNA sugar moiety) at the 2' position.

[0126] As used herein, “sugar moiety” refers to the naturally occurring sugar moiety of a nucleoside or a modified sugar moiety. As used herein, “modified sugar moiety” refers to a substituted sugar moiety or a sugar substitute.

[0127] As used herein, “substituted sugar moiety” means a substituted furanyl glycosyl group. Substituted sugar moiety includes, but is not limited to, furanyl glycosyl groups containing substituents at the 2', 3', 5', and / or 4' positions. Some substituted sugar moiety is a bicyclic sugar moiety.

[0128] As used herein, “2’-substituted sugar moiety” means a furanyl group that contains a substituent at the 2’ position in addition to H or OH. Unless otherwise stated, a 2’-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2’-substituent of the 2’-substituted sugar moiety does not form a bridge with another atom of the furanyl ring).

[0129] As used in this article, "MOE" means -OCH2CH2OCH3.

[0130] As used herein, “2’-F nucleoside” refers to a nucleoside containing a sugar with fluorine at the 2’ position. Unless otherwise stated, the fluorine in 2’-F nucleoside is located at the ribose position (in place of the OH group of native ribose). The duplex of uniformly modified 2’-fluorinated (ribose) oligonucleotides hybridizing with RNA strands is not a substrate for RNase H, while ara analogs retain RNase H activity.

[0131] As used herein, the term "sugar substitute" means a structure that does not contain a furanyl group and is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside subunits can link together and / or link with other nucleosides to form an oligomer capable of hybridizing with complementary oligomers. Such structures include rings (e.g., 4-, 6-, or 7-membered rings) containing a number of atoms different from the number of furanyl groups; substitution of oxygen in the furanyl group by non-oxygen atoms (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and substitution of oxygen. Such structures may also contain substitutions corresponding to those described for the substituted sugar moiety (e.g., a 6-membered carbon-ring bicyclic sugar substitute optionally containing additional substituents). Sugar substitutes also include more complex sugar substitutions (e.g., acyclic systems of peptide nucleic acids). Sugar substitutes include, but are not limited to, morpholino, cyclohexenyl, and cyclohexitol.

[0132] As used herein, "bicyclic sugar moiety" means a modified sugar moiety comprising a 4- to 7-membered ring (including, but not limited to, a furanyl group) and a bridge connecting two atoms of the 4- to 7-membered ring to form a second ring, thereby creating a bicyclic structure. In some embodiments, the 4- to 7-membered ring is a sugar ring. In some embodiments, the 4- to 7-membered ring is a furanyl group. In some such embodiments, the bridge connects the 2' carbon and 4' carbon of the furanyl group.

[0133] As used herein, "nucleotide" means a nucleoside that further comprises a phosphate ester linking group. As used herein, "linked nucleosides" may or may not be linked by a phosphate ester bond, and therefore include, but are not limited to, "linked nucleotides". As used herein, "linked nucleosides" are nucleosides linked in a continuous sequence (i.e., there are no other nucleosides between the linked nucleosides).

[0134] As used herein, "nucleobase" refers to a group of atoms that can be linked to a sugar moiety to produce a nucleoside that can be incorporated into an oligonucleotide, and wherein said group of atoms can bond to a complementary, naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or modified.

[0135] As used herein, the terms “unmodified nucleobase” or “naturally occurring nucleobase” refer to naturally occurring heterocyclic nucleobases in RNA or DNA: purine bases adenine (A) and guanine (G), and pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).

[0136] As used herein, “modified nucleobase” means any nucleobase that is not a naturally occurring nucleobase. As used herein, “modified nucleoside” means a nucleoside that contains at least one chemical modification compared to a naturally occurring RNA or DNA nucleoside. Modified nucleosides may contain modified sugar moieties and / or modified nucleobases.

[0137] As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside containing a bicyclic sugar moiety. As used herein, “locked nucleoside” or “LNA” means a nucleoside containing a bicyclic sugar moiety comprising a 4'-CH2-O-2' bridge. As used herein, “2'-substituted nucleoside” means a nucleoside containing a substituent other than H or OH at the 2' position of the sugar moiety. Unless otherwise stated, 2'-substituted nucleosides are not bicyclic nucleosides.

[0138] As used herein, "deoxynucleoside" means a nucleoside containing a 2'-H furanyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA). In some embodiments, the 2'-deoxynucleoside may contain modified nucleosides or may contain RNA nucleosides (e.g., uracil).

[0139] As used herein, "oligonucleotide" means a compound containing multiple linked nucleosides. In some embodiments, the oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides.

[0140] As used herein, “modified oligonucleotide” means an oligonucleotide containing at least one modified nucleoside and / or at least one modified nucleoside bond.

[0141] As used in this article, "bond" or "linking group" refers to an atomic group that links two or more other atomic groups together.

[0142] As used in this article, "nucleoside bond" refers to the covalent bond between adjacent nucleosides in an oligonucleotide.

[0143] As used herein, “naturally occurring nucleoside interbond” means a 3' to 5' phosphodiester bond. As used herein, “modified nucleoside interbond” means any nucleoside interbond other than naturally occurring nucleoside interbonds. In particular, “modified nucleoside interbond” as mentioned herein can include modified phosphorus-linking groups, such as thiophosphate or dithiophosphate nucleoside interbonds.

[0144] As used in this article, "terminal nucleoside bond" refers to the bond between the last two nucleosides of an oligonucleotide or its defined region.

[0145] As used herein, "phospholinking group" means a linking group containing a phosphorus atom, and may include naturally occurring phosphorus linking groups present in naturally occurring RNA or DNA, such as phosphodiester linking groups, or modified phosphorus linking groups not typically present in naturally occurring RNA or DNA, such as thiophosphate or dithiophosphate linking groups. Therefore, phosphorus linking groups may include, but are not limited to, phosphodiester, thiophosphate, dithiophosphate, phosphonates, phosphoramides, thiophosphoramides, thioalkylphosphonates, triphosphates, thioalkyltriphosphates, and borophosphates.

[0146] As used in this article, "internucleotide phosphorus linking group" refers to a phosphorus linking group that directly connects two nucleosides.

[0147] As used herein, "oligomeric compound" means a polymeric structure comprising two or more substructures. In some embodiments, the oligomeric compound comprises oligonucleotides, such as modified oligonucleotides. In some embodiments, the oligomeric compound further comprises one or more conjugating groups and / or terminal groups and / or ligands. In some embodiments, the oligomeric compound consists of oligonucleotides. In some embodiments, the oligomeric compound comprises a backbone of one or more linked monomeric sugar moieties, wherein each linked monomeric sugar moiety is directly or indirectly linked to a heterocyclic base moiety. In some embodiments, the oligomeric compound may also include a monomeric sugar moiety not linked to a heterocyclic base moiety, thereby providing a base-free site.

[0148] As used herein, "terminal group" means one or more atoms attached to either or both of the 3' or 5' ends of an oligonucleotide. In some embodiments, the terminal group comprises one or more terminal nucleosides.

[0149] As used herein, "conjugate" or "conjugation group" means an atom or atomic group that binds to an oligonucleotide or oligomer compound. In some embodiments, the conjugation group links a ligand to a modified oligonucleotide or oligomer compound. Typically, the conjugation group can modify one or more properties of the compound to which it is linked, including but not limited to pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, cellular uptake, charge, and / or clearance properties.

[0150] As used herein, in the context of a conjugated group, "conjugated linker" or "linker" means the portion of the conjugated group that contains any atom or atomic group and covalently links the oligonucleotide to another portion of the conjugated group. In some embodiments, the linking site on the oligomer is the 3'-oxygen atom of the 3'-hydroxyl group of the 3'-terminal nucleoside of the oligonucleotide. In some embodiments, the linking site on the oligomer is the 5'-oxygen atom of the 5'-hydroxyl group of the 5'-terminal nucleoside of the oligonucleotide. In some embodiments, the bond used to form the link with the oligomer is a cleavable bond. In some such embodiments, such a cleavable bond constitutes all or part of the cleavable portion.

[0151] In some embodiments, the conjugating group comprises a cleavable portion (e.g., a cleavable bond or cleavable nucleoside) and a ligand portion, said ligand portion may comprise one or more ligands, such as a carbohydrate cluster portion, such as an N-acetyl-galactosamine (also known as "GalNAc") cluster portion. In some embodiments, the carbohydrate cluster portion is identified by the number and identity of the ligands. For example, in some embodiments, the carbohydrate cluster portion comprises two GalNAc groups. For example, in some embodiments, the carbohydrate cluster portion comprises three GalNAc groups, and this is particularly preferred. In some embodiments, the carbohydrate cluster portion comprises four GalNAc groups. Such ligand portions are linked to the oligomeric compound via cleavable portions (e.g., cleavable bonds or cleavable nucleosides). The ligands may be arranged in linear or branched configurations, such as biantennary or triantennary.

[0152] As used herein, "cleavable moiety" means a bond or group that can be cleaved under physiological conditions. In some embodiments, the cleavable moiety is cleaved within a cellular or subcellular compartment (such as an endosome or lysosome). In some embodiments, the cleavable moiety is cleaved by an endogenous enzyme (such as a nuclease). In some embodiments, the cleavable moiety comprises an atomic group having one, two, three, four, or more than four cleavable bonds. In some embodiments, the cleavable moiety is a phosphodiester bond.

[0153] As used herein, “cleavable bond” means any chemical bond that can be broken. As used herein, “carbohydrate cluster” means a compound having one or more carbohydrate residues attached to a linker group.

[0154] As used herein, “modified carbohydrate” means any carbohydrate that has one or more chemical modifications relative to naturally occurring carbohydrates. As used herein, “carbohydrate derivative” means any compound that can be synthesized using carbohydrates as starting materials or intermediates.

[0155] As used herein, "carbohydrate" means naturally occurring carbohydrates, modified carbohydrates, or carbohydrate derivatives. A carbohydrate is a biomolecule comprising carbon (C), hydrogen (H), and oxygen (O) atoms. Carbohydrates can include monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, or polysaccharides, such as one or more galactose moieties, one or more lactose moieties, one or more N-acetyl-galactosamine moieties, and / or one or more mannose moieties. Particularly preferred carbohydrates are those with an N-acetyl-galactosamine moiety.

[0156] As used herein, “chain” refers to an oligomeric compound containing linked nucleosides. As used herein, “single-strand” or “single-stranded” refers to an oligomeric compound containing linked nucleosides connected in a continuous sequence without breaks in between. Such single-stranded compounds may include regions with sufficient self-complementarity to enable the formation of stable self-dihexes within a hairpin structure.

[0157] As used herein, "hairpin" refers to a single-stranded oligomer comprising a double-stranded structure formed by base pairing between self-complementary and oppositely oriented sequences within the strand. As used herein, "hairpin ring" refers to an unpaired ring formed by hybridization of linked nucleosides within a hairpin due to self-complementary sequences. The resulting structure appears as a ring or U-shape.

[0158] As used herein, “directionism” refers to the end-to-end chemical orientation of an oligonucleotide based on the chemical convention of carbon atom numbering in the sugar moiety, meaning there will be a 5' end defined by the 5' carbon of the sugar moiety and a 3' end defined by the 3' carbon of the sugar moiety. In a duplex or double-stranded oligonucleotide, the corresponding strands extend in opposite 5' to 3' directions to allow base pairing between them.

[0159] As used herein, a "double-stranded structure" refers to two or more complementary strands or strands of one or more oligonucleotides hybridized together by non-covalent sequence-specific interactions therebetween. Most commonly, hybridization in a double-stranded structure will occur between the nucleobases adenine (A) and thymine (T), and / or adenine (A) and uracil (U), and / or guanine (G) and cytosine (C). A double-stranded structure can be a portion of a single-stranded structure where self-complementarity leads to hybridization, or it can be the result of hybridization between corresponding strands in a double-stranded construct.

[0160] As used herein, "double strand" or "double stranded" refers to a pair of oligomeric compounds that hybridize with each other. In some embodiments, the double-stranded oligomeric compound comprises a first oligomeric compound and a second oligomeric compound.

[0161] As used in this article, “expression” refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, addition of a 5' cap), and translation.

[0162] As used herein, “transcription” or “transcribed” refers to the first step in a series of steps in DNA-based gene expression, in which the target sequence of DNA is copied into RNA (specifically mRNA) by an enzyme, namely RNA polymerase. During transcription, the DNA sequence is read by RNA polymerase, which produces a complementary antiparallel RNA sequence known as the primary transcript.

[0163] As used herein, "target sequence" refers to the nucleoside sequence with which an oligonucleotide is intended to hybridize to produce the desired activity related to the function of a disease or gene of interest. The oligonucleotide and its target sequence have complementarity sufficient to allow hybridization under physiological conditions.

[0164] As used herein, when referring to nucleobases, "nucleobase complementarity" or "complementarity" means a nucleobase capable of base-pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In both DNA and RNA, guanine (G) is complementary to cytosine (C). In some embodiments, complementary nucleobases mean nucleobases of an oligomer capable of base-pairing with nucleobases of its target sequence. For example, if a nucleobase at a position in an oligomer is capable of hydrogen-bonding with a nucleobase at a position in a target sequence, the position of the hydrogen bond between the oligomer and the target sequence is considered complementary at said nucleobase pair. Nucleobases containing certain modifications can maintain their ability to pair with corresponding nucleobases and therefore can still possess nucleobase complementarity.

[0165] As used herein, “non-complementarity” in relation to nucleobases means a pair of nucleobases that do not form hydrogen bonds with each other. As used herein, “complementarity” in relation to oligomers (e.g., linked nucleosides, oligonucleotides) means the ability of such oligomers or regions thereof to hybridize with a target sequence or with regions of the oligomer itself through nucleobase complementarity.

[0166] Complementary oligomers do not need to have nucleobase complementarity at every nucleoside. Instead, some mismatches are tolerated. In some embodiments, the complementary oligomers or regions are complementary at 70% of their nucleobases (70% complementary). In some embodiments, the complementary oligomers or regions are at least 80% complementary. In some embodiments, the complementary oligomers or regions are at least 90% complementary. In some embodiments, the complementary oligomers or regions are at least 95% complementary. In some embodiments, the complementary oligomers or regions are at least 100% complementary.

[0167] As used herein, the term "self-complementarity" in oligomers refers to compounds that can fold back on themselves, thereby producing double strands due to nucleobase hybridization of complementary internal chain regions. Depending on the degree and / or length of the tightness of the chain regions, the compounds can form hairpin rings, junctions, protrusions, or internal rings.

[0168] As used herein, “mismatch” means that when aligning an oligomer with a target sequence and / or the self-complementary region of the oligomer, the oligomer hybridizes due to self-complementarity, and the nucleobases of the oligomer cannot pair with the corresponding nucleobases at the corresponding positions in the target sequence or the oligomer itself.

[0169] As used herein, “hybridization” means pairing of complementary oligomers (e.g., an oligomer and its target sequence). While not limited to a specific mechanism, the most common pairing mechanisms involve hydrogen bonding between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding.

[0170] As used in this article, "specific hybridization" refers to the ability of an oligomer to hybridize with a nucleic acid site with a greater affinity than it has with another nucleic acid site.

[0171] As used herein, “perfectly complementary” for an oligomer or its region means that every nucleobase of the oligomer or its region is capable of pairing with a nucleobase of the complementary nucleic acid target sequence or self-complementary region of the oligomer. Therefore, a perfectly complementary oligomer or its region does not contain mismatched or unhybridized nucleobases relative to the target sequence or self-complementary region of the oligomer.

[0172] As used herein, “complementarity percentage” refers to the percentage of nucleobases in the oligomer that are complementary to the same length portion of the target nucleic acid. The complementarity percentage is calculated by dividing the number of nucleobases in the oligomer that are complementary to the corresponding nucleobases in the target nucleic acid by the total length of the oligomer.

[0173] As used in this article, “identity percentage” means the number of nucleobases in the first nucleic acid that are of the same type as the corresponding nucleobases in the second nucleic acid (regardless of chemical modification) divided by the total number of nucleobases in the first nucleic acid.

[0174] As used in this article, “regulation” means a change in the quantity or quality of a molecule, function, or activity relative to its state before regulation. For example, regulation includes changes in gene expression, either an increase (stimulation or induction) or a decrease (inhibition or reduction).

[0175] The nucleic acid molecules described herein can inhibit the expression of variant NRAS by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. Compared to the inhibition of wild-type NRAS expression, the nucleic acid molecules described herein can also preferentially inhibit the expression of variant NRAS. In other words, the nucleic acid molecules described herein can inhibit the expression of variant NRAS to a greater extent than the degree of inhibition of wild-type NRAS expression. For example, variant NRAS expression can be inhibited by 2, 3, 4, 5, or more times compared to the inhibition of wild-type NRAS expression. The nucleic acid molecules described herein can inhibit the expression of variant NRAS but not the expression of wild-type NRAS.

[0176] As used herein, "modification type" in relation to a nucleoside or a "type" of nucleoside means a chemical modification of the nucleoside and includes both modified and unmodified nucleosides. Therefore, unless otherwise stated, "a nucleoside having a first-type modification" can be an unmodified nucleoside.

[0177] As used herein, “differently modified” means chemical modifications or substituents that are distinct from each other, including the absence of modification. Therefore, for example, MOE nucleosides and unmodified naturally occurring RNA nucleosides are “differently modified,” even if the naturally occurring nucleosides are unmodified. Similarly, DNA and RNA oligonucleotides are “differently modified,” even if both are naturally occurring unmodified nucleosides. Nucleosides that are identical but contain different nucleobases are not differently modified. For example, a nucleoside containing a 2'-OMe modified sugar moiety and an unmodified adenine nucleobase is not differently modified from a nucleoside containing a 2'-OMe modified sugar moiety and an unmodified thymine nucleobase.

[0178] As used herein, "same type of modification" means modifications that are identical to each other, including the absence of any modification. Therefore, for example, two unmodified RNA nucleotides have "same type of modification," even if the RNA nucleotides are unmodified. Such nucleotides with the same type of modification can contain different nucleobases.

[0179] As used herein, “region” or “regions” or “portion” or “portions” means having a function or characteristic as defined herein, and in particular with reference to a plurality of linked nucleosides as provided in the claims and definitions herein. Typically, such regions or portions contain at least 10, at least 11, at least 12, or at least 13 linked nucleosides. For example, such regions may contain 13 to 20 linked nucleosides, such as 13 to 16 or 18 to 20 linked nucleosides. Typically, a first region as defined herein consists substantially of 18 to 20 nucleosides, and a second region as defined herein consists substantially of 13 to 16 linked nucleosides.

[0180] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for administration to animals. In some embodiments, a pharmaceutically acceptable carrier or diluent is sterile saline. In some embodiments, such sterile saline is pharmaceutical-grade saline.

[0181] As used herein, "substituent" and "substituent group" mean an atom or group that replaces an atom or group in a specified parent compound. For example, a substituent in a modified nucleoside is any atom or group that is different from an atom or group present in naturally occurring nucleosides (e.g., a modified 2' substituent is any atom or group other than H or OH located at the 2' position of the nucleoside). Substituent groups may be protected or unprotected. In some embodiments, the compounds of this disclosure have substituents at one or more positions in the parent compound. Substituents may further be substituted by other substituent groups and may be linked to the parent compound directly or via a linking group (such as an oxygen or alkyl or hydrocarbon group).

[0182] Such substituents can exist as modifications to the sugar moiety, particularly substituents at the 2' position of the sugar moiety. Unless otherwise stated, suitable substituents include, but are not limited to, one or more of halogenated, hydroxylated, alkylated, alkenylated, alkynylated, acylated, carboxylated, alkoxylated, alkoxyalkyleneated, and amino substituents. Some substituents as described herein can represent modifications directly linked to the sugar moiety ring (e.g., halogenated directly linked to the sugar ring, such as fluorinated), or modifications indirectly linked to the sugar moiety ring via an oxygen atom that is itself directly linked to the sugar moiety (e.g., alkoxyalkyleneated, such as methoxyethylene, linked to an oxygen atom, thereby generally providing an alkoxyalkylene substituent linked to the 2' position of the sugar moiety as described herein).

[0183] As used herein, "alkyl" means a saturated straight-chain or branched monovalent C1-6 hydrocarbon group, wherein methyl is the most preferred alkyl group as a substituent at the 2' position of the sugar moiety. The alkyl group is generally linked to the oxygen atom at the 2' position of the sugar; therefore, -O alkyl substituents, such as -OCH3 substituents, are generally provided on the sugar moiety of the oligomeric compounds according to the invention. This will be well understood by those skilled in the art.

[0184] As used herein, "alkylene" refers to a saturated straight-chain or branched divalent hydrocarbon group of the general formula -CnH2n-, where n is 1-6. Methylene or ethylene are preferred alkylene groups.

[0185] As used in this article, "alkenyl" refers to a straight-chain or branched unsaturated monovalent carbon. 2-6 The alkenyl group, wherein vinyl or propenyl is the most preferred alkenyl group as a substituent at the 2' position of the sugar moiety. As will be well understood in the art, the degree of unsaturation present in the alkenyl group is the presence of at least one carbon-carbon double bond. The alkenyl group is typically attached to an oxygen atom at the 2' position of the sugar; therefore, generally, -O alkenyl substituents, such as -OCH2CH=CH2 substituents, are provided on the sugar moiety of the oligomeric compounds according to the invention. This will be well understood by those skilled in the art.

[0186] As used herein, "alkynyl" refers to a straight-chain or branched unsaturated C2-6 hydrocarbon group, of which ethynyl is the most preferred alkynyl group as a substituent at the 2' position of the sugar moiety. As will be well understood in the art, the degree of unsaturation present in the alkynyl group is the presence of at least one carbon-carbon triple bond. The alkynyl group is typically attached to an oxygen atom at the 2' position of the sugar, thus generally providing an -O alkynyl substituent on the sugar moiety of the oligomeric compounds according to the invention. This will be well understood by those skilled in the art.

[0187] As used in this article, "carboxyl" is a group having the general formula -CO2H.

[0188] As used herein, “acyl” means a group formed by removing a hydroxyl group from a carboxyl group as defined herein, and has the general formula -C(O)-X, where X is typically C. 1-6 alkyl.

[0189] As used in this article, "alkoxy" refers to an alkyl group (such as C12-C ... 1-6 An alkoxy group is a group between an alkyl group and an oxygen atom, wherein the oxygen atom is used to connect the alkoxy group to the parent molecule (e.g., at the 2' position of the sugar moiety) or to another group, such as an alkylene group as defined herein. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, and tert-butoxy. As used herein, an alkoxy group may optionally include additional substituent groups.

[0190] As used herein, alkoxyalkylene refers to an alkoxy group as defined herein and attached to an alkylene group as also defined herein, wherein the oxygen atom of the alkoxy group is attached to the alkylene group and the alkylene group is attached to the parent molecule. The alkylene group is typically attached to the oxygen atom at the 2' position of the sugar, thus generally providing an -O alkylene alkoxy substituent, such as an -OCH2CH2OCH3 substituent, on the sugar moiety of the oligomeric compounds according to the invention. This will be well understood by those skilled in the art and is generally referred to as a MOE substituent as defined herein and as known in the art.

[0191] As used herein, "amino" includes primary, secondary, and tertiary amino groups. As used herein, "halogenated" and "halogen" refer to atoms selected from fluorine, chlorine, bromine, and iodine.

[0192] It should also be understood that nucleic acid molecules or compounds as described herein may have one or more non-hybridized nucleosides (protruding ends) and / or one or more internal non-hybridized nucleosides (mismatches) at one or both ends of one or two strands, provided that sufficient complementarity to maintain hybridization is present under physiologically relevant conditions. Alternatively, oligomeric compounds as described herein may be blunt-ended at at least one end.

[0193] The term “comprising” is used herein to mean including identified method steps or elements, but such steps or elements do not contain an exclusive list and therefore additional steps or elements may exist.

[0194] Furthermore, in the context of the use of the term "comprising" in the specific description or claims, this term is intended to be inclusive in a manner similar to that of the term "including," since "including" is interpreted as a transitional word in the claims when adopted.

[0195] Microneedles, microneedle patches, or microarray patches are micrometer-scale medical devices for administering therapeutic agents. Microneedles can be used for percutaneous drug delivery applications and can also be used for intraocular, vaginal, transnasal, cardiac, vascular, gastrointestinal, and cochlear drug delivery. Microneedles are constructed using various methods, typically involving photolithography or micromolding. These methods involve etching microstructures into resin or silicon to cast the microneedles. Microneedles are made from a variety of materials, including silicon, titanium, stainless steel, and polymers. Some microneedles are made with drugs to be delivered to the body but are shaped like needles so that they will penetrate the skin. Microneedles vary in size, shape, and function, but all serve as alternatives to other delivery methods, such as conventional hypodermic needles or other injection devices.

[0196] Microneedles are typically applied using either a single needle or a small array. The array used is a collection of microneedles ranging from just a few to hundreds, connected to an applicator, sometimes a patch or other solid-state device. The array is applied to the patient's skin, allowing sufficient time for effective drug delivery. The size of individual microneedles can be optimized based on desired microneedle size, such as the target depth, the strength requirements of the needles to avoid rupture of specific tissue types, etc.

[0197] Solid microneedles are designed as a two-part system; first, an array of microneedles is applied to the skin to create micropores just deep enough to penetrate the outermost layer of the skin, and then medication is applied via a percutaneous patch. Solid microneedles have been used by dermatologists for collagen induction therapy, a method that uses repeated punctures of the skin with microneedles to induce the expression and deposition of collagen and elastin proteins in the skin.

[0198] Hollow microneedles are similar in material to solid microneedles. They contain reservoirs for direct drug delivery to the site of infection. Because drug delivery depends on the flow rate of the microneedles, this type of array is susceptible to clogging due to over-swelling or defective design.

[0199] Coated microneedles are typically designed from polymers or metals. In this method, the drug is applied directly to the microneedle array, rather than through other patches or applicators. The coated microneedles are often covered with other surfactants or thickeners to ensure proper drug delivery.

[0200] Soluble microneedles encapsulate drugs in a non-toxic polymer that dissolves upon contact with the skin. This polymer allows for drug delivery to the skin and can be broken down upon contact with the body. Polymers, such as silk fibroin (a silk-based protein), can be molded into structures like microneedles and dissolve upon contact with the body.

[0201] Microneedles that form a hydrogel encapsulate the drug within the polymer. These microneedles can penetrate the stratum corneum and draw out interstitial fluid, causing the polymer to swell. The drug then enters the skin from the swollen matrix.

[0202] Different methods for producing lipid-encapsulated RNA nanoparticles are known to those skilled in the art. Techniques for preparing lipid-encapsulated RNA nanoparticles using a static mixer that provides a turbulent environment via an ethanol injection method are known, wherein the lipid-encapsulated RNA nanoparticles are combined with therapeutic molecules after vesicle formation. Other techniques for forming lipid-encapsulated RNA nanoparticles using non-turbulent mixing and a series of successive stepwise dilutions are known. Particles can also be formed by spraying lipids through an orifice onto nucleic acids flowing through an aqueous solution in an organic solution tube. Parameters used to produce lipid-encapsulated RNA nanoparticles can be varied according to desired properties.

[0203] Nanodelivery systems, such as ruxolitinib and thalidomide co-delivered polyelectrolyte nanocomposites (RTNPs), can be engineered to mimic viruses while maintaining the safety of non-viral particles. One approach is to encourage delivery to specific cell types by incorporating peptides into the particles, said peptides having affinity for cell surface receptors or other proteins specific to the cell type of interest. Often, the peptides targeting specific cell types are unknown, and novel amino acid sequences with affinity for the specific cell type of interest can be identified experimentally (e.g., phage display library biopanning).

[0204] For this purpose, along with the selection of optimal lipids, there exists a modular approach for testing hypotheses to identify properties that optimally deliver cargo to the cell type of interest [3]. Recent studies have used pre-existing literature to design peptides that target receptors on specific cell types in the skin: fibroblasts, melanocytes, and keratinocytes [4]. However, unbiased approaches to identifying novel cell-targeting peptides using phage display libraries are expected to reveal the most effective peptides for this purpose. Furthermore, the cells of interest are typically pathological and / or the closest equivalent cells to healthy individuals. Therefore, it is important to study these cells specifically to target nanodelivery systems most effectively.

[0205] In some implementations, a recombinant viral envelope is used to encapsulate and deliver siRNA. The recombinant membrane vesicles may contain viral spike proteins and additional cationic lipids. The siRNA-loaded vesicles are taken up via receptor-mediated endocytosis and can evade endosome degradation by fusing with the endosome membrane. Functional siRNA delivery has been demonstrated in vitro and in vivo. As with some viral methods, the disadvantages of this system are difficulty in repeating administration and limited control over the transduced cell types.

[0206] In some implementations, DNA encoding siRNA can be delivered virally for in vivo gene silencing. To improve specificity, the virus's natural tropism towards certain cell types can be utilized. In some implementations, the virus's natural tropism towards therapeutically useful receptors on the surface of target cells can be redirected. Examples include retargeting mouse coronaviruses to human epidermal growth factor receptors, directing adenoviruses towards their associated receptor (FGFR1) via fibroblast growth factor ligands for delivery to gliomas, or delivering adenoviruses to angiogenic endothelium via an RGD peptide that binds to αv-integrin. A particular advantage of viral delivery methods is the highly efficient transduction of cells.

[0207] In some embodiments, the compounds of the present invention can be delivered via non-viral delivery. While viral vectors offer many desirable properties for efficient nucleic acid delivery, non-viral vectors offer additional advantages. Important benefits of synthetic vector systems are safety (associated with their lack of immunogenicity and low integration frequency) and ease of large-scale production. Furthermore, they can accommodate a wide range of nucleic acid sizes, and they allow for easy modification.

[0208] Non-viral delivery systems may require the incorporation of functional groups into the compounds of this invention. Typically, cationic functional groups are needed to bind to and condense nucleic acids, thereby protecting them from nucleases and (importantly for siRNA) increasing the apparent molecular weight above the renal clearance cutoff.

[0209] Nucleic acid molecules targeting multiple variants

[0210] In some cases, nucleic acid molecules as described herein can be used to target two different NRAS variants, particularly two or more NRAS alleles at the same position. For example, a single nucleic acid molecule containing a sequence targeting Q61K can be adapted to also target Q61R, since this mutation involves substitutions at different positions in the nucleotide sequence (C181A substitution for Q61K and A182G substitution for Q61R). Therefore, this single nucleic acid molecule can be contained with AG complementary at positions 181 and 182 to target the sequences of both Q61K and Q61R variants. The foregoing is merely an example, and the nucleic acid molecules described herein can be used to target various combinations of NRAS variants (e.g., Q61K and Q61L; Q61K and Q61H, etc.).

[0211] This document describes a nucleic acid molecule comprising a sequence that is completely complementary to a sequence having at least 80% identity with an isolong portion of mRNA encoding a first variant NRAS and a sequence having at least 80% identity with an isolong portion of mRNA encoding a second variant NRAS, wherein the second variant NRAS is different from the first variant NRAS. This document also describes a nucleic acid molecule comprising a sequence that is completely complementary to a sequence having at least 80% identity with an isolong portion of mRNA encoding a first variant NRAS and a sequence having at least 80% identity with an isolong portion of mRNA encoding a second variant NRAS. For example, this document describes a nucleic acid molecule comprising a sequence that is completely complementary to a sequence having at least 80% identity with an isolong portion of mRNA encoding variant NRAS p.(Q61K) and a sequence having at least 80% identity with an isolong portion of mRNA encoding variant NRAS p.(Q61R). The nucleic acid molecule may contain a first strand containing a sequence having at least 80% identity with a sequence selected from the group consisting of SEQ ID NO: 187-205 and at least 80% identity with a sequence selected from the group consisting of SEQ ID NO: 225-243.

[0212] Pharmaceutical composition of a pharmaceutical agent

[0213] As used herein, "pharmaceutical composition" means a mixture of substances suitable for individual administration. For example, a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.

[0214] As used herein, “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of an antisense compound, that is, a salt that retains the desired biological activity of the parent oligonucleotide and does not impart undesirable toxicological effects to it.

[0215] Other aspects of the invention relate to a pharmaceutical product or diagnostic aid comprising a composition according to the invention or a nucleic acid according to the invention, and, where appropriate, suitable excipients and additives, such as physiological saline solution, stabilizers or protease inhibitors.

[0216] antisense mechanism

[0217] In some embodiments, the antisense compound has chemically modified subunits arranged in a pattern or motif to impart properties to the antisense compound such as enhanced inhibitory activity, increased binding affinity to the target nucleic acid, or resistance to degradation by nucleases in vivo.

[0218] Chimeric antisense compounds typically contain at least one modified region to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity to target nucleic acids, and / or increased inhibitory activity. A second region of the chimeric antisense compound can confer another desired property, for example, as a substrate for a cellular endonuclease, RNase H, which cleaves the RNA strand of the RNA:DNA duplex.

[0219] Antisense activity can arise from any mechanism involving hybridization of an antisense compound (e.g., an oligonucleotide) with a target nucleic acid, where the hybridization ultimately produces a biological effect. In some embodiments, the amount and / or activity of the target nucleic acid is modulated. In some embodiments, the amount and / or activity of the target nucleic acid is reduced. In some embodiments, the hybridization of the antisense compound with the target nucleic acid ultimately leads to the degradation of the target nucleic acid. In some embodiments, the hybridization of the antisense compound with the target nucleic acid does not lead to the degradation of the target nucleic acid. In some such embodiments, the presence of the antisense compound (occupying) hybridizing with the target nucleic acid results in the modulation of antisense activity. In some embodiments, antisense compounds having specific chemical motifs or chemical modification patterns are particularly suitable for utilizing one or more mechanisms. In some embodiments, the antisense compound acts through more than one mechanism and / or through a mechanism not yet elucidated. Therefore, the antisense compounds described herein are not limited to a specific mechanism.

[0220] Antisense mechanisms include, but are not limited to, RNase H-mediated antisense; RNAi mechanisms, which utilize the RISC pathway and include, but are not limited to, siRNA, ssRNA, and microRNA mechanisms; and occupation-based mechanisms. Some antisense compounds may function through more than one of these mechanisms and / or through additional mechanisms.

[0221] RNase H-mediated antisense. In some embodiments, antisense activity is at least partially caused by the degradation of target RNA by RNase H. RNase H is a cellular endonuclease that cleaves the RNA:DNA double-stranded RNA chain. It is known in the art that "DNA-like" single-stranded antisense compounds induce RNase H activity in mammalian cells. Therefore, antisense compounds containing at least a portion of DNA or a DNA-like nucleotide can activate RNase H, thereby leading to cleavage of the target nucleic acid. In some embodiments, antisense compounds utilizing RNase H contain one or more modified nucleotides. In some embodiments, such antisense compounds contain at least one block consisting of 1-8 modified nucleotides. In some such embodiments, the modified nucleotides do not support RNase H activity.

[0222] RNAi compounds. In some embodiments, the antisense compound is an interfering RNA compound (RNAi), which includes double-stranded RNA compounds (also referred to as short interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds function at least partially through the RISC pathway to degrade and / or isolate the target nucleic acid (therefore, including microRNA / microRNA-mimicking compounds). In some embodiments, the antisense compound contains modifications that make it particularly suitable for such mechanisms.

[0223] Conjugate

[0224] In some embodiments, this disclosure provides conjugated antisense compounds. In some embodiments, this disclosure provides conjugated antisense compounds comprising antisense oligonucleotides complementary to nucleic acid transcripts. In some embodiments, this disclosure provides a method comprising contacting a cell with a conjugated antisense compound comprising antisense oligonucleotides complementary to nucleic acid transcripts. In some embodiments, this disclosure provides a method comprising contacting a cell with a conjugated antisense compound comprising antisense oligonucleotides and reducing the amount or activity of nucleic acid transcripts in the cell.

[0225] The desialylate glycoprotein receptor (ASGP-R) has been previously described. See, for example, Park et al., PNAS Vol. 102, No. 47, pp. 17125-17129 (2005). This type of receptor is expressed on liver cells, particularly hepatocytes. Furthermore, it has been shown that compounds comprising a cluster of three N-acetylgalactosamine (GalNAc) ligands can bind to ASGP-R, thereby enabling the compound to be taken up into the cell. See, for example, Khorev et al., Bioorganic and Medicinal Chemistry, 16, 9, pp. 5216-5231 (May 2008).

[0226] Therefore, conjugates containing such GalNAc clusters have been used to promote the uptake of certain compounds into liver cells, particularly hepatocytes. For example, certain GalNAc-containing conjugates have been shown to increase the activity of double-stranded siRNA compounds in hepatocytes in vivo. In such cases, the GalNAc-containing conjugates are typically linked to the sense strand of the siRNA double strand. Since the sense strand is discarded before the antisense strand ultimately hybridizes with the target nucleic acid, there is little concern that the conjugate will interfere with activity. This paper discloses conjugated single-stranded antisense compounds that exhibit improved potency in hepatocytes in vivo compared to the same antisense compound lacking the conjugate.

[0227] In some embodiments, the conjugation group herein comprises a cleavable moiety. As noted, it is not desirable to be bound by a specific mechanism; logically, the conjugate should remain on the compound for a sufficiently long time to provide enhanced uptake, but after which it is desirable that some or ideally all of the conjugate be cleaved, thereby releasing the parent compound (e.g., the antisense compound) in its most active form. In some embodiments, the cleavable moiety is a cleavable nucleoside. Such embodiments utilize endogenous nucleases in the cell by linking the remaining portion (cluster) of the conjugate to an antisense oligonucleotide via one or more cleavable bonds (such as cleavable bonds of phosphodiester bonds). In some embodiments, the cluster is bound to the cleavable nucleoside via a phosphodiester bond. In some embodiments, the cleavable nucleoside is linked to the antisense oligonucleotide (antense compound) via a phosphodiester bond. In some embodiments, the conjugation group may comprise two or three cleavable nucleosides. In such embodiments, such cleavable nucleosides are linked to the antisense compound and / or cluster via cleavable bonds (such as cleavable bonds of phosphodiester bonds). Some of the conjugates described in this paper do not contain cleavable nucleosides, but instead contain cleavable bonds. It is shown that the full cleavage of the conjugates from the oligonucleotides is provided by at least one readily cleavable bond in the cell (the cleavable bond).

[0228] In some implementations, the conjugated antisense compound is a prodrug. Such a prodrug is administered to an animal and eventually metabolized into a more active form. For example, the conjugated antisense compound is cleaved to remove all or part of the conjugate, thereby producing an active (or more active) form of the antisense compound lacking all or part of the conjugate.

[0229] In some embodiments, the conjugate is attached to the 5' end of the oligonucleotide. Some such 5'-conjugates are cleaved more efficiently than their counterparts with similar conjugate groups attached to the 3' end. In some embodiments, the improved activity may be associated with improved cleavage. In some embodiments, oligonucleotides containing the conjugate at the 5' end are more potent than those containing the conjugate at the 3' end. In some embodiments, oligonucleotides containing the conjugate at the 3' end are more potent than those containing the conjugate at the 5' end. The 5' attachment allows for simpler oligonucleotide synthesis.

[0230] Typically, oligonucleotides are synthesized on a solid support along the 3' to 5' direction. To prepare 3'-conjugated oligonucleotides, a pre-conjugated 3' nucleoside is usually linked to the solid support, and then the oligonucleotide is constructed as usual. However, linking the conjugated nucleoside to the solid support increases the complexity of the synthesis. Furthermore, using this method, the conjugate is then present throughout the oligonucleotide synthesis and can be degraded during subsequent steps, or may limit the variety of reactions and reagents that can be used. Using the structures and techniques described herein for 5'-conjugated oligonucleotides, oligonucleotides can be synthesized using standard automated techniques, and the conjugate can be introduced either together with the final (most 5') nucleoside or after the oligonucleotide has already been cleaved from the solid support.

[0231] Given the art and this disclosure, those skilled in the art can readily prepare any of the conjugates and conjugated oligonucleotides described herein. Furthermore, the synthesis of certain such conjugates and conjugated oligonucleotides disclosed herein is easier and / or requires fewer steps, and is therefore less expensive than the synthesis of previously disclosed conjugates, thus offering advantages in manufacturing. For example, the synthesis of certain conjugates consists of fewer synthetic steps compared to the synthesis of previously described conjugates, resulting in increased yields.

[0232] splicing joint

[0233] In some embodiments, the conjugating group comprises a linker. In some such embodiments, the linker is covalently bound to a cleavable moiety. In some such embodiments, the linker is covalently bound to an antisense oligonucleotide. In some embodiments, the linker is covalently bound to a cell-targeting moiety. In some embodiments, the linker further comprises a covalent link to a solid-phase support. In some embodiments, the linker further comprises a covalent link to a protein-binding moiety. In some embodiments, the linker further comprises a covalent link to a solid-phase support and further comprises a covalent link to a protein-binding moiety. In some embodiments, the linker includes multiple sites for attaching a binding ligand. In some embodiments, the linker includes multiple sites for attaching a binding ligand and is not attached to a branching group. In some embodiments, the linker further comprises one or more cleavable bonds. In some embodiments, the conjugating group does not include a linker.

[0234] In some embodiments, the linker includes at least one linear group, said at least one linear group comprising a group selected from: alkyl, amide, disulfide, polyethylene glycol, ether, thioether (-S-), and hydroxyamino (-ON(H)-). In some embodiments, the linear group comprises a group selected from alkyl, amide, and ether. In some embodiments, the linear group comprises a group selected from alkyl and ether. In some embodiments, the linear group comprises at least one phosphorus linker. In some embodiments, the linear group comprises at least one phosphodiester group. In some embodiments, the linear group comprises at least one neutral linker. In some embodiments, the linear group is covalently linked to the cell-targeting portion and the cleavable portion. In some embodiments, the linear group is covalently linked to the cell-targeting portion and the antisense oligonucleotide. In some embodiments, the linear group is covalently linked to the cell-targeting portion, the cleavable portion, and the solid-phase carrier. In some embodiments, the linear group is covalently linked to the cell-targeting portion, the cleavable portion, the solid-phase carrier, and the protein-binding portion. In some embodiments, the linear group comprises one or more cleavable bonds.

[0235] In some embodiments, the connector comprises a linear group covalently linked to the scaffold group. In some embodiments, the scaffold comprises a branched aliphatic group, the branched aliphatic group comprising a group selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In some embodiments, the scaffold comprises a branched aliphatic group, the branched aliphatic group comprising a group selected from alkyl, amide, and ether groups. In some embodiments, the scaffold comprises at least one monocyclic or polycyclic ring system. In some embodiments, the scaffold comprises at least two monocyclic or polycyclic ring systems. In some embodiments, the linear group is covalently linked to the scaffold group, and the scaffold group is covalently linked to the cleavable portion and the connector. In some embodiments, the linear group is covalently linked to the scaffold group, and the scaffold group is covalently linked to the cleavable portion, the connector, and the solid-phase support. In some embodiments, the linear group is covalently linked to the scaffold group, and the scaffold group is covalently linked to the cleavable portion, the connector, and the protein-binding portion. In some embodiments, the linear group is covalently linked to the scaffold group, and the scaffold group is covalently linked to the cleavable portion, the linker, the protein-binding portion, and the solid support. In some embodiments, the scaffold group includes one or more cleavable bonds.

[0236] In some embodiments, the connector includes a protein-binding portion. In some embodiments, the protein-binding portion is a lipid (e.g., including but not limited to cholesterol, bile acids, adamantane acetic acid, 1-pyrene butyrate, dihydrotestosterone, 1,3-bis-O-(hexadecyl)glycerol, geranyloxyhexyl, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, myristic acid, 0.3-(oleoyl)lithocholic acid, 0.3-(oleoyl)cholenic acid, dimethoxytriphenylmethyl, or phenoxazine), a vitamin (e.g., folic acid, vitamin A, vitamin E, biotin, pyridoxine), or a vitamin (e.g., folic acid, vitamin A, vitamin E, biotin, pyridoxine). Aldehydes), peptides, carbohydrates (e.g., monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, polysaccharides), endosome-soluble components, steroids (e.g., uvaol, hecigenin, diosgenin), terpenes (e.g., triterpenes, such as sarsasapogenin, friedelin, epifriedelanol-derived cholic acid), or cationic lipids. In some embodiments, the protein-binding moiety is C. 16 To C 22 Long-chain saturated or unsaturated fatty acids, cholesterol, bile acids, vitamin E, adamantane, or 1-pentafluoropropyl.

[0237] Combination therapy

[0238] In some embodiments, the invention is characterized by comprising a composition (e.g., one or more compositions, formulations, or dosage forms) or pharmaceutical combination comprising a double-stranded RNA molecule or a compound or composition comprising a double-stranded RNA molecule and a conjugate according to the invention, and a second therapeutic agent. In some embodiments, the invention is characterized by comprising a composition (e.g., one or more compositions, formulations, or dosage forms) or pharmaceutical combination comprising a therapeutic agent and a second therapeutic agent according to the invention.

[0239] In some embodiments, the composition comprises a pharmaceutically acceptable carrier or diluent. In some embodiments, the double-stranded RNA molecule or a compound comprising a double-stranded RNA molecule and a conjugate, and the second agent, may be present in a single composition or as two or more different components. The double-stranded RNA molecule or a compound comprising a double-stranded RNA molecule and a conjugate, and the second agent, may be administered via the same route of administration or via different routes of administration. The double-stranded RNA molecule or a compound comprising a double-stranded RNA molecule and a conjugate, and the second agent, may be administered simultaneously or sequentially. In some embodiments, the pharmaceutical combination comprises, alone or together, a double-stranded RNA molecule or a compound comprising a double-stranded RNA molecule and a conjugate, and the second agent.

[0240] The methods of the present invention described herein may include administering the nucleic acid molecules, compounds, compositions, or prodrugs described herein in combination with a second therapeutic agent. The second therapeutic agent may be an anticancer agent or a chemotherapeutic agent. For example, the second therapeutic agent may be a protein kinase inhibitor, such as a MEK inhibitor. The second therapeutic agent may be trametinib. The second therapeutic agent may be administered simultaneously, separately, or sequentially with the nucleic acid molecules, compounds, compositions, or prodrugs described herein. A pharmaceutical composition comprising a combination of a double-stranded ribonucleic acid molecule as described herein and trametinib is also described herein.

[0241] Combined NRAS and BRAF

[0242] This article also describes a composition comprising two nucleic acid molecules, wherein a first nucleic acid molecule targets variant NRAS and a second nucleic acid molecule targets variant BRAF. Such compositions can be advantageously used to treat, reduce, or remove acquired nevi (common nevi). Acquired nevi express either variant NRAS or variant BRAF (i.e., the acquired nevi do not carry mutations in either variant). The inventors utilize this expression pattern by providing a composition that can target both variant NRAS and variant BRAF. This avoids the need for initial sequencing analysis to determine which variants are present in the nevus, as the composition can target both NRAS and BRAF variants. This composition is advantageous because genotyping is not required prior to application. Treatment, reduction, or removal of acquired nevi can also provide benefits in the prevention of cancers such as melanoma.

[0243] Therefore, this document provides a composition comprising a first nucleic acid molecule and a second nucleic acid molecule, wherein the first nucleic acid molecule comprises a first strand consisting of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding a variant NRAS; and wherein the second nucleic acid molecule comprises a first strand consisting of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding a variant BRAF. The composition may comprise a combination of any nucleic acid molecule described herein for targeting NRAS and any nucleic acid molecule described herein for targeting BRAF.

[0244] One advantage of the composition is that it eliminates the need for genotyping or sequencing of acquired nevi prior to application. Consistent with this, the composition may contain multiple siRNAs targeting different NRAS variants / alleles and / or multiple siRNAs targeting different BRAF variants. For example, the composition may contain siRNAs targeting NRAS Q61K, NRAS Q61R, and NRAS Q61L, as well as siRNAs targeting BRAF V600E and BRAF V600K. The composition may contain at least two, at least three, at least four, at least five, or at least six nucleic acid molecules targeting different NRAS variants. The composition may also contain at least two, at least three, at least four, at least five, or at least six nucleic acid molecules targeting different BRAF variants. The composition may comprise at least three nucleic acid molecules targeting NRAS variants, wherein said three nucleic acid molecules target different NRAS variants; and at least two nucleic acid molecules targeting BRAF variants, wherein said at least two nucleic acid molecules target different BRAF variants. The composition may comprise at least two nucleic acid molecules targeting NRAS variants, wherein said two nucleic acid molecules target different NRAS variants; and at least two nucleic acid molecules targeting BRAF variants, wherein said at least two nucleic acid molecules target different BRAF variants. The composition may comprise at least three nucleic acid molecules targeting NRAS variants, wherein said three nucleic acid molecules target different NRAS variants; and at least one nucleic acid molecule targeting a BRAF variant. The composition may comprise at least two nucleic acid molecules targeting NRAS variants, wherein said two nucleic acid molecules target different NRAS variants; and at least one nucleic acid molecule targeting a BRAF variant.

[0245] The composition may also contain nucleic acid molecules targeting variant NRAS and variant BRAF in different ratios. Variant BRAF is a more common cause of acquired melanocytic nevi than variant NRAS. However, there are more variant NRAS alleles than variant BRAF alleles. The ratio of nucleic acid molecules targeting variant NRAS to variant BRAF can be varied accordingly.

[0246] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding the variant NRAS, wherein the variant NRAS contains mutations at positions Q61, G60, G12 and / or G13 relative to the wild-type NRAS, and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding the variant BRAF, wherein the variant BRAF contains a mutation at position V600 relative to the wild-type BRAF.

[0247] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding the variant NRAS, wherein the variant NRAS contains a mutation at position Q61 relative to the wild-type NRAS, and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding the variant BRAF, wherein the variant BRAF contains a mutation at position V600 relative to the wild-type BRAF.

[0248] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding the variant NRAS, wherein the variant NRAS contains a mutation at position G60 relative to the wild-type NRAS, and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding the variant BRAF, wherein the variant BRAF contains a mutation at position V600 relative to the wild-type BRAF.

[0249] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding the variant NRAS, wherein the variant NRAS contains a mutation at position G12 relative to the wild-type NRAS, and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding the variant BRAF, wherein the variant BRAF contains a mutation at position V600 relative to the wild-type BRAF.

[0250] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding the variant NRAS, wherein the variant NRAS contains a mutation at position G13 relative to the wild-type NRAS, and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding the variant BRAF, wherein the variant BRAF contains a mutation at position V600 relative to the wild-type BRAF.

[0251] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isotropic portion of the mRNA encoding variants NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isotropic portion of the mRNA encoding variants BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E).

[0252] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isotropic portion of the mRNA encoding variants NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isotropic portion of the mRNA encoding variant BRAF p.(V600E).

[0253] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600E).

[0254] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61R), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600E).

[0255] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61H), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600E).

[0256] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61L), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600E).

[0257] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61P), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600E).

[0258] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600G).

[0259] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600M).

[0260] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600D).

[0261] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600R).

[0262] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600K).

[0263] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 80% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 80% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600E).

[0264] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 85% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 85% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600E).

[0265] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600E).

[0266] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 95% identity with an isolong portion of the mRNA encoding variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having at least 95% identity with an isolong portion of the mRNA encoding variant BRAF p.(V600E).

[0267] The first strand of the first nucleic acid molecule may contain a sequence that is completely complementary to a sequence having 100% identity with the same length portion of the mRNA encoding variant NRAS p.(Q61K), and the first strand of the second nucleic acid molecule may contain a sequence that is completely complementary to a sequence having 100% identity with the same length portion of the mRNA encoding variant BRAF p.(V600E).

[0268] In some cases, the variant NRAS p.(Q61K) is caused by a c.C181A mutation in the NRAS genome sequence. The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 206-224. The first strand of the first nucleic acid molecule may contain a sequence selected from the group consisting of SEQ ID NO: 206-224. The first strand of the first nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NO: 206-224. The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence shown in SEQ ID NO: 213. The first strand of the first nucleic acid molecule may contain the sequence shown in SEQ ID NO: 213. The first strand of the first nucleic acid molecule may consist of the sequence shown in SEQ ID NO: 213.

[0269] In some cases, the variant NRAS p.(Q61K) is caused by a c.C181A mutation in the NRAS genome sequence. The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 187-205. The first strand of the first nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NO: 187-205. The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence shown in SEQ ID NO: 194. The first strand of the first nucleic acid molecule may contain the sequence shown in SEQ ID NO: 194. The first strand of the first nucleic acid molecule may consist of the sequence shown in SEQ ID NO: 194.

[0270] In some cases, the variant BRAF p.(V600E) is caused by the c.1799_1800delisAA mutation in the BRAF genome sequence. The first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1287-1306. The first strand of the second nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NO: 1287-1306.

[0271] In some cases, the variant BRAF p.(V600E) is caused by the c.1799_1800delisAA mutation in the BRAF genome sequence. The first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1267-1286. The first strand of the second nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NO: 1267-1286.

[0272] In some cases, the variant BRAF p.(V600E) is caused by the c.T1799A mutation in the BRAF genome sequence. The first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1326-1344. The first strand of the second nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NO: 1326-1344.

[0273] In some cases, the variant BRAF p.(V600E) is caused by the c.T1799A mutation in the BRAF genome sequence. The first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1307-1325. The first strand of the second nucleic acid molecule may consist of a sequence selected from the group consisting of SEQ ID NO: 1307-1325.

[0274] The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 206-224, and the first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1287-1306.

[0275] The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 187-205, and the first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1267-1286.

[0276] The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 206-224, and the first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1326-1344.

[0277] The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 187-205, and the first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1307-1325.

[0278] The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence shown in SEQ ID NO: 213, and the first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence shown in SEQ ID NO: 1334.

[0279] The first strand of the first nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence shown in SEQ ID NO: 194, and the first strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence shown in SEQ ID NO: 1315.

[0280] For any implementation, the first strand of the first nucleic acid molecule may comprise a sequence having at least 80%, at least 90%, at least 95%, or 100% identity with a sequence selected from the group consisting of: SEQ ID NO: 194, 232, 270, 346, 384, 498, 536, 652, 614, 922, 766, and 422. The first strand of the first nucleic acid molecule may consist of a sequence having at least 80%, at least 90%, at least 95%, or 100% identity with a sequence selected from the group consisting of: SEQ ID NO: 194, 232, 270, 346, 384, 498, 536, 652, 614, 922, 766, and 422.

[0281] For any implementation, the second strand of the first nucleic acid molecule may comprise a sequence having at least 80%, at least 90%, at least 95%, or 100% identity with a sequence selected from the group consisting of: SEQ ID NO: 213, 251, 289, 365, 403, 517, 555, 671, 633, 941, 785, and 441. The second strand of the first nucleic acid molecule may consist of a sequence having at least 80%, at least 90%, at least 95%, or 100% identity with a sequence selected from the group consisting of: SEQ ID NO: 213, 251, 289, 365, 403, 517, 555, 671, 633, 941, 785, and 441.

[0282] In any embodiment, the first nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand comprising sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences selected from the list comprising: SEQ ID NO: 194 and 213, 232 and 251, 270 and 289, 346 and 365, 384 and 403, 498 and 517, 536 and 555, 652 and 671, 614 and 633, 922 and 941, 766 and 785, 422 and 441. The first nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand being composed of sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences selected from the list comprising: SEQ ID NO: 194 and 213, 232 and 251, 270 and 289, 346 and 365, 384 and 403, 498 and 517, 536 and 555, 652 and 671, 614 and 633, 922 and 941, 766 and 785, 422 and 441.

[0283] For any implementation, the first strand of the second nucleic acid molecule may comprise a sequence having at least 80%, at least 90%, at least 95%, or 100% identity with a sequence selected from the group consisting of: SEQ ID NO: 1314, 1315, 1317, and 1319. The first strand of the second nucleic acid molecule may consist of a sequence having at least 80%, at least 90%, at least 95%, or 100% identity with a sequence selected from the group consisting of: SEQ ID NO: 1314, 1315, 1317, and 1319.

[0284] For any implementation, the second strand of the second nucleic acid molecule may contain a sequence having at least 80%, at least 90%, at least 95%, or 100% identity with a sequence selected from the group consisting of: SEQ ID NO: 1333, 1334, 1336, and 1338. The second strand of the second nucleic acid molecule may consist of a sequence having at least 80%, at least 90%, at least 95%, or 100% identity with a sequence selected from the group consisting of: SEQ ID NO: 1333, 1334, 1336, and 1338.

[0285] In any embodiment, the second nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand comprising sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences selected from the list comprising: SEQ ID NO: 1314 and 1333, 1315 and 1334, 1317 and 1336, and 1319 and 1338. The second nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand comprising sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences selected from the list comprising: SEQ ID NO: 1314 and 1333, 1315 and 1334, 1317 and 1336, and 1319 and 1338.

[0286] In any embodiment, the first nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand comprising sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 194 and 213, and the second nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand comprising sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 1314 and 1333. In any embodiment, the first nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand consisting of sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 194 and 213, and the second nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand consisting of sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 1314 and 1333.

[0287] In any embodiment, the first nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand comprising sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 194 and 213, and the second nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand comprising sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 1315 and 1334. In any embodiment, the first nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand consisting of sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 194 and 213, and the second nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand consisting of sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 1315 and 1334.

[0288] In any embodiment, the first nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand comprising sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 194 and 213, and the second nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand comprising sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 1317 and 1336. In any embodiment, the first nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand consisting of sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 194 and 213, and the second nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand consisting of sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 1317 and 1336.

[0289] In any embodiment, the first nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand comprising sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 194 and 213, and the second nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand comprising sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 1319 and 1338. In any embodiment, the first nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand consisting of sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 194 and 213, and the second nucleic acid molecule may comprise a first strand and a second strand, the first strand and the second strand consisting of sequence pairs having at least 80%, at least 90%, at least 95%, or 100% identity with sequences SEQ ID NO: 1319 and 1338.

[0290] This article also describes a pharmaceutical composition comprising, for example, a first nucleic acid molecule having a targeting variant NRAS and a second nucleic acid molecule having a targeting variant BRAF, as described above.

[0291] This document also describes methods for treating acquired nevi in ​​a subject. Treatment can mean removing, reducing, or preventing acquired nevi. Methods may comprise administering to a subject a composition or pharmaceutical composition as described herein, said composition or pharmaceutical composition having a first nucleic acid molecule targeting a variant NRAS and a second nucleic acid molecule targeting a variant BRAF. Alternatively, methods may comprise administering to a subject a combination of the first and second nucleic acid molecules, wherein said administration occurs simultaneously or sequentially in any order, wherein said first nucleic acid molecule targets a variant NRAS, preferably Q61K, as described herein, and said second nucleic acid molecule targets a variant BRAF, preferably V600E, as described herein.

[0292] This article also describes a method for preventing melanoma in a subject. The method may comprise administering to a subject a composition or pharmaceutical composition as described herein, said composition or pharmaceutical composition having a first nucleic acid molecule (preferably Q61K) targeting the NRAS variant and a second nucleic acid molecule (preferably V600E) targeting the BRAF variant.

[0293] This article also describes the composition comprising a first nucleic acid molecule and a second nucleic acid molecule (targeting variant NRAS and variant BRAF) described herein, in a method for treating acquired nevi and in a method for preventing melanoma.

[0294] This article also provides an use of the composition as described herein for reducing or removing acquired nevi in ​​a subject.

[0295] It should be understood that the nucleic acid molecules targeting the NRAS variant and the BRAF variant can be provided together as part of a single composition or separately. When provided separately, the first and second nucleic acid molecules can be administered to the subject simultaneously or sequentially in any order.

[0296] This document also describes a kit comprising a first nucleic acid molecule targeting the NRAS variant as described herein and a second nucleic acid molecule targeting the BRAF variant as described herein. The kit may comprise (a) a first nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding the NRAS variant; and (b) a second nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding the BRAF variant.

[0297] Application route

[0298] The pharmaceutical agent or pharmaceutical composition may be administered via various routes, including oral, parenteral, sublingual, intradermal, transdermal, rectal, transmucosal, local, by inhalation, buccal administration, intrapleural, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intranasal, intrathecal, and / or intra-articular, or combinations thereof. In some embodiments, the pharmaceutical agent or pharmaceutical composition is administered orally. In some embodiments, the pharmaceutical agent or pharmaceutical composition is administered intravenously. In some embodiments, the pharmaceutical agent or pharmaceutical composition is administered locally. In some embodiments, the pharmaceutical agent or pharmaceutical composition is administered via microneedle injection. In some embodiments, the pharmaceutical agent or pharmaceutical composition is administered via microneedle injection into the dermis.

[0299] CRISPR

[0300] As used herein, “CRISPR nuclease system” generally refers to transcripts and other elements involved in the expression of CRISPR-related (“Cas”) genes or directing their activity, including sequences encoding Cas genes, guide sequences (also referred to as “spacers” in the context of endogenous CRISPR systems) or other sequences and transcripts from CRISPR loci.

[0301] In some embodiments, one or more elements of the CRISPR system are derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of the CRISPR system are derived from a specific organism containing an endogenous CRISPR system, such as *Streptococcus pyogenes*. The CRISPR system is characterized by elements that promote the formation of the CRISPR complex at the site of the target sequence.

[0302] In the context of CRISPR complex formation, a "target sequence" refers to a sequence to which the guide sequence is designed to be complementary, wherein hybridization between the target sequence and the guide sequence promotes the formation of the CRISPR complex. Perfect complementarity is not necessarily required if sufficient complementarity is sufficient to induce hybridization and promote CRISPR complex formation. The target sequence can contain any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, the target sequence is located in the cell nucleus or cytoplasm. In some embodiments, the target sequence can be located in organelles of eukaryotic cells, such as mitochondria or chloroplasts.

[0303] When using multiple different guide sequences, a single expression construct can be used to target CRISPR activity to multiple different corresponding target sequences within cells. For example, a single vector may contain about one, two, three, four, five, six, seven, eight, nine, ten, fifteen, twenty, or more guide sequences. In some embodiments, about one, two, three, four, five, six, seven, eight, nine, ten, or more such vectors containing guide sequences may be provided, and said vectors may optionally be delivered to cells. In some embodiments, the vector contains a regulatory element operatively linked to an enzyme-coding sequence encoding a CRISPR enzyme (such as the Cas protein, also known as the Cas enzyme).

[0304] Non-limiting examples of Cas proteins (or Cas enzymes) include Cas1, Cas1.13, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csx12), Cas10, Csy1, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm.5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Crnr6, Csbl, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, their homologs, or modified versions thereof.

[0305] These enzymes are known; for example, the amino acid sequence of the *Streptococcus pyogenes* Cas9 protein can be found in the SwissProt database with accession number Q99ZW2. In some embodiments, the CRISPR enzyme has DNA cleavage activity, such as Cas9. In some embodiments, the CRISPR enzyme is Cas9, and may be Cas9 derived from *Streptococcus pyogenes* or *Streptococcus pneumoniae*.

[0306] In some embodiments, the CRISPR enzyme guides the cleavage of one or both strands at a location on the target sequence (e.g., within the target sequence and / or within complement of the target sequence). In some embodiments, the CRISPR enzyme guides the cleavage of one or both strands starting from the first or last nucleotide of the target sequence within approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500 or more base pairs.

[0307] Nucleic acid molecules

[0308] Nucleic acid molecules as described herein may comprise a first strand containing a sequence that is completely complementary to a sequence having at least 90% identity with an isolong portion of the mRNA encoding a gain-of-function variant of NRAS (e.g., an NRAS variant). Nucleic acid molecules as described herein may comprise a first strand containing a sequence that is completely complementary to a sequence having at least 95% identity with an isolong portion of the mRNA encoding a gain-of-function variant of NRAS (e.g., an NRAS variant). Nucleic acid molecules as described herein may comprise a first strand containing a sequence that is completely complementary to a sequence having at least 99% identity with an isolong portion of the mRNA encoding a gain-of-function variant of NRAS (e.g., an NRAS variant).

[0309] The nucleic acid molecule described herein may comprise a first strand containing a sequence that is completely complementary to a sequence having at least 95% identity with an isotropic portion of the mRNA encoding the variant NRAS. The variant NRAS may have mutations at positions Q61, G60, G12, and / or G13 relative to the wild-type NRAS. For example, a variant NRAS differing from the wild-type NRAS at position Q61 may be referred to as the "Q61 variant".

[0310] In some implementations, the variant NRAS differs from the wild-type NRAS at position G60. The variant NRAS can be the G60R variant. The variant NRAS can be the G60V variant. The variant NRAS can be the G60E variant.

[0311] Variant NRAS G60R may be caused by a c.178G>C (c.G178C) mutation in the NRAS genome sequence. Variant NRAS G60V may be caused by a c.179G>T (c.G179T) mutation in the NRAS genome sequence. Variant NRAS G60E may be caused by a c.179G>A (c.G179A) mutation in the NRAS genome sequence.

[0312] In some implementations, the variant NRAS differs from the wild-type NRAS at position Q61. The variant NRAS can be the Q61K variant. The variant NRAS can be the Q61H variant. The variant NRAS can be the Q61R variant. The variant NRAS can be the Q61L variant. The variant NRAS can be the Q61P variant.

[0313] Variant NRAS Q61K may be caused by a c.181C>A (c.C181A) mutation in the NRAS genome sequence. Variant NRAS Q61H may be caused by a c.183A>C (c.A183C) mutation in the NRAS genome sequence. Variant NRAS Q61H may be caused by a c.183A>T (c.A183T) mutation in the NRAS genome sequence. Variant NRAS Q61R may be caused by a c.182A>G (c.A182G) mutation in the NRAS genome sequence. Variant NRAS Q61L may be caused by a c.182A>T (c.A182T) mutation in the NRAS genome sequence. Variant NRAS Q61P may be caused by a c.182A>C (c.A182C) mutation in the NRAS genome sequence.

[0314] In some implementations, the variant NRAS differs from the wild-type NRAS at position G12. The variant NRAS can be the G12V variant. The variant NRAS can be the G12R variant. The variant NRAS can be the G12D variant. The variant NRAS can be the G12S variant. The variant NRAS can be the G12P variant. The variant NRAS can be the G12C variant. The variant NRAS can be the G12A variant.

[0315] Variant G12V may be caused by a c.35G>T (c.G35T) mutation in the NRAS genome sequence. Variant G12R may be caused by a c.34G>C (c.G34C) mutation in the NRAS genome sequence. Variant G12D may be caused by a c.35G>A (c.G35A) mutation in the NRAS genome sequence. Variant G12S may be caused by a c.34G>A (c.G34A) mutation in the NRAS genome sequence. Variant G12P may be caused by a c.34_35 inversion or a dinucleotide change from GG to CC in the NRAS genome sequence. Variant G12C may be caused by a c.34G>T (c.G34T) mutation in the NRAS genome sequence. Variant G12A may be caused by a c.35G>C (c.G35C) mutation in the NRAS genome sequence.

[0316] In some implementations, the variant NRAS differs from the wild-type NRAS at position G13. The variant NRAS can be the G13S variant. The variant NRAS can be the G13C variant. The variant NRAS can be the G13R variant. The variant NRAS can be the G13F variant. The variant NRAS can be the G13Y variant. The variant NRAS can be the G13V variant. The variant NRAS can be the G13D variant. The variant NRAS can be the G13A variant.

[0317] Variant G13S may be caused by a c.37G>A (c.G37A) mutation in the NRAS genome sequence. Variant G13C may be caused by a c.37G>T (c.G37T) mutation in the NRAS genome sequence. Variant G13R may be caused by a c.37G>C (c.G37C) mutation in the NRAS genome sequence. Variant G13F may be caused by a c.37_38 deletion and a TT insertion in the NRAS genome sequence. Variant G13Y may be caused by a c.37_38 deletion and a TA insertion in the NRAS genome sequence. Variant G13V may be caused by a c.38G>T (c.G38T) mutation in the NRAS genome sequence. Variant G13D may be caused by a c.38G>A (c.G38A) mutation in the NRAS genome sequence. Variant G13A may be caused by a c.38G>C (c.G38C) mutation in the NRAS genome sequence.

[0318] The nucleic acid molecules described herein can specifically target sequences of variant NRAS. As used herein, “specifically target” describes the preferential hybridization of the nucleic acid molecule with the sequence of interest (in this case, the sequence of variant NRAS).

[0319] The nucleic acid molecule described herein may comprise a first strand containing a sequence that is completely complementary to a sequence having at least 95% identity with an equal-length portion of the mRNA encoding the variant BRAF. The variant BRAF may have a mutation at position V600 relative to the wild-type BRAF. For example, a variant BRAF differing from the wild-type BRAF at position V600 may be referred to as the "V600 variant".

[0320] In some implementations, the variant BRAF differs from the wild-type BRAF at position V600. The variant BRAF can be the V600G variant. The variant BRAF can be the V600M variant. The variant BRAF can be the V600D variant. The variant BRAF can be the V600R variant. The variant BRAF can be the V600K variant. The variant BRAF can be the V600E variant.

[0321] Variant BRAF V600G may be caused by the c.1799T>G (c.T1799G) mutation in the BRAF genome sequence. Variant BRAF V600M may be caused by the c.1798G>A (c.G1798A) mutation in the BRAF genome sequence. Variant BRAF V600D may be caused by the c.1799_1800delisAT mutation in the BRAF genome sequence. Variant BRAF V600R may be caused by the c.1798_1799delisCG mutation in the BRAF genome sequence. Variant BRAF V600K may be caused by the c.1798_1799delisAA mutation in the BRAF genome sequence. Variant BRAF V600E may be caused by the c.1799_1800delisAA mutation in the BRAF genome sequence. The variant BRAF V600E may be caused by the c.1799T>A (c.T1799A) mutation in the BRAF genome sequence.

[0322] The nucleic acid molecules described herein can specifically target sequences of variant BRAF. As used herein, “specifically target” describes the preferential hybridization of the nucleic acid molecule with the sequence of interest (in this case, the sequence of variant BRAF).

[0323] The nucleic acid molecules described herein can inhibit the expression of the G60R variant NRAS and specifically target nucleic acid molecules with the sequence GACATACTGGATACAGCTCGACAAGAAGAGTACAGTG (SEQ ID NO: 7). The nucleic acid molecules described herein can inhibit the expression of the G60V variant NRAS and specifically target nucleic acid molecules with the sequence ACATACTGGATACAGCTGTACAAGAAGAGTACAGTGC (SEQ ID NO: 9). The nucleic acid molecules described herein can inhibit the expression of the G60E variant NRAS and specifically target nucleic acid molecules with the sequence ACATACTGGATACAGCTGAACAAGAAGAGTACAGTGC (SEQ ID NO: 11). The nucleic acid molecules described herein can inhibit the expression of the Q61K variant NRAS and specifically target nucleic acid molecules with the sequence ATACTGGATACAGCTGGAAAAGAAGAGTACAGTGCCA (SEQ ID NO: 13). The nucleic acid molecules described herein can inhibit the expression of the Q61R variant NRAS and specifically target nucleic acid molecules with the sequence TACTGGATACAGCTGGACGAGAAGAGTACAGTGCCAT (SEQ ID NO: 15). The nucleic acid molecules described herein can inhibit the expression of the Q61L variant NRAS and specifically target nucleic acid molecules with the sequence TACTGGATACAGCTGGACTAGAAGAGTACAGTGCCAT (SEQ ID NO: 17). The nucleic acid molecules described herein can inhibit the expression of the Q61P variant NRAS and specifically target nucleic acid molecules with the sequence TACTGGATACAGCTGGACCAGAAGAGTACAGTGCCAT (SEQ ID NO: 19). The nucleic acid molecules described herein can inhibit the expression of the Q61H variant NRAS and specifically target nucleic acid molecules with the sequence ACTGGATACAGCTGGACACGAAGAGTACAGTGCCATG (SEQ ID NO: 21). The nucleic acid molecules described herein can inhibit the expression of the Q61H variant NRAS and can specifically target nucleic acid molecules with the sequence ACTGGATACAGCTGGACATGAAGAGTACAGTGCCATG (SEQ ID NO: 23).

[0324] The nucleic acid molecules described herein can inhibit the expression of the G12V variant NRAS and specifically target nucleic acid molecules with the sequence TGGTGGTGGTTGGAGCAGTTGGTGTTGGGAAAAGCGC (SEQ ID NO: 25). The nucleic acid molecules described herein can inhibit the expression of the G12R variant NRAS and specifically target nucleic acid molecules with the sequence CTGGTGGTGGTTGGAGCACGTGGTGTTGGGAAAAGCG (SEQ ID NO: 27). The nucleic acid molecules described herein can inhibit the expression of the G12D variant NRAS and specifically target nucleic acid molecules with the sequence TGGTGGTGGTTGGAGCAGATGGTGTTGGGAAAAGCGC (SEQ ID NO: 29). The nucleic acid molecules described herein can inhibit the expression of the G12S variant NRAS and specifically target nucleic acid molecules with the sequence CTGGTGGTGGTTGGAGCAAGTGGTGTTGGGAAAAGCGC (SEQ ID NO: 31). The nucleic acid molecules described herein can inhibit the expression of the G12P variant NRAS and specifically target nucleic acid molecules with the sequence TGGTGGTGGTTGGAGCACCTGGTGTTGGGAAAAGCGC (SEQ ID NO: 33). The nucleic acid molecules described herein can inhibit the expression of the G12C variant NRAS and specifically target nucleic acid molecules with the sequence CTGGTGGTGGTTGGAGCATGTGGTGTTGGGAAAAGCGC (SEQ ID NO: 35). The nucleic acid molecules described herein can inhibit the expression of the G12A variant NRAS and specifically target nucleic acid molecules with the sequence TGGTGGTGGTTGGAGCAGCTGGTGTTGGGAAAAGCGC (SEQ ID NO: 37). The nucleic acid molecules described herein can inhibit the expression of the G13S variant NRAS and specifically target nucleic acid molecules with the sequence GTGGTGGTTGGAGCAGGTAGTGTTGGGAAAAGCGCAC (SEQ ID NO: 39). The nucleic acid molecules described herein can inhibit the expression of the G13C variant NRAS and can specifically target nucleic acid molecules with the sequence GTGGTGGTTGGAGCAGGTTGTGTTGGGAAAAGCGCAC (SEQ ID NO: 41). The nucleic acid molecules described herein can inhibit the expression of the G13R variant NRAS and can specifically target nucleic acid molecules with the sequence GTGGTGGTTGGAGCAGGTCGTGTTGGGAAAAGCGCAC (SEQ ID NO: 43).The nucleic acid molecules described herein can inhibit the expression of the G13F variant NRAS and specifically target nucleic acid molecules with the sequence GTGGTGGTTGGAGCAGGTTTTGTTGGGAAAAGCGCAC (SEQ ID NO: 45). The nucleic acid molecules described herein can inhibit the expression of the G13Y variant NRAS and specifically target nucleic acid molecules with the sequence GTGGTGGTTGGAGCAGGTTATGTTGGGAAAAGCGCAC (SEQ ID NO: 47). The nucleic acid molecules described herein can inhibit the expression of the G13V variant NRAS and specifically target nucleic acid molecules with the sequence GTGGTGGTTGGAGCAGGTGTTGTTGGGAAAAGCGCAC (SEQ ID NO: 49). The nucleic acid molecules described herein can inhibit the expression of the G13D variant NRAS and specifically target nucleic acid molecules with the sequence TGGTGGTTGGAGCAGGTGATGTTGGGAAAAGCGCACT (SEQ ID NO: 51). The nucleic acid molecules described herein can inhibit the expression of the G13A variant NRAS and can specifically target nucleic acid molecules with the sequence TGGTGGTTGGAGCAGGTGCTGTTGGGAAAAGCGCACT (SEQ ID NO: 53).

[0325] The nucleic acid molecules described herein can inhibit the expression of variant NRAS and can specifically target nucleic acid molecules with the sequence ATACTGGATACAGCTGGTAAAGAAGAGTACAGTGCCA (SEQ ID NO: 55). The nucleic acid molecules described herein can inhibit the expression of variant NRAS and can specifically target nucleic acid molecules with the sequence ATACTGGATACAGCTGGAAAGGAAGAGTACAGTGCCA (SEQ ID NO: 57).

[0326] The nucleic acid molecules described herein can inhibit the expression of the V600G variant BRAF and specifically target nucleic acid molecules with the sequence ATTTTGGTCTAGCTACAGGGAAATCTCGATGGAGTGG (SEQ ID NO: 59). The nucleic acid molecules described herein can inhibit the expression of the V600M variant BRAF and specifically target nucleic acid molecules with the sequence GATTTTGGTCTAGCTACAATGAAATCTCGATGGAGTG (SEQ ID NO: 61). The nucleic acid molecules described herein can inhibit the expression of the V600D variant BRAF and specifically target nucleic acid molecules with the sequence ATTTTGGTCTAGCTACAGATAAATCTCGATGGAGTGG (SEQ ID NO: 63). The nucleic acid molecules described herein can inhibit the expression of the V600R variant BRAF and specifically target nucleic acid molecules with the sequence GATTTTGGTCTAGCTACACGGAAATCTCGATGGAGTG (SEQ ID NO: 65). The nucleic acid molecules described herein can inhibit the expression of the V600K variant BRAF and can specifically target nucleic acid molecules with the sequence GATTTTGGTCTAGCTACAAAGAAATCTCGATGGAGTG (SEQ ID NO: 67). The nucleic acid molecules described herein can inhibit the expression of the V600E variant BRAF and can specifically target nucleic acid molecules with the sequence ATTTTGGTCTAGCTACAGAAAAATCTCGATGGAGTGG (SEQ ID NO: 69). The nucleic acid molecules described herein can inhibit the expression of the V600E variant BRAF and can specifically target nucleic acid molecules with the sequence ATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGG (SEQ ID NO: 71).

[0327] Sequence identity

[0328] The antisense compounds described herein may also have a defined percentage of identity with a specific nucleotide sequence, SEQ ID NO, or compound or portion thereof. As used herein, an antisense compound is considered identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, RNA containing uracil instead of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence because both uracil and thymidine pair with adenine. Shortened and extended versions of the antisense compounds described herein, as well as compounds having different bases relative to the antisense compounds provided herein, are also contemplated. Different bases may be adjacent to each other or scattered throughout the antisense compound. The percentage of identity of an antisense compound is calculated based on the number of bases having the same base pairing ability relative to the sequence with which it is being compared.

[0329] In some embodiments, the antisense compound or a portion thereof is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more of the antisense compounds disclosed herein or SEQ ID NO or a portion thereof.

[0330] In some embodiments, a portion of the antisense compound is compared to an equal-length portion of the target nucleic acid. In some embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides is compared to an equal-length portion of the target nucleic acid.

[0331] In some embodiments, a portion of the antisense oligonucleotide is compared to an equal-length portion of the target nucleic acid. In some embodiments, a nucleobase portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides is compared to an equal-length portion of the target nucleic acid. A nucleoside is a base-sugar combination. A nucleotide is a nucleoside that further includes a phosphate ester group covalently linked to the sugar portion of the nucleoside. Oligonucleotides are formed by the covalent linkage of adjacent nucleosides to form linear polymeric oligonucleotides. Within the oligonucleotide structure, the phosphate ester group is typically referred to as the internucleotide bond that forms the oligonucleotide.

[0332] Modification of antisense compounds encompasses the substitution or alteration of nucleoside internucleotide bonds, sugar moieties, or nucleobases. Modified antisense compounds are generally preferred over their natural forms due to desired properties such as enhanced cellular uptake, increased affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased inhibitory activity.

[0333] Sequence complementarity

[0334] When a sufficient number of nucleobases of an antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, the antisense compound and the target nucleic acid complement each other, resulting in the desired effect (e.g., inhibition of target gene expression).

[0335] Non-complementary nucleobases between the antisense compound and the nucleic acid can be tolerated, provided that the antisense compound can still specifically hybridize with the target nucleic acid. Furthermore, the antisense compound can hybridize over one or more segments of the nucleic acid, such that intermediate or adjacent segments are not involved in hybridization events (e.g., loop structures, mismatches, or hairpin structures).

[0336] In some embodiments, the antisense compound or a designated portion thereof provided herein is complementary to a nucleic acid, a target region, a target segment, or a designated portion thereof, or is at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (or 100%) complementary. The percentage of complementarity between the antisense compound and the target nucleic acid can be determined using conventional methods.

[0337] For example, an antisense compound in which 18 out of 20 nucleosides are complementary to the target region and will therefore specifically hybridize will represent 90% complementarity. In this example, the remaining non-complementary nucleosides may cluster with or be scattered with complementary nucleosides and do not need to be adjacent to each other or to complementary nucleosides. The percentage of complementarity between the antisense compound and the target nucleic acid region can be routinely determined using BLAST (Basic Local Alignment Search) procedures known in the art. Homology, sequence identity, or complementarity percentages can be determined, for example, using the Gap procedure with default settings.

[0338] The invention is further illustrated in the following examples. It should be understood that while these examples disclose embodiments of the invention, they are given by way of illustration only. Through the foregoing discussion and these examples, those skilled in the art can identify the essential features of the invention and can make various changes and modifications to adapt it to various uses and conditions without departing from the spirit and scope of the invention. Therefore, based on the foregoing description, various modifications to the invention, in addition to those shown and described herein, will be apparent to those skilled in the art. Such modifications are also intended to fall within the scope of the appended claims.

[0339] Example

[0340] Example 1 - Identification and Validation of Variant NRAS Selective siRNA

[0341] siRNA recognition using allele discrimination against NRAS c.181C>A mutation

[0342] The experiment was designed to identify siRNA sequences that could distinguish between the wild-type NRAS allele and the NRAS allele with the c.181C>A mutation. The experimental design was as follows: Figure 1 As shown in (a). In short, a "walking" approach was used to design siRNAs with the potential to knock down variant NRAS transcripts relative to the mutation of interest (vertical gray bar NRAS c.181C>A). The 3' end of the siRNA complementary sequence is completed with two uracil nucleotides, which have been reported to enhance its activity. Note that the sequences shown in the figure are transient (sense) strands to facilitate interpretation of the corresponding nucleotides.

[0343] HCT116 colorectal cancer WT (Crown Biotech, C8052C-WT) and homozygous NRAS were compared. c.181C >A;p.Q61K(Coronoc Biotech, C6072C) Treatment with siRNA for 48 hours. RNA was extracted, reverse transcribed into cDNA, and analyzed by qPCR. Allelic discrimination of the target NRAS c.181C>A transcript was measured based on simple statistical analysis (i.e., statistically significant reduction of the target allele and no statistically significant reduction of the non-target allele). To extend this evaluation, results from formulations that tolerated or did not tolerate the targeting of non-target alleles were also considered (Takahashi and Hohjoh 2014).

[0344] like Figure 1 As shown, a total of 19 siRNAs were tested. Among them, siRNAs 8 and 15 showed excellent allele discrimination between wild-type NRAS and c.181C>A variant NRAS, and were able to significantly reduce the expression of variant NRAS without affecting the expression of wild-type NRAS.

[0345] The qPCR data obtained from this initial study were then validated using RNA-seq. In short, HCT116 colorectal cancer WT (Coronocene Biotech, C8052C-WT) and homozygous NRAS were compared. c.181C>A;p.Q61K (Coronoc Biotech, C6072C) Treatment with siRNA for 48 hours. RNA was extracted and then analyzed using RNA-seq. The results of the RNA-seq analysis are shown in... Figure 14 middle.

[0346] like Figure 2 As shown in Figure A, siRNAs 1, 8, and 15 significantly reduced the expression of variant NRAS. Figure 2 E, 2F, and 2G show the effects of siRNA candidates 1, 8, and 15 on the transcriptome. Figure 2 E, 2F, and 2G show the predicted off-target effects of each siRNA and the extent to which the expression of each of these targets is affected after siRNA treatment. siRNAs 8 and 15, in particular, show minimal disruption to predicted off-target expression, suggesting significant potential as regulators of variant NRAS. siRNA 8 also does not affect the expression of NRAS homologs KRAS and HRAS in non-variant cells. Figure 2 C and Figure 2 D).

[0347] Effects of identified siRNAs on downstream signaling pathways and cell morphology

[0348] After identifying several siRNA candidates that can selectively regulate the expression of variant NRAS, the effects of these siRNAs on the MAPK pathway were analyzed by Western blot. HCT116 colorectal cancer WT (Coronoc Biotech, C8052C-WT) and homozygous NRAS were compared. c.181C>A;p.Q61K (Coronoc Biotech, C6072C) The patients were treated with candidate siRNAs (siRNA1, siRNA8, and siRNA15) for 48 hours. Proteins were extracted and then studied by Western blotting.

[0349] like Figure 13 As shown, in WT NRAS cancer cells, the candidate siRNAs did not alter the amount of phosphorylated ERK compared to the control. However, in variant NRAS cells, phosphorylated ERK decreased after treatment with candidate siRNAs 1, 8, and 15. These results indicate that candidate siRNAs can regulate variant NRAS expression and influence downstream signaling pathways.

[0350] Example 2 - Inhibition of variant NRAS in patient-derived cells of congenital melanocytic nevi (CMN)

[0351] First, nevus cells derived from CMN patients were characterized. In short, nevus cells were obtained from biopsies of CMN patients and grown in cultures. The cells were fixed and labeled with antibodies targeting SOX10 and tyrosinase. The cells were sequenced using Sanger sequencing. Morphology was analyzed using images acquired from a Livecyte microscope, employing CellProfiler Analyst (trained by a machine learning classifier model).

[0352] The results of the characterization are shown in Figure 3 In particular, Figure 3 E shows NRAS mutations identified by Sanger sequencing in CMN patient-derived nevus cells. Both c.181C>A and c.182A>G mutations were identified.

[0353] After characterizing CMN patient-derived nevus cells, the effects of variant NRAS inhibition on cell morphology, proliferation, and downstream signaling pathways were evaluated.

[0354] In short, nevus cells were obtained from biopsies of CMN patients and grown in cultures. Cells were treated with siRNA8 or, as a control, randomized RNA for 48 hours. Cellular RNA was extracted, reverse transcribed into cDNA, and analyzed by qPCR. Proteins were extracted and analyzed using antibodies targeting total NRAS (i.e., both WT NRASQ61K and variant NRASQ61K protein, as no antibodies targeting only WT NRASQ61K or variant NRASQ61K protein were available). Cell growth in the last 24 hours after siRNA treatment was analyzed using Livecyte microscopy and tomography. The number of cells that had divided in the last 24 hours after siRNA treatment was analyzed by EdU incorporation analysis, and the number was imaged using standard fluorescence microscopy. Quantification of the images was performed using CellProfiler software.

[0355] The results are shown in Figure 4 In the middle. siRNA8 treatment significantly reduced the expression of variant NRAS c.181C>A ( Figure 4 C), and also significantly reduced total NRAS protein (C). Figure 4 (D) This confirms that knockdown of mRNA levels translates into reduced protein expression. In siRNA8-treated cells, the ratio of phosphorylated ERK to total ERK was also significantly reduced (D). Figure 4 E, 4F), which further demonstrates that the regulation of NRAS in CMN patient-derived nevus cells may affect downstream signaling pathways. Compared with untreated and disordered RNA controls, treatment with siRNA8 in CMN patient-derived nevus cells also significantly reduced cell proliferation (E, 4F). Figure 4 H).

[0356] The combined effect of variant NRAS inhibition and trametinib treatment was then evaluated. Trametinib is an anticancer drug used to treat melanoma. As expected, trametinib treatment alone caused a dose-dependent reduction in the proliferation of CMN-derived nevus cells. Figure 4 I. Treatment with the inhibitory variant NRAS using siRNA8 further reduced the proliferation of trametinib-treated cells ( Figure 4 I, 4J).

[0357] Nevus cells were obtained from biopsies of CMN patients and grown in cultures. Cells were treated with siRNA for 48 hours. Cell growth in the last 24 hours after siRNA treatment was analyzed using Livecyte microscopy and tomographic analysis. Cell morphology was assigned based on machine learning (CellProfiler Analyst software, see Figure "In vitro growth of patient-derived NRAS variant cells of congenital melanocytic nevus (CMN)"). Immunofluorescence was performed using antibodies targeting specific proteins associated with stem cells and melanocytes. Images were quantified using CellProfiler software. These data are shown in... Figure 5 middle.

[0358] siRNA8 also reduced the proportion of nonpolar cells in primary nevus cell cultures. Label-free stacked imaging of nevus cell morphology and behavior from samples from four patients revealed the morphological range within each sample. Figure 3 , Figure 4 Therefore, machine learning tools were used to classify morphology into relatively proportional nonpolar, bipolar, multipolar, and multinucleated possible senescent cells. Figure 3 The scores for each cell type were consistent across patients. Figure 3 The nonpolar morphology typically appears briefly before cell division, sometimes specifically into three daughter cells. A single dose of siRNA8 treatment induced a significant decrease in the fraction of nonpolar cells, with no other subtype changes observed within 48 hours. Figure 5 b-5e). Flow cytometry based on DNA content (DAPI intensity) analysis did not detect any effect of siRNA8 treatment on cell cycle phases after 48 hours.

[0359] Besides MITF, DCT and nestin ( Figure 5 In addition to the aging markers P53 (TP53) and P16 (CDKN2A), nevus cells were baseline characterized by immunocytochemistry to confirm the expression of SOX10 and tyrosinase, characteristic of the melanocyte lineage. Although an increase in DCT expression and a slight decrease in NES expression were observed in the RNAseq dataset, all immunocytochemical markers were unaffected by siRNA8 treatment within 48 hours.

[0360] Treatment of primary CMN cells with siRNA8 inhibited the anti-apoptotic marker ARL6IP1. RNA-seq was performed on the primary nevus cell lines before and after siRNA8 treatment to identify both on-target and off-target effects. The expression of the variant NRAS was significantly lowered compared to the wild-type. Figure 14 C), while the highly homologous gene KRAS ( Figure 15 C) and HRAS Figure 15 D) Unaffected. Pathway analysis of differentially expressed genes identified enrichment primarily targeting pathways related to the cell cycle. Figure 14 E, Figure 15 E and Supplementary Data Table 2). Enrichment of RAL and integrin pathways, along with pathways associated with neuronal sheaths (E and Supplementary Data Table 2). Figure 14 E, Figure 15 E and Supplementary Data Table 2). Conversely, apart from increased expression of DCT, genes associated with melanocyte differentiation were largely unaffected (E and Supplementary Data Table 2). Figure 14 E, Figure 17 E). Importantly, the most significantly differentially expressed gene was ADP-ribosylation factor-like GTPase 6 interacting protein 1, or ARL6IP1, which is also known as an apoptosis regulator or ARMER in the endoplasmic reticulum membrane. Figure 14 A).

[0361] siRNA8 treatment triggers apoptosis in primary CMN cell cultures. As emphasized above, ARL6IP1 is highly expressed in nevus cells (…). Figure 17 H), which is distributed on the endoplasmic reticulum membrane in a pattern similar to but not identical to that of the rough endoplasmic reticulum-associated protein ribosome-binding protein 1 (RPN1). Figure 16 A). Validation experiments showed that 48-hour siRNA8 treatment induced an effect on the ARL6IP1 gene (A) in all patient lines. Figure 16 B) and protein ( Figure 16 C and Figure 17 Inhibition of ARL6IP1. In HCT116 cells treated with the siRNA8 dataset, ARL6IP1 was also significantly downregulated (I). Figure 18 A, Figure 18 B). ARL6IP1 is known to play a role in protecting cells from apoptosis induced by ER stress, and its oncogenic NRAS activity has been shown to drive resistance to ER stress. Therefore, the inventors reviewed the expression of key ER stress-induced apoptosis regulators ERN1, EIF2AK3, and ATF6. On RNAseq, ERN1 and EIFAK3 were significantly increased ( Figure 18 D-18F), but qPCR revealed that only ERN1 was significantly upregulated in response to siNRASQ61K treatment within 48 hours ( Figure 16 D and Figure 18 G). Meanwhile, in nevus cells ( Figure 16 E) and HCT116 cell dataset ( Figure 18 C) Of the two, the inventors identified that BIRC5 expression was significantly reduced by siRNA8 treatment. BIRC5 encodes survivin, a key protein that protects against RAS-induced apoptosis.

[0362] Given these early indicators of apoptosis pathway activation on RNAseq within 48 hours, the inventors then used caspase 3 / 7 activation in in vivo imaging of cells from four nevus patients over a seven-day period. In all patients, all nevus cell cultures treated with a single dose of siRNA8 showed significantly increased apoptosis levels over the stated time period when compared to untreated cells and control siRNA at day seven, which could be measured from day 3–4. Figure 16 F).

[0363] Treatment with siRNA8 in primary nevus cell cultures enabled MEKi to achieve efficacy. The efficacy of siRNA8 treatment was then compared to that of the MEK inhibitor (MEKi) trametinib, which is currently the only drug therapy that has been tried in vivo in patients with CMN. Individually, at the doses used, the efficacy of siRNA8 alone and trametinib was similar. Figure 4 i, 4j). However, within 48 hours, the combined efficacy of siRNA8 and trametinib in reducing proliferation was significantly greater than that of trametinib alone (i, 4j). Figure 4 i, 4j and Figure 20 Unlike its effect on the proliferation of CMN cells in culture, MEKi trametinib alone had no effect on caspase 3 / 7 activity. Figure 19 However, the addition of 12.5 nM trametinib to siRNA8-treated cells significantly increased the induction of apoptosis seen with siRNA8 alone, an effect not seen when trametinib was added to cells treated with a small interference control. Figure 19 ).

[0364] The data above demonstrate that manipulation of variant NRAS has therapeutic efficacy in rescuing overactivation of the ERK pathway and reducing the proliferation of CMN-derived nevus cells. Given that individuals with CMN have a significantly higher risk of developing melanoma than those without CMN, modulation of variant NRAS also offers the opportunity to mitigate melanoma risk by rescuing effects associated with functionally acquired NRAS mutations. Importantly, the data included in this paper confirm that silencing variant NRAS alleles triggers apoptosis in disease cells. This further confirms the utility of targeting NRAS variants as a method for both CMN and melanoma treatment.

[0365] Example 3 - Injecting siRNA targeting NRAS into the dermis

[0366] Materials and methods

[0367] TYR::NRASQ61K mice were euthanized and dehaired. 50 μL of siRNA-cy5, prepared in cationic lipid nanoparticles (DOTMA + DOPE + peptide KKKKKKKKKKKKKKKGACISVYMMCG) (SEQ ID NO: 1353) and mixed in an isotonic sucrose buffer (300 mOsmol), was injected into the dermis. An injection of sucrose-mediated buffer alone was shown as a negative control. The injection site was immediately isolated, fixed, cryoprotected, and then cryosectioned. Sections were stained with Hoechst to observe DNA (i.e., the cell nucleus) and siRNA-cy5 in… Figure 6 It is displayed in white.

[0368] result

[0369] Since the dermis is the predominant site of nevus cells in the CMN, experiments were conducted to investigate whether siRNA could be successfully delivered to the dermis via injection in mice. The distribution of siRNA after intradermal injection into mouse skin was studied by tracking siRNA-Cy5. siRNA was observable within the dermis, the predominant site of nevus cells in the CMN. The dashed line depicts the boundary between the epidermis and dermis.

[0370] Figure 6 The results show that siRNA can be successfully delivered to the location of nevus cells via injection in vivo.

[0371] Although siRNA is used as the targeting mode in the above embodiments, any targeting mode that can modulate the expression of variant NRAS would be useful in this context. With this in mind, the inventors sought to provide a guide RNA that would enable selective targeting of variant NRAS via CRISPR editing.

[0372] Example 4 - CRISPR Editing

[0373] The CRISPR-Cas9 system has two main components: the Cas9 endonuclease and the single-guide RNA (sgRNA). Both parts play a role in target nomenclature. The sgRNA is a single RNA molecule produced by fusing a custom-designed short CRISPR RNA (crRNA) complementary to the DNA sequence of interest with a trans-activating crRNA (tracrRNA) scaffold. This sgRNA can guide the Cas9 system to any complementary sequence; however, the Cas9 nuclease will not be activated unless a prototypical spacer adjacent motif (PAM) sequence is detected. The PAM sequence is a short sequence of nucleotides recognized by the C-terminal domain within the nuclease leaf of the Cas9 enzyme. After the Cas9-sgRNA complex is formed, the complex scans the genome for the presence of the PAM site via hydrogen bonding of the C-terminal domain to the DNA through the master groove. Upon recognition of the PAM sequence, Cas9 enables local DNA unwinding, allowing the sgRNA strand to invade and induce R-loop formation. The sgRNA is then aligned with potential target sites, and given the high homology between the sequences, the sgRNA enables the activation of two nuclease domains, HNH and RuvC, resulting in double-stranded DNA breaks.

[0374] Many homologs of Cas9 have been found in a wide variety of bacterial species, including Streptococcus pyogenes (Sp), Staphylococcus aureus (S. aureus, Sa), thermophiles, and Neisseria meningitidis N. 162, each of which has a distinct PAM recognition sequence.

[0375] To generate allele-specific sgRNAs, either the sgRNA or the PAM sequence must include the NRAS c.(181C>A) mutation. No PAM sequence specific to -NGG- (where N can be any nucleotide) has been found in NRAS incorporating the mutation or sufficiently close to the mutation to use this endonuclease. Instead, using Benchling (October 2016; Benchling Inc., -NNGRRT-; where N is any nucleotide and R is A or G) located sufficiently close, the sgRNA can include the NRAS c.(181C>A) mutation. Figure 7 The 21 nucleotide sequences of the three sgRNAs corresponding to the three PAM sites are shown in... Figure 7 middle.

[0376] Three sgRNAs were inserted into plasmids via restriction enzyme digestion of the backbone and ligation of the sgRNA DNA template. The px601 plasmid vector (Addgene plasmid #61591; Addgene, MA, USA) was chosen because it contains SaCas9 and a site for inserting the sgRNA DNA template into the plasmid via Golden Gate cloning.

[0377] The plasmid was provided in chemically competent *E. coli* (Stbl3), and the *E. coli* were amplified in a selective medium for 16 hours. A specific proportion of the bacterial suspension was then used for plasmid extraction. Plasmid identification was confirmed by enzymatic digestion with HincIII enzyme (New England Biolabs, MA, USA). After confirmation, the plasmid was then linearized using BsaI enzyme (New England Biolabs, MA), allowing for Golden Gate cloning.

[0378] The sgRNA DNA insert has a relevant overhang that was incorporated into its design prior to synthesis. The plasmid and insert were then ligated together and transformed into chemically competent *E. coli* at Thermo Fisher Scientific, MA, USA. *E. coli* were streaked onto selective agar and incubated for 16 hours to generate single-cell colonies. Single-cell colonies were selected and amplified in selective medium suspension for an additional 16 hours. Plasmid extraction was performed using a specific proportion of bacterial cell suspension to screen colonies for correct insertion of the sgRNA DNA insert into the px601 plasmid backbone. Screening consisted of enzymatic digestion and Sanger sequencing. Figure 6-8 To check for the correct insertion of sgRNA1 or sgRNA2, the plasmid extracted from the bacterial colony was digested with the BciVI enzyme. Figure 8 A shows that plasmid 1 contains an sgRNA2 insert and is therefore named px601-sgRNA2. px601-sgRNA1 had been identified in previous screenings and... Figure 8 A is used as a positive control for enzyme activity. Figure 9 The results showed that all three clusters tested contained the sgRNA1 insert in the px601-GFP backbone, and therefore GFPsgRNA1.1 was advanced and named px601-GFP-sgRNA1. Figure 9The results showed that all three colonies tested contained the sgRNA2 insert in the px601-GFP backbone, and therefore GFP sgRNA2.1 was advanced and named px601-GFP-sgRNA2. To check for the correct insertion of sgRNA3, EarI enzyme (New England Biological Laboratory, Massachusetts, USA) was used. Figure 8 B. Figure 10 This allows for the digestion of plasmids extracted from bacterial colonies. Figure 8 B shows that plasmid 3 contains an sgRNA3 insert, and is therefore named px601-sgRNA3. Figure 10 The results showed that all three colonies tested contained the sgRNA3 insert in the px601-GFP backbone, and therefore GFP sgRNA3.1 was advanced and named px601-GFP-sgRNA3. Positive results from enzymatic screening ( Figure 6-8 This was confirmed by Sanger sequencing. This led to the generation of px601-sgRNA1, px601-sgRNA2, and px601-sgRNA3; px601-GFP-sgRNA1, px601-GFP-sgRNA2, and px601-GFP-sgRNA3.

[0379] Makes it from Figure [22 (in the paper)], Figure

[23] and Figure 24 DNA from positive results was subjected to Sanger sequencing to confirm that the relevant sgRNA oligonucleotide was inserted into the px601 or px601-GFP backbone. Figure 25 The resulting chromatogram is shown. The relevant inserted sequence is highlighted within the chromatogram. The sgRNA sequence is visible in... Figure 20 The sgRNA-DNA oligonucleotide sequences of each insert are shown in Table 6. Chromatograms were generated using Snap Gene Viewer (GSL Biotech LLC, IL, USA).

[0380] Optimization of GFP-containing plasmid transfection in HCT116 cell line

[0381] The aim of this experiment was to maximize transfection efficiency. This is essential to providing the best opportunity to observe any genome editing while using the CRISPR-Cas9 system. To achieve this, a plasmid containing the GFP protein (pEGFP-N1; Clontech, CA, USA) was transfected into the HCT116-Q cell line using Lipofectamine® 2000 (Thermo Fisher Scientific, Waltham, MA). The GFP plasmid was used because plasmids containing the CRISPR-Cas9 system do not have optional markers. HCT116-Q cells were seeded at two different densities in 24-well plates (1.8 × 10⁵ and 2.2 × 10⁵) and incubated overnight at 37°C in a 5% CO₂ incubator. The two different seeding densities were observed, and it was found that the 2.2 × 10⁵ wells exceeded the recommended confluence for transfection; therefore, only 1.8 × 10⁵ wells were advanced for transfection. Three amounts of plasmid DNA (250 ng, 500 ng, and 750 ng) and three volumes of Lipofectamine® 2000 (1 pL, 2 pL, and 3 pL) were used. This optimized transfection protocol was not implemented in the three biological triplicate replicas. After 48 hours, cells were passed through a flow cytometer. Healthy cells were initially selected using forward and side scattering within the normal range. Cells were then measured for the presence and abundance of fluorescence. Untransfected cells were used as a negative fluorescence control to introduce a gating system to determine the percentage of cells with fluorescent activity, thereby providing transfection efficiency. The same gating was applied to all biological replicas. Figure 26 ).

[0382] Transfections using 1 pL Lipofectamine® 2000 were found to have the worst transfection rates, with GFP fluorescence around 10%. The remaining combinations showed comparable transfection efficiencies, with both the 2 pL and 3 pL Lipofectamine® combinations achieving approximately 50% transfection efficiency. Controls showed negligible transfection rates. Based on these results, future plasmid transfections will be performed using 250 ng of DNA and 3 pL Lipofectamine® 2000. Figure 27 ).

[0383] Determining editing efficiency in the HCT116 cell line

[0384] PX601-sgRNA was transfected into the HCT116 cell line. Cells were seeded, and after 24 hours, the optimized formulation was applied to the cells. Cells were incubated for 48 hours, followed by cell lysis and DNA extraction. PCR was performed on the region of interest, and after purification of the PCR product, the T7 assay was used to determine genome editing. Figure 28 ).

[0385] The assay included numerous controls to aid in the detection of any defects. The samples used were px601-sgRNA1 (sgRNA1), px601-sgRNA2 (sgRNA2), px601-sgRNA3 (sgRNA3), px601 without any sgRNA (px601), a CFTR-transfected control plasmid, a lipofectamine 2000-only control (L2K), an untransfected control (Unt), and a T7 control (T7 control). All samples were run in both uncut (no T7 addition) and tested (with T7 addition) conditions, as indicated by '2' or '+'. Transfection of the px601 plasmid containing no sgRNA was performed; this control was used to show any effect of adding the Cas9 plasmid without a guide. A positive control was used for transfection of a plasmid known to target CFTR; this plasmid has been shown to be effective by previous members of the laboratory in various cell lines. A lipofectamine 2000-only control was used to determine any interfering effects of adding lipofectamine only. An untransfected control was also included to indicate what the unedited baseline would show. Finally, a T7 assay control was provided, designed to show whether the T7 assay was effective. This was achieved by providing a sample of genomic DNA, which had been shown to have undergone gene editing within the CFTR gene. This DNA was amplified by PCR, cleaned, and digested with T7. Experiments were performed using biological triplicate copies.

[0386] Positive results for expected gene editing showed that the PCR product was digested, resulting in two shorter DNA fragments of the original PCR product's total length. For the plasmid targeting NRAS, the PCR product was 827 bp, and two fragments of 372 bp and 455 bp in size were observed if gene editing occurred at the site of interest. In all three replicates, an example of a positive T7 result was seen in the T7 control, where the PCR product for one region of the CFTR gene was approximately 840 bp, and two fragments of 210 bp and 630 bp in size were present if editing had occurred. The presence of these DNA fragments suggests that the T7 assay did indeed function. However, the transfection control in the form of the CFTR-targeting plasmid did not show editing. Furthermore, all three px601-sgRNAs showed no editing. Other negative controls—unguided px601, Lipofectamine® 2000 only, and untransfected samples—also showed no editing. This leads to the conclusion that transfection may not have worked as expected. To move forward, it would be useful to ensure that transfection works correctly by utilizing tagged Cas9.

[0387] Single-cell sorting of GFP-positive cells helps identify gene-edited cells.

[0388] A novel px601-GFP plasmid containing guide RNA was transfected into both the parental (wild-type c.(181C)) and variant (homozygous c.(181C>A)) HCT116 cell lines. Cells were incubated for 48 hours and then subjected to cell sorting. Figure 29 Cell sorting was performed using flow cytometry with GFP tagging to enrich CRISPR-Cas9 transfected cells.

[0389] Flow cytometry was also used to generate single-cell colonies of GFP-positive cells through single-cell sorting. After a period of amplification, these colonies were collected for DNA extraction and sequencing. In addition, excess GFP-positive cells not used for single-cell colony seeding were collected into a “GFP-positive mixed population” of cells. DNA and proteins were extracted from these cells; the DNA was used to investigate whether any editing had occurred within the population, and the proteins were used to examine the effect of editing on MAPK pathway activation by Western blot analysis of ERK phosphorylation status.

[0390] Study on the existence of gene editing in a GFP-positive mixed population transfected with px601-GFP-sgRNA

[0391] As previously mentioned, excess GFP-positive cells not used to generate single-cell colonies were collected in triplicate as a GFP-positive mixed population. These populations were amplified until both DNA and protein could be extracted. The sites of interest were amplified using PCR, and the PCR products were subjected to a T7 assay. In short, this consists of: unwinding and re-annealing the PCR products, digesting the annealed PCR products with T7 endonuclease I (New England Biolabs®, Massachusetts, USA), and examining the results on an agarose gel using electrophoresis. Figure 30 Clear gene editing was demonstrated in the HCT116-Q (NRAS variant) cell line transfected with px601-GFP-sgRNA2, witnessed by digestion of PCR products from all three triplicate copies. No detectable editing was observed by this method in HCT116-Q transfected with px601-GFP-sgRNA1 or px601-GFP-sgRNA3, and no detectable editing was observed in HCT116-P (non-NRAS variant).

[0392] Study on the existence of gene editing in single-cell populations transfected with px601-GFP-sgRNA

[0393] A GFP-positive mixed population that had undergone gene editing was established, and single-cell colonies were investigated. Following single-cell sorting, the single-cell colonies were amplified before DNA extraction. Regions of interest were amplified by PCR and sequenced using the Sanger method.

[0394] Gene editing has been performed using px601-GFP-sgRNA1 and px601-GFP-sgRNA2 only in the HCT116-Q cell line. Figure 31 In 18 single-cell colonies sequenced from HCT116-Q transfected with px601-GFP-sgRNA1, two colonies showed gene editing, while 19 single-cell colonies from HCT116-P transfected with px601-GFP-sgRNA1 showed no gene editing. In 16 single-cell colonies sequenced from HCT116-Q transfected with px601-GFP-sgRNA2, eight colonies showed gene editing, while 9 single-cell colonies from HCT116-P transfected with px601-GFP-sgRNA2 showed no gene editing. Gene editing of px601-GFP-sgRNA3 was not detected in either HCT116-Q or HCT116-P, in 21 and 7 sequenced single-cell colonies, respectively.

[0395] This led to the conclusion that the gene editing rate of px601-GFP-sgRNA1 was 11%, and that of px601-GFP-sgRNA2 was 50%, with both showing allele-specific editing only of variant alleles.

[0396] To determine the effect of gene editing in a GFP-positive mixed population on the activation state of the MAPK signaling pathway.

[0397] After allele-specifically identifying the presence of gene editing in NRAS, further investigation was conducted on GFP-positive mixed samples to reveal any potential changes in the downstream MAPK signaling pathway by querying ERK phosphorylation status. DNA was extracted for gene editing analysis. Figure 30 Following this, proteins were extracted. Imprint analysis was performed on ERK, phosphorylated ERK, and histone 3 (H3) in each of the three copies. Figure 32 The obtained imprint was quantified using the optical density method. Figure 33 The values ​​were normalized relative to the relevant untransfected control (Unt), and the ratio of phosphorylated ERK to total ERK was obtained to provide a biomarker for MAPK signaling activation.

[0398] When compared with the untransfected control, the relative phosphorylation status of ERK was not significantly reduced upon transfection with sgRNA. Figure 33 When sgRNA2 was transfected, the largest change was observed in HCT116-Q (HCT116-P: 0.122 ± 0.080; HCT116-Q: 0.023 ± 0.017; mean ± standard deviation; p = 0.125), which is consistent with previously observed gene editing in these samples.

[0399] CRISPR-Cas9 Conclusion

[0400] The primary objective was to achieve allele-specific gene editing of the NRAS c.(181A) allele. This involved the design of three sgRNAs that specifically covered the c.(181) locus and were close enough to utilize the unique PAM site of SaCas9. These sgRNAs were successfully cloned into a GFP-containing p601 plasmid, as confirmed by both enzymatic digestion and Sanger sequencing. Transfection of the HCT116 cell line with the GFP-containing plasmid was optimized using flow cytometry. After optimization, cells were transfected with the p601-GFP-sgRNA plasmid and sorted by flow cytometry. Mixed and single-cell clones exhibited absolute allele-specific targeting and knockdown of the NRAS gene, as confirmed at the DNA level. Overall, sgRNA2 appeared to be the most promising guide, while sgRNA1 also showed good activity.

[0401] Example 5 - Design and Testing of Receptor-Targeting Nanoparticles (RTNPs)

[0402] Materials and methods

[0403] The lipids used for the cationic nanoparticles were resuspended and mixed in 100% ethanol at a total lipid concentration of 1 mg / ml: 49.5% cationic lipid DOTMA (DOTMA, 1,2-bis-O-octadecenyl-3-trimethylammonium propane (chloride salt). Molecular weight: 670.575 [CAS: 104872-42-6; Avanti SKU: 890898P]). 49.5% neutral lipid DOPE (18:1 (Δ9-Cis)PE (DOPE), 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine. Molecular weight: 744.034 [CAS: 4004-05-1; Avanti SKU: 850725P]). 1% polyethylene glycol-modified lipid (DPPE-PEG(2000) azide, 1,2-dipalmitoyl-sn-glycerol-3-phosphoethanolamine-N-azido(polyethylene glycol)-2000 (ammonium salt). Molecular weight: 2760.38 [CAS: Not available; Avanti SKU: 880231P]). The peptide (27 amino acids, Lys-Lys Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys-Gly-Ala-Cys-Ile-Ser-Val-Tyr-Met-Met-Cys-Gly (KKKKKKKKKKKKKKGACISVYMMCG (SEQ ID NO: 1353)) [AMSBIO]) was resuspended in 95% ethanol at a concentration of 10 mg / ml.

[0404] The self-assembly of lipid nanoparticles was initiated by mixing lipids, peptides, and siRNA in the stated order and, unless otherwise specified, in a 1:4:1 ratio (lipid:peptide:siRNA). For every 1 volume of ethanol, 3 volumes of water must be used (i.e., for every 1 volume of ethanol from the lipid and peptide feedstocks, the siRNA input must be 3 volumes of water). The lipid nanoparticles containing siRNA were dialyzed (GeBaFlex tube-dialysis kit MWCO 8kDa, Generon) to exchange ethanol for water, with the water changed 3 times over 24 hours.

[0405] RTNPs were concentrated by loading dialyzed samples onto a centrifuge filter unit (Amicron Ultra, Merck) and centrifuging at the rates / times outlined in the protocol. The concentrated nanoparticles were resuspended in sucrose solution (275–300 mOsm). A sterile filter (syringe filter PTFE 25 mm 0.2 μl NSTR, Fisher 15141499) was used. The hydrodynamic size and charge of the lipid nanoparticles were measured using a Malvern Zetasizer. RNase protection assays were performed by treating the formulated lipid nanoparticles or siRNA alone with RNase A at 2 µg / ml, followed by incubation at 37°C for 1, 2, or 4 hours. 1 μl of RNase inhibitor was added to stop digestion. The nanoparticles were then lysed with 16.4 mM SDS and run on an agarose gel. Encapsulation assays were performed by loading the formulated lipid nanoparticles onto an agarose gel and examining the free siRNA after electrophoresis.

[0406] result

[0407] A delivery system for siRNA therapy was designed to extrapolate to human trials. While the inventors had already incorporated allele targeting into the siRNA design, additional cell type targeting was deemed desirable to keep the ultimately required dose as low as possible. Based on single-cell expression data, the KIT receptor was selected as the most melanocyte-specific cell surface target compared to other skin cells, and the peptide sequence for targeting had already been established in previous publications.

[0408] Optimization of self-assembled receptor-targeting nanoparticles (RTNPs) protects siRNA from degradation and allows delivery to human skin explants. Self-assembled RTNPs have previously been described as a highly efficient method for intracellular delivery of siRNA. The formulation of RTNPs was optimized using variable peptide content while maintaining an equal ratio of siRNA to lipids. Figure 22A-22C), thereby generating siRNA8-RTNP. The average nanoparticle diameter was assessed at approximately 200 nm using dynamic light scattering. Figure 22 A, Figure 22 F). The addition of increased amounts of peptides changes the lipid nanoparticles from anionic to cationic (F). Figure 22 B), and in parallel, led to an increase in siRNA encapsulation. Encapsulation was completed at ratios of 1:3:1 and 1:4:1 (lipid:peptide:siRNA). Figure 22 C), and protects siRNA from RNase degradation (C) Figure 22 D). Treatment of nevus cells with RTNPs containing peptide sequences reported to bind to the KIT receptor delivered siRNA more effectively than treatment of nevus cells with controls. Figure 22 G). Following intradermal injection, siRNA8-RTNP was successfully delivered to the dermis of the skin explants from CMN patients (G). Figure 21 A, Figure 21 B).

[0409] Example 6 - Treatment with siRNA8-RTNP in a mouse model of CMN

[0410] Materials and methods

[0411] Tyr::NRASQ61K mice (age = 41–45 weeks, 3 females, 5 males) were shaved with scissors on either side of the midline of the back under general anesthesia (isoflurane) and then received an intradermal injection (30G insulin) of 450 μg RTNP prepared in sucrose solution (295 mOsmol). Injection sites were marked by drawing around the blister with a marker. Forty-eight hours later, the mice were euthanized, and 4 mm puncture biopsies were collected from each site. The biopsies were stored in an RNAlater (Invitrogen AM7021) prior to RNA extraction.

[0412] result

[0413] RTNPs containing Cy5-siRNA were successfully delivered into the dermis of mice. To demonstrate in vivo delivery, Cy5-tagged control siRNA incorporated into the RTNP was injected into the dermis of mice, and the skin was fixed one hour later. Fluorescence was visible after paraffin embedding and H&E staining, confirming successful delivery into the dermis. Figure 23 C Figure 23 D).

[0414] Treatment with siRNA8-RTNP induced selective knockdown of humanized NRAS variants, followed by CMN in a mouse model (Tg(Tyr-NRAS*Q61K)1Bee; MGI:376864540). Figure 23 A), in which mice with hyperpigmented skin and excessive melanin-producing cells in the dermis were tested with siRNA8-RTNP treatment ( Figure 21 D、 Figure 21 E and Figure 23 B). Eight mice that received two separate intradermal injections of siRNA8-RTNP into their dorsal skin were shaved just before surgery, except for the same adjacent injections of RTNP containing non-targeting siRNA as a control. siRNA8-RTNP induced knockdown of the transgenic variant NRAS allele at 24 and 48 hours. Figure 21 F, but does not induce knockdown of the WT endogenous Nras allele ( Figure 21 G). At this point in time, no side effects were observed by visual inspection at the injection site or regarding the behavior or overall health of the mice.

[0415] These findings demonstrate the targeted silencing of the variant NRAS in vitro, in patient skin explants, and in primary patient nevus cells in humanized transgenic mice. Importantly, the silencing of the variant allele in vitro triggers nevus cell apoptosis through a previously unknown link to the ER stress-induced apoptosis pathway. These results illustrate the utility of targeting the variant NRAS to reverse benign lesions, treat CMN, and prevent the development of malignant diseases.

[0416] Example 7 - Variant BRAF inhibition in BRAF-mutant melanoma cell lines

[0417] Materials and methods

[0418] The effects of siRNA inhibition on variant BRAF were investigated in homozygous (A375, SKMEL28) and heterozygous (A2058, G-361) cell lines. Cells were treated with siBRAFV600E (antisense strand SEQ ID NO: 1334, sense strand SEQ ID NO: 1315) to selectively target variant BRAF, or with siBRAF to non-selectively target BRAF. siSCRA was used as a negative control, and siUBB with knockdown of the essential gene UBB was used as a positive control for caspase 3 / 7 activation.

[0419] result

[0420] Figure 24 Results including the positive control siUBB are shown. Figure 25 The same results, without showing siUBB, are shown; this allows for better visualization due to the need for scaling. (As shown) Figure 25 As shown in Figure A, in the A375, A2058, and G-361 cell lines, treatment with the allele-specific siBRAFV600E significantly reduced cell proliferation compared to treatment with the control siSCRA. The performance of siBRAFV600E was also superior to that of non-selective siRNA (siBRAF). Figure 25 As shown in B, siBRAFV600E treatment also induced apoptosis in heterozygous cell lines.

[0421] The results shown above demonstrate that direct targeting of oncogenic BRAF variants can induce apoptosis in melanoma cells. siRNAs targeting the alleles also performed better than non-targeted siRNAs.

[0422] Example 8 - Variant NRAS Inhibition in Leptomeningeal Melanocytosis

[0423] Nevus cells were obtained from patients with leptomeningeal melanocytosis and grown in cultures. In leptomeningeal melanocytosis, patients have dysplastic (between benign and malignant) leptomeningeal disease. Primary nevus cell cultures were treated with a single dose of siRNA8, and apoptosis was measured using caspase 3 / 7 activation in in vivo imaging of the cells. siUBB was used as a positive control, and untreated, liposome-only, and small-interference non-target (siNon-target) cells were used as negative controls.

[0424] like Figure 26 As shown in B, inhibition of variant NRAS by treatment with siRNA8 triggered apoptosis. Significantly greater caspase 3 / 7 activation was observed in primary nevus cell cultures treated with siRNA8 compared to the small interfering non-target (p<0.0001). Cell confluence was also significantly reduced in siRNA8-treated cells compared to the control (p<0.0001).

[0425] The above results demonstrate that the targeted variant NRAS triggers apoptosis in leptomeningeal melanocytosis, providing evidence of the utility of this method in different tissue types.

[0426] Example 9 - Combination therapy of NRAS and BRAF in acquired nevi

[0427] Individuals with acquired nevi will be recruited according to a standard protocol, and will be randomized and assigned to either a placebo (control) condition or a treatment condition. Under the treatment condition, individuals will be administered a composition containing siRNA targeting NRAS and BRAF variants, along with a pharmaceutically acceptable excipient. Under the placebo condition, individuals will be administered the same composition without siRNA. Administration of placebo or treatment will be via microneedle injection into the dermis or via topical application. Repeated doses may be administered. Measurements of nevus size, surface area, color, and shape will be performed before administration (baseline) and again at defined time points after administration (e.g., four weeks post-administration). Changes in nevus size and surface area relative to baseline will be calculated, and these changes will be statistically compared between the placebo and treatment conditions.

[0428] Example 10 - In melanoma cell lines and siNRAS Q61K During co-transfection, siBRAF V600E BRAF performed V600E The degree of variant-specific knockdown was maintained.

[0429] like Figure 27 As shown, transfection with a combination of siRNAs containing the same concentration of siBRAFV600E did not significantly affect the degree of variant-specific knockdown in the A2058 melanoma cell line (hybrid).

[0430] Example 11 - In alone or with siNRAS Q61K When the combination is transfected to the same extent, a single dose of siBRAF V600E Significant apoptosis was induced in the A2058 melanoma cell line (heterozygous).

[0431] like Figure 28 As shown, IncuCyte is performed. ® The experiment was conducted to test the response of the A2058 cell line to siBRAFV600E knockdown in combination with siNRAS or a small interference control, thereby measuring apoptosis.

[0432] Compared to the small interference control alone, a significant increase in apoptotic activity was observed under all conditions containing siBRAF V600E. Apoptotic activity comparable to that of siUBB (a positive control for cell death) was observed in all cases, regardless of the siBRAF concentration. V600E Whether it was transfection alone or in combination. Since all conditions for transfection with siBRAF were at comparable levels, this indicates that the pro-apoptotic effect of siBRAF was preserved when used in combination.

[0433] Example 12 - A series of concentrations of siBRAF used in combination V600E and siNRASQ61K In the relevant cell line (a heterozygous BRAF cell line for cutaneous melanoma A2058) V600E The study achieved fairly variant-specific knockdown of BRAF or NRAS.

[0434] exist Figure 29 In the experiment shown, siBRAF V600E and siNRAS Q61K were combined in four different concentration combinations. Figure 29 This indicates that the knockdown efficiency of siBRAF V600E did not differ under different conditions, with variant-specific knockdown achieved in all combinations regardless of the concentration of siRNA used. Figure 29 A, 29B).

[0435] Example 13 - In the A2058 melanoma cell line (heterozygote), different concentrations of siBRAF were used. V600E and different concentrations of siNRAS Q61K The combined transfection significantly induced apoptosis.

[0436] like Figure 30 As shown, the effects of different concentrations of siRNA on cell viability in the heterozygous BRAFV600E melanoma cell line A2058 were also evaluated. Significant and marked induction of apoptosis was observed under all siBRAFV600E conditions. Figure 30 Furthermore, increasing the concentration of siBRAF to some extent increases apoptosis.

[0437] Example 14 - Combined transfection with siNRASQ61K + siBRAFV600E does not impair specific knockdown of NRASQ61K variants in benign melanocytic nevus cell lines and dysplastic leptomeningeal melanocytic cell lines with multiple NRASQ61K variants.

[0438] Figure 31 The study presents supporting evidence for NRAS Q61K knockdown when transfected alone or in combination with siBRAF V600E in various NRAS Q61K variant nevus cell lines.

[0439] Example 14 - via siBRAF V600E , siNRAS Q61K The reduced expression of ARL6IP1 after siRNA knockdown of the combination of the two demonstrated its effectiveness in various primary nevus cell lines (NRAS). Q61K Mechanisms of apoptosis induction in heterozygotes

[0440] The results are shown in Figure 32 middle.

[0441] Example 15 - In the primary nevus cell line (NRAS) Q61K Heterozygous) and melanoma cell line (BRAF) V600E In heterozygous and homozygous combinations of siBRAF V600E and siNRAS Q61K The reduction in ARL6IP1 expression after siRNA knockdown was greater than the reduction in ARL6IP1 expression after knockdown using siRNA alone.

[0442] The results are shown in Figure 33 middle.

[0443] Equivalent form and scope

[0444] Those skilled in the art will understand that the present invention is defined by the appended claims rather than by the examples or other descriptions of certain embodiments included herein.

[0445] Similarly, unless the context clearly specifies otherwise, the singular forms “a / an” and “the” include plural indicators.

[0446] Unless otherwise defined above, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Any methods and materials similar to or equivalent to those described herein may also be used to practice or test the invention. Generally, the terminology and techniques used in conjunction with those described herein in cell and tissue culture, molecular biology, immunology, genetics and protein, and nucleic acid chemistry are well-known and commonly used in the art, or are according to the manufacturer's specifications.

[0447] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference in their entirety, as if each individual publication, patent, or patent application were specifically and individually indicated as incorporated herein by reference. Furthermore, any reference or identification in this application should not be construed as an admission that such reference is available as prior art to the invention. The use of section headings should not be construed as necessarily limiting.

[0448] sequence

[0449] Table 1 - Exemplary target sequences and exemplary siRNA sequences

[0450] Terms and Conditions

[0451] This application also provides the following implementation schemes:

[0452] 1. A nucleic acid molecule comprising a first strand consisting of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of an mRNA encoding NRAS or BRAF.

[0453] 2. The nucleic acid molecule according to embodiment 1, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of an mRNA encoding a gain-of-function variant of NRAS or BRAF.

[0454] 3. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding NRAS.

[0455] 4. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding a functional gain variant of NRAS.

[0456] 5. A nucleic acid molecule according to any one of embodiments 1 or 2, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding BRAF.

[0457] 6. A nucleic acid molecule according to any one of embodiments 1, 2 or 5, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding a functional gain variant of BRAF.

[0458] 7. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand consists of 10 to 40 linked nucleosides.

[0459] 8. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand consists of 10 to 30 linked nucleosides.

[0460] 9. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand consists of 15 to 30 linked nucleosides.

[0461] 10. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand consists of 15 to 25 linked nucleosides.

[0462] 11. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand consists of 15 to 20 linked nucleosides.

[0463] 12. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand consists of 10 to 20 linked nucleosides.

[0464] 13. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand consists of 20 to 30 linked nucleosides.

[0465] 14. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand consists of 20 to 25 linked nucleosides.

[0466] 15. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand consists of 21 linked nucleosides.

[0467] 16. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding variants NRAS p.(G60R), p.(G60V), p.(G60E), or p.(G60D).

[0468] 17. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the first strand comprises a sequence that is completely complementary to a sequence having 100% identity with an isometric portion of the mRNA encoding variants NRAS p.(G60R), p.(G60V), p.(G60E), or p.(G60D).

[0469] 18. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p.(G60R / V / E / D) by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro.

[0470] 19. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the nucleic acid molecule inhibits the expression of variant NRAS p.(G60R / V / E / D) to a greater extent in vitro than the inhibition of wild-type NRAS expression in vitro.

[0471] 20. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the nucleic acid molecule is capable of partially or completely rescuing abnormal cell differentiation signaling in cells expressing variant NRAS p.(G60R / V / E / D).

[0472] 21. The nucleic acid molecule according to any one of embodiments 16-20, wherein the variant NRAS p.(G60R) is caused by a c.G178C mutation in the NRAS genome sequence.

[0473] 22. The nucleic acid molecule according to embodiment 21, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:73-91.

[0474] 23. The nucleic acid molecule according to embodiment 21 or 22, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 73-91.

[0475] 24. The nucleic acid molecule according to any one of embodiments 21 to 23, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 73-91.

[0476] 25. The nucleic acid molecule according to any one of embodiments 16 to 20, wherein the variant NRAS p.(G60V) is caused by a c.G179T mutation in the NRAS genome sequence.

[0477] 26. The nucleic acid molecule according to embodiment 25, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:111-129.

[0478] 27. The nucleic acid molecule according to embodiment 25 or 26, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 111-129.

[0479] 28. The nucleic acid molecule according to any one of embodiments 25 to 27, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 111-129.

[0480] 29. The nucleic acid molecule according to any one of embodiments 16 to 20, wherein the variant NRAS p.(G60E) is caused by a c.G179A mutation in the NRAS genome sequence.

[0481] 30. The nucleic acid molecule according to embodiment 29, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:149-167.

[0482] 31. The nucleic acid molecule according to embodiment 29 or 30, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 149-167.

[0483] 32. The nucleic acid molecule according to any one of embodiments 29 to 31, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 149-167.

[0484] 33. A nucleic acid molecule according to any one of embodiments 1 to 4 or 7 to 15, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding variants NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P).

[0485] 34. A nucleic acid molecule according to any one of embodiments 1 to 4, 7 to 15 or 33, wherein the first strand comprises a sequence that is 100% complementary to a sequence having 100% identity with an isolength portion of the mRNA encoding variants NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L) or p.(Q61P).

[0486] 35. A nucleic acid molecule according to any one of embodiments 1 to 4, 7 to 15 or 33 to 34, wherein the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p.(Q61K / R / H / L / P) by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% in vitro.

[0487] 36. The nucleic acid molecule according to any one of embodiments 1 to 4, 7 to 15 or 33 to 35, wherein the nucleic acid molecule inhibits the expression of variant NRAS p.(Q61K / R / H / L / P) to a greater extent in vitro than the inhibition of wild-type NRAS expression in vitro.

[0488] 37. A nucleic acid molecule according to any one of embodiments 1 to 4, 7 to 15 or 33 to 36, wherein the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signaling in cells expressing variant NRAS p.(Q61K / R / H / L / P).

[0489] 38. The nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS p.(Q61K) is caused by a c.C181A mutation in the NRAS genome sequence.

[0490] 39. The nucleic acid molecule according to embodiment 38, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:187-205.

[0491] 40. The nucleic acid molecule according to embodiment 38 or 39, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 187-205.

[0492] 41. The nucleic acid molecule according to any one of embodiments 38 to 40, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 187-205.

[0493] 42. The nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS p.(Q61R) is caused by a c.A182G mutation in the NRAS genome sequence.

[0494] 43. The nucleic acid molecule according to embodiment 42, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:225-243.

[0495] 44. The nucleic acid molecule according to embodiment 42 or 43, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 225-243.

[0496] 45. The nucleic acid molecule according to any one of embodiments 42 to 44, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 225-243.

[0497] 46. ​​The nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS p.(Q61L) is caused by a c.A182T mutation in the NRAS genome sequence.

[0498] 47. The nucleic acid molecule according to embodiment 46, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:263-281.

[0499] 48. The nucleic acid molecule according to embodiment 46 or 47, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 263-281.

[0500] 49. The nucleic acid molecule according to any one of embodiments 46 to 48, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 263-281.

[0501] 50. The nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS p.(Q61P) is caused by a c.A182C mutation in the NRAS genome sequence.

[0502] 51. The nucleic acid molecule according to embodiment 50, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:301-319.

[0503] 52. The nucleic acid molecule according to embodiment 50 or 51, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 301-319.

[0504] 53. The nucleic acid molecule according to any one of embodiments 50 to 52, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 301-319.

[0505] 54. The nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS p.(Q61H) variant is caused by a c.A183C mutation in the NRAS genome sequence.

[0506] 55. The nucleic acid molecule according to embodiment 54, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:339-357.

[0507] 56. The nucleic acid molecule according to embodiment 54 or 55, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 339-357.

[0508] 57. The nucleic acid molecule according to any one of embodiments 54 to 56, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 339-357.

[0509] 58. The nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS p.(Q61H) variant is caused by a c.A183T mutation in the NRAS genome sequence.

[0510] 59. The nucleic acid molecule according to embodiment 58, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:377-395.

[0511] 60. The nucleic acid molecule according to embodiment 58 or 59, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 377-395.

[0512] 61. The nucleic acid molecule according to any one of embodiments 58 to 60, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 377-395.

[0513] 62. The nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS is caused by a c.180_181delinsTA mutation in the NRAS genome sequence.

[0514] 63. The nucleic acid molecule according to embodiment 62, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 991-1010.

[0515] 64. The nucleic acid molecule according to embodiment 62 or 63, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 991-1010.

[0516] 65. The nucleic acid molecule according to any one of embodiments 62 to 64, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 991-1010.

[0517] 66. The nucleic acid molecule according to any one of embodiments 33 to 37, wherein the variant NRAS is caused by a c.181_183delinsAAG mutation in the NRAS genome sequence.

[0518] 67. The nucleic acid molecule according to embodiment 66, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:1031-1051.

[0519] 68. The nucleic acid molecule according to embodiment 66 or 67, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1031-1051.

[0520] 69. The nucleic acid molecule according to any one of embodiments 66 to 68, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1031-1051.

[0521] 70. A nucleic acid molecule according to any one of embodiments 1 to 4 or 7 to 15, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding variants NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V).

[0522] 71. A nucleic acid molecule according to any one of embodiments 1 to 4, 7 to 15 or 70, wherein the first strand comprises a sequence that is completely complementary to a sequence having 100% identity with an isolength portion of the mRNA encoding variants NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A) or p.(G12V).

[0523] 72. A nucleic acid molecule according to any one of embodiments 1 to 4, 7 to 15 or 70 to 71, wherein the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p. (G12R / S / D / P / C / A / V) by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% in vitro.

[0524] 73. The nucleic acid molecule according to any one of embodiments 1 to 4, 7 to 15 or 70 to 72, wherein the nucleic acid molecule inhibits the expression of variant NRAS p. (G12R / S / D / P / C / A / V) to a greater extent in vitro than the inhibition of wild-type NRAS expression in vitro.

[0525] 74. A nucleic acid molecule according to any one of embodiments 1 to 4, 7 to 15 or 70 to 73, wherein the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signaling in cells expressing variant NRAS p. (G12R / S / D / P / C / A / V).

[0526] 75. The nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12V) is caused by a c.G35T mutation in the NRAS genome sequence.

[0527] 76. The nucleic acid molecule according to embodiment 75, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:415-433.

[0528] 77. The nucleic acid molecule according to embodiment 75 or 76, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 415-433.

[0529] 78. The nucleic acid molecule according to any one of embodiments 75 to 77, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 415-433.

[0530] 79. The nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12R) is caused by a c.G34C mutation in the NRAS genome sequence.

[0531] 80. The nucleic acid molecule according to embodiment 79, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:453-471.

[0532] 81. The nucleic acid molecule according to embodiment 79 or 80, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 453-471.

[0533] 82. The nucleic acid molecule according to any one of embodiments 79 to 81, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 453-471.

[0534] 83. The nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12D) is caused by a c.G35A mutation in the NRAS genome sequence.

[0535] 84. The nucleic acid molecule according to embodiment 83, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:491-509.

[0536] 85. The nucleic acid molecule according to embodiment 83 or 84, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 491-509.

[0537] 86. The nucleic acid molecule according to any one of embodiments 83 to 85, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 491-509.

[0538] 87. The nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12S) is caused by a c.G34A mutation in the NRAS genome sequence.

[0539] 88. The nucleic acid molecule according to embodiment 87, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:529-547.

[0540] 89. The nucleic acid molecule according to embodiment 87 or 88, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 529-547.

[0541] 90. A nucleic acid molecule according to any one of embodiments 87 to 89, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 529-547.

[0542] 91. The nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12P) is caused by a c.G34C / G35C mutation in the NRAS genome sequence.

[0543] 92. The nucleic acid molecule according to embodiment 91, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:567-586.

[0544] 93. The nucleic acid molecule according to embodiment 91 or 92, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 567-586.

[0545] 94. The nucleic acid molecule according to any one of embodiments 91 to 93, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 567-586.

[0546] 95. The nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12C) is caused by a c.G34T mutation in the NRAS genome sequence.

[0547] 96. The nucleic acid molecule according to embodiment 95, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:607-625.

[0548] 97. The nucleic acid molecule according to embodiment 95 or 96, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 607-625.

[0549] 98. A nucleic acid molecule according to any one of embodiments 95 to 97, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 607-625.

[0550] 99. The nucleic acid molecule according to any one of embodiments 70 to 74, wherein the variant NRAS p.(G12A) is caused by a c.G35C mutation in the NRAS genome sequence.

[0551] 100. The nucleic acid molecule according to embodiment 99, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO:645-663.

[0552] 101. The nucleic acid molecule according to embodiment 99 or 100, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 645-663.

[0553] 102. The nucleic acid molecule according to any one of embodiments 99 to 101, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 645-663.

[0554] 103. A nucleic acid molecule according to any one of embodiments 1 to 4 or 7 to 15, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding variants NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F), or p.(G13Y).

[0555] 104. A nucleic acid molecule according to any one of embodiments 1 to 4, 7 to 15 or 103, wherein the first strand comprises a sequence that is completely complementary to a sequence having 100% identity with an isolength portion of the mRNA encoding variants NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F) or p.(G13Y).

[0556] 105. A nucleic acid molecule according to any one of embodiments 1 to 4, 7 to 15 or 103 to 104, wherein the nucleic acid molecule is capable of inhibiting the expression of variant NRAS p. (G13V / D / A / S / C / R / F / Y) by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% in vitro.

[0557] 106. The nucleic acid molecule according to any one of embodiments 1 to 4, 7 to 15 or 103 to 105, wherein the nucleic acid molecule inhibits the expression of variant NRAS p. (G13V / D / A / S / C / R / F / Y) to a greater extent in vitro than the inhibition of wild-type NRAS expression in vitro.

[0558] 107. A nucleic acid molecule according to any one of embodiments 1 to 4, 7 to 15 or 103 to 106, wherein the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signaling in cells expressing variant NRAS p. (G13V / D / A / S / C / R / F / Y).

[0559] 108. The nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13S) is caused by a c.G37A mutation in the NRAS genome sequence.

[0560] 109. The nucleic acid molecule according to embodiment 108, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 683-701.

[0561] 110. The nucleic acid molecule according to embodiment 108 or 109, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 683-701.

[0562] 111. The nucleic acid molecule according to any one of embodiments 108 to 110, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 683-701.

[0563] 112. The nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13C) is caused by a c.G37T mutation in the NRAS genome sequence.

[0564] 113. The nucleic acid molecule according to embodiment 112, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 721-739.

[0565] 114. The nucleic acid molecule according to embodiment 112 or 113, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 721-739.

[0566] 115. The nucleic acid molecule according to any one of embodiments 112 to 114, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 721-739.

[0567] 116. The nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13R) is caused by a c.G37C mutation in the NRAS genome sequence.

[0568] 117. The nucleic acid molecule according to embodiment 116, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 759-777.

[0569] 118. The nucleic acid molecule according to embodiment 116 or 117, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 759-777.

[0570] 119. The nucleic acid molecule according to any one of embodiments 116 to 118, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 759-777.

[0571] 120. The nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13F) is caused by a c.37_38delinsTT mutation in the NRAS genome sequence.

[0572] 121. The nucleic acid molecule according to embodiment 120, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 797-816.

[0573] 122. The nucleic acid molecule according to embodiment 120 or 121, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 797-816.

[0574] 123. The nucleic acid molecule according to any one of embodiments 120 to 122, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 797-816.

[0575] 124. The nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13Y) is caused by a c.37_38delinsTA mutation in the NRAS genome sequence.

[0576] 125. The nucleic acid molecule according to embodiment 124, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 837-856.

[0577] 126. The nucleic acid molecule according to embodiment 124 or 125, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 837-856.

[0578] 127. The nucleic acid molecule according to any one of embodiments 124 to 126, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 837-856.

[0579] 128. The nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13V) is caused by a c.G38T mutation in the NRAS genome sequence.

[0580] 129. The nucleic acid molecule according to embodiment 128, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 877-895.

[0581] 130. The nucleic acid molecule according to embodiment 128 or 129, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 877-895.

[0582] 131. The nucleic acid molecule according to any one of embodiments 128 to 130, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 877-895.

[0583] 132. The nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13D) is caused by a c.G38A mutation in the NRAS genome sequence.

[0584] 133. The nucleic acid molecule according to embodiment 132, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 915-933.

[0585] 134. The nucleic acid molecule according to embodiment 132 or 133, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 915-933.

[0586] 135. The nucleic acid molecule according to any one of embodiments 132 to 134, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 915-933.

[0587] 136. The nucleic acid molecule according to any one of embodiments 103 to 107, wherein the variant NRAS p.(G13A) is caused by a c.G38C mutation in the NRAS genome sequence.

[0588] 137. The nucleic acid molecule according to embodiment 136, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 953-971.

[0589] 138. The nucleic acid molecule according to embodiment 136 or 137, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 953-971.

[0590] 139. The nucleic acid molecule according to any one of embodiments 136 to 138, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 953-971.

[0591] 140. A nucleic acid molecule according to any one of embodiments 1 to 2 or 5 to 15, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding variants BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E).

[0592] 141. A nucleic acid molecule according to any one of embodiments 1 to 2, or 5 to 15, or 140, wherein the first strand comprises a sequence that is completely complementary to a sequence having 100% identity with an isolength portion of the mRNA encoding variants BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E).

[0593] 142. A nucleic acid molecule according to any one of embodiments 1 to 2, or 5 to 15, or 140 to 141, wherein the nucleic acid molecule is capable of inhibiting the expression of variant BRAF p. (V600G / M / D / R / K / E) by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro.

[0594] 143. The nucleic acid molecule according to any one of embodiments 1 to 2, or 5 to 15, or 140 to 142, wherein the nucleic acid molecule inhibits the expression of variant BRAF p. (V600G / M / D / R / K / E) to a greater extent in vitro than the inhibition of wild-type BRAF expression in vitro.

[0595] 144. A nucleic acid molecule according to any one of embodiments 1 to 2, or 5 to 15, or 140 to 143, wherein the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signaling in cells expressing variant BRAF p. (V600G / M / D / R / K / E).

[0596] 145. The nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600G) is caused by the c.T1799G mutation in the BRAF genome sequence.

[0597] 146. The nucleic acid molecule according to embodiment 145, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1073-1091.

[0598] 147. The nucleic acid molecule according to embodiment 145 or 146, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1073-1091.

[0599] 148. The nucleic acid molecule according to any one of embodiments 145 to 147, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1073-1091.

[0600] 149. The nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600M) is caused by a c.G1798A mutation in the BRAF genome sequence.

[0601] 150. The nucleic acid molecule according to embodiment 149, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1111-1129.

[0602] 151. The nucleic acid molecule according to embodiment 149 or 150, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1111-1129.

[0603] 152. The nucleic acid molecule according to any one of embodiments 149 to 151, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1111-1129.

[0604] 153. The nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600D) is caused by the c.1799_1800delisAT mutation in the BRAF genome sequence.

[0605] 154. The nucleic acid molecule according to embodiment 153, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1149-1167.

[0606] 155. The nucleic acid molecule according to embodiment 153 or 154, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1149-1167.

[0607] 156. The nucleic acid molecule according to any one of embodiments 153 to 155, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1149-1167.

[0608] 157. The nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600R) is caused by the c.1798_1799delisCG mutation in the BRAF genome sequence.

[0609] 158. The nucleic acid molecule according to embodiment 157, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1187-1206.

[0610] 159. The nucleic acid molecule according to embodiment 157 or 158, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1187-1206.

[0611] 160. The nucleic acid molecule according to any one of embodiments 157 to 159, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1187-1206.

[0612] 161. The nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600K) is caused by the c.1798_1799delisAA mutation in the BRAF genome sequence.

[0613] 162. The nucleic acid molecule according to embodiment 161, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1227-1246.

[0614] 163. The nucleic acid molecule according to embodiment 161 or 162, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1227-1246.

[0615] 164. The nucleic acid molecule according to any one of embodiments 161 to 163, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1227-1246.

[0616] 165. The nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600E) is caused by the c.1799_1800delisAA mutation in the BRAF genome sequence.

[0617] 166. The nucleic acid molecule according to embodiment 165, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1267-1286.

[0618] 167. The nucleic acid molecule according to embodiment 165 or 166, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1267-1286.

[0619] 168. The nucleic acid molecule according to any one of embodiments 165 to 167, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1267-1286.

[0620] 169. The nucleic acid molecule according to any one of embodiments 140 to 144, wherein the variant BRAF p.(V600E) is caused by a c.T1799A mutation in the BRAF genome sequence.

[0621] 170. The nucleic acid molecule according to embodiment 169, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1307-1325.

[0622] 171. The nucleic acid molecule according to embodiment 169 or 170, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1307-1325.

[0623] 172. The nucleic acid molecule according to any one of embodiments 169 to 171, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO: 1307-1325.

[0624] 173. The nucleic acid molecule according to any one of the foregoing embodiments, wherein the nucleic acid molecule is a single-stranded nucleic acid molecule.

[0625] 174. The nucleic acid molecule according to any one of embodiments 1 to 172, wherein the nucleic acid molecule is a double-stranded nucleic acid molecule.

[0626] 175. The nucleic acid molecule according to embodiment 174, wherein the double-stranded nucleic acid molecule comprises a second strand consisting of 10 to 50 linked nucleosides, wherein the second strand is at least partially complementary to the first strand.

[0627] 176. The nucleic acid molecule according to embodiment 175, wherein the second strand is at least 80% complementary to the first strand.

[0628] 177. The nucleic acid molecule according to embodiment 175 or 176, wherein the second strand is at least 90% complementary to the first strand.

[0629] 178. The nucleic acid molecule according to any one of embodiments 175 to 177, wherein the second strand is at least 95% complementary to the first strand.

[0630] 179. The nucleic acid molecule according to any one of embodiments 175 to 178, wherein the second strand is completely complementary to the first strand.

[0631] 180. The nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second strand is composed of 10 to 40 linked nucleosides.

[0632] 181. The nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second strand is composed of 10 to 30 linked nucleosides.

[0633] 182. The nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second strand is composed of 15 to 30 linked nucleosides.

[0634] 183. The nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second strand is composed of 15 to 25 linked nucleosides.

[0635] 184. The nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second strand is composed of 15 to 20 linked nucleosides.

[0636] 185. The nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second strand is composed of 10 to 20 linked nucleosides.

[0637] 186. The nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second strand is composed of 20 to 30 linked nucleosides.

[0638] 187. The nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second strand is composed of 20 to 25 linked nucleosides.

[0639] 188. The nucleic acid molecule according to any one of embodiments 175 to 179, wherein the second strand is composed of 21 linked nucleosides.

[0640] 189. The nucleic acid molecule according to any one of embodiments 175 to 188, wherein the first strand is longer than the second strand.

[0641] 190. The nucleic acid molecule according to any one of embodiments 175 to 189, having a protruding end at the 3' end of the first strand composed of one, two, three, four, five or more nucleotides.

[0642] 191. The nucleic acid molecule according to any one of embodiments 175 to 190, having a protrusion composed of two nucleosides at the 3' end of the first strand.

[0643] 192. The nucleic acid molecule according to any one of embodiments 175 to 191, wherein it has a protrusion at the 5' end of the first strand consisting of one, two, three, four, five or more nucleotides.

[0644] 193. The nucleic acid molecule according to any one of embodiments 175 to 192, wherein it has a 5' end composed of two nucleosides at the 5' end of the first strand.

[0645] 194. The nucleic acid molecule according to any one of embodiments 175 to 188, wherein the second strand is longer than the first strand.

[0646] 195. The nucleic acid molecule according to embodiments 175 to 188 or 194, having a protrusion at the 3' end of the first strand consisting of one, two, three, four, five or more nucleosides.

[0647] 196. The nucleic acid molecule according to any one of embodiments 175 to 188 or 194 to 195, having a protrusion composed of two nucleosides at the 3' end of the second strand.

[0648] 197. The nucleic acid molecule according to any one of embodiments 175 to 188 or 194 to 196, having a protrusion at the 5' end of the second strand consisting of one, two, three, four, five or more nucleotides.

[0649] 198. The nucleic acid molecule according to any one of embodiments 175 to 188 or 194 to 197, having a 5' end of the second strand consisting of two nucleosides.

[0650] 199. The nucleic acid molecule according to any one of embodiments 175 to 188 or 194 to 198, having overhangs at the 5' and 3' ends of the first strand composed of one, two, three, four, five or more nucleotides.

[0651] 200. The nucleic acid molecule according to any one of embodiments 175 to 188 or 194 to 199, having overhangs composed of two nucleosides at the 5' and 3' ends of the first strand.

[0652] 201. The nucleic acid molecule according to any one of embodiments 190 to 193 or 194 to 200, wherein the overhang comprises two thymine nucleotides (TT).

[0653] 202. The nucleic acid molecule according to any one of embodiments 190 to 193 or 194 to 200, wherein the overhang is composed of two thymidine nucleotides (TT).

[0654] 203. A nucleic acid molecule according to any one of embodiments 175 to 202, wherein the second strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of:

[0655] (a)SEQ ID NO: 92-110;

[0656] (b)SEQ ID NO: 130-148;

[0657] (c)SEQ ID NO: 168-186;

[0658] (d)SEQ ID NO: 206-224;

[0659] (e)SEQ ID NO: 244-262;

[0660] (f)SEQ ID NO: 282-300;

[0661] (g)SEQ ID NO: 320-338;

[0662] (h)SEQ ID NO: 358-376;

[0663] (i)SEQ ID NO: 396-414;

[0664] (j)SEQ ID NO: 434-452;

[0665] (k)SEQ ID NO: 472-490;

[0666] (l)SEQ ID NO: 510-528;

[0667] (m)SEQ ID NO: 548-566;

[0668] (n)SEQ ID NO: 587-606;

[0669] (o)SEQ ID NO: 626-644;

[0670] (p)SEQ ID NO: 664-682;

[0671] (q)SEQ ID NO: 702-720;

[0672] (r)SEQ ID NO: 740-758;

[0673] (s)SEQ ID NO: 778-796;

[0674] (t)SEQ ID NO: 817-836;

[0675] (u)SEQ ID NO: 857-876;

[0676] (v)SEQ ID NO: 896-914;

[0677] (w)SEQ ID NO: 934-952;

[0678] (x)SEQ ID NO: 972-990;

[0679] (y)SEQ ID NO: 1011-1030;

[0680] (z)SEQ ID NO: 1052-1072;

[0681] (aa)SEQ ID NO: 1092-1110;

[0682] (bb)SEQ ID NO: 1130-1148;

[0683] (cc)SEQ ID NO: 1168-1186;

[0684] (dd)SEQ ID NO: 1207-1226;

[0685] (ee)SEQ ID NO: 1247-1266;

[0686] (ff)SEQ ID NO: 1287-1306; or

[0687] (gg)SEQ ID NO: 1326-1344.

[0688] 204. The nucleic acid molecule according to embodiments 175 to 203, wherein the second strand comprises a sequence selected from the group consisting of:

[0689] (a)SEQ ID NO: 92-110;

[0690] (b)SEQ ID NO: 130-148;

[0691] (c)SEQ ID NO: 168-186;

[0692] (d)SEQ ID NO: 206-224;

[0693] (e)SEQ ID NO: 244-262;

[0694] (f)SEQ ID NO: 282-300;

[0695] (g)SEQ ID NO: 320-338;

[0696] (h)SEQ ID NO: 358-376;

[0697] (i)SEQ ID NO: 396-414;

[0698] (j)SEQ ID NO: 434-452;

[0699] (k)SEQ ID NO: 472-490;

[0700] (l)SEQ ID NO: 510-528;

[0701] (m)SEQ ID NO: 548-566;

[0702] (n)SEQ ID NO: 587-606;

[0703] (o)SEQ ID NO: 626-644;

[0704] (p)SEQ ID NO: 664-682;

[0705] (q)SEQ ID NO: 702-720;

[0706] (r)SEQ ID NO: 740-758;

[0707] (s)SEQ ID NO: 778-796;

[0708] (t)SEQ ID NO: 817-836;

[0709] (u)SEQ ID NO: 857-876;

[0710] (v)SEQ ID NO: 896-914;

[0711] (w)SEQ ID NO: 934-952;

[0712] (x)SEQ ID NO: 972-990;

[0713] (y)SEQ ID NO: 1011-1030;

[0714] (z)SEQ ID NO: 1052-1072;

[0715] (aa)SEQ ID NO: 1092-1110;

[0716] (bb)SEQ ID NO: 1130-1148;

[0717] (cc)SEQ ID NO: 1168-1186;

[0718] (dd)SEQ ID NO: 1207-1226;

[0719] (ee)SEQ ID NO: 1247-1266;

[0720] (ff)SEQ ID NO: 1287-1306; or

[0721] (gg)SEQ ID NO: 1326-1344.

[0722] 205. A nucleic acid molecule according to any one of embodiments 175 to 204, wherein the second strand comprises a sequence selected from the group consisting of:

[0723] (a)SEQ ID NO: 92-110;

[0724] (b)SEQ ID NO: 130-148;

[0725] (c)SEQ ID NO: 168-186;

[0726] (d)SEQ ID NO: 206-224;

[0727] (e)SEQ ID NO: 244-262;

[0728] (f)SEQ ID NO: 282-300;

[0729] (g)SEQ ID NO: 320-338;

[0730] (h)SEQ ID NO: 358-376;

[0731] (i)SEQ ID NO: 396-414;

[0732] (j)SEQ ID NO: 434-452;

[0733] (k)SEQ ID NO: 472-490;

[0734] (l)SEQ ID NO: 510-528;

[0735] (m)SEQ ID NO: 548-566;

[0736] (n)SEQ ID NO: 587-606;

[0737] (o)SEQ ID NO: 626-644;

[0738] (p)SEQ ID NO: 664-682;

[0739] (q)SEQ ID NO: 702-720;

[0740] (r)SEQ ID NO: 740-758;

[0741] (s)SEQ ID NO: 778-796;

[0742] (t)SEQ ID NO: 817-836;

[0743] (u)SEQ ID NO: 857-876;

[0744] (v)SEQ ID NO: 896-914;

[0745] (w)SEQ ID NO: 934-952;

[0746] (x)SEQ ID NO: 972-990;

[0747] (y)SEQ ID NO: 1011-1030;

[0748] (z)SEQ ID NO: 1052-1072;

[0749] (aa)SEQ ID NO: 1092-1110;

[0750] (bb)SEQ ID NO: 1130-1148;

[0751] (cc)SEQ ID NO: 1168-1186;

[0752] (dd)SEQ ID NO: 1207-1226;

[0753] (ee)SEQ ID NO: 1247-1266;

[0754] (ff)SEQ ID NO: 1287-1306; or

[0755] (gg)SEQ ID NO: 1326-1344.

[0756] 206. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand, the first strand and the second strand comprising sequence pairs selected from the list consisting of: SEQ ID NO: 73 and SEQ ID NO: 92, SEQ ID NO: 74 and SEQ ID NO: 93, SEQ ID NO: 75 and SEQ ID NO: 94, SEQ ID NO: 76 and SEQ ID NO: 95, SEQ ID NO: 77 and SEQ ID NO: 96, SEQ ID NO: 78 and SEQ ID NO: 97, SEQ ID NO: 79 and SEQ ID NO: 98, SEQ ID NO: 80 and SEQ ID NO: 99, SEQ ID NO: 81 and SEQ ID NO: 100, SEQ ID NO: 82 and SEQ ID NO: 101, SEQ ID NO: 83 and SEQ ID NO: 102, SEQ ID NO: 84 and SEQ ID NO: 103, SEQ ID NO: 85 and SEQ ID NO: 96. SEQ ID NO: 104, SEQ ID NO: 86, SEQ ID NO: 105, SEQ ID NO: 87, SEQ ID NO: 106, SEQ ID NO: 88, SEQ ID NO: 107, SEQ ID NO: 89, SEQ ID NO: 108, SEQ ID NO: 90, SEQ ID NO: 109, SEQ ID NO: 91, and SEQ ID NO: 110.

[0757] 207. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand, the first strand and the second strand comprising sequence pairs selected from the list consisting of: SEQ ID NO: 111 and SEQ ID NO: 130, SEQ ID NO: 112 and SEQ ID NO: 131, SEQ ID NO: 113 and SEQ ID NO: 132, SEQ ID NO: 114 and SEQ ID NO: 133, SEQ ID NO: 115 and SEQ ID NO: 134, SEQ ID NO: 116 and SEQ ID NO: 135, SEQ ID NO: 117 and SEQ ID NO: 136, SEQ ID NO: 118 and SEQ ID NO: 137, SEQ ID NO: 119 and SEQ ID NO: 138, SEQ ID NO: 120 and SEQ ID NO: 139, SEQ ID NO: 121 and SEQ ID NO: 140, SEQ ID NO: 139, SEQ ID NO: 121 and SEQ ID NO: 140, SEQ ID NO: 139, SEQ ID NO: 120 and SEQ ID NO: 139, SEQ ID NO: 121 and SEQ ID NO: 140, SEQ ID NO: 139, SEQ ID NO: 13 ... SEQ ID NO: 122 and SEQ ID NO: 141, SEQ ID NO: 123 and SEQ ID NO: 142, SEQ ID NO: 124 and SEQ ID NO: 143, SEQ ID NO: 125 and SEQ ID NO: 144, SEQ ID NO: 126 and SEQ ID NO: 145, SEQ ID NO: 127 and SEQ ID NO: 146, SEQ ID NO: 128 and SEQ ID NO: 147, and SEQ ID NO: 129 and SEQ ID NO: 148.

[0758] 208. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand, the first strand and the second strand comprising sequence pairs selected from the list consisting of: SEQ ID NO: 149 and SEQ ID NO: 168, SEQ ID NO: 150 and SEQ ID NO: 169, SEQ ID NO: 151 and SEQ ID NO: 170, SEQ ID NO: 152 and SEQ ID NO: 171, SEQ ID NO: 153 and SEQ ID NO: 172, SEQ ID NO: 154 and SEQ ID NO: 173, SEQ ID NO: 155 and SEQ ID NO: 174, SEQ ID NO: 156 and SEQ ID NO: 175, SEQ ID NO: 157 and SEQ ID NO: 176, SEQ ID NO: 158 and SEQ ID NO: 177, SEQ ID NO: 159 and SEQ ID NO: 178, SEQ ID NO: SEQ ID NO: 160 and SEQ ID NO: 179, SEQ ID NO: 161 and SEQ ID NO: 180, SEQ ID NO: 162 and SEQ ID NO: 181, SEQ ID NO: 163 and SEQ ID NO: 182, SEQ ID NO: 164 and SEQ ID NO: 183, SEQ ID NO: 165 and SEQ ID NO: 184, SEQ ID NO: 166 and SEQ ID NO: 185, and SEQ ID NO: 167 and SEQ ID NO: 186.

[0759] 209. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand, the first strand and the second strand comprising sequence pairs selected from the list consisting of: SEQ ID NO: 187 and SEQ ID NO: 206, SEQ ID NO: 188 and SEQ ID NO: 207, SEQ ID NO: 189 and SEQ ID NO: 208, SEQ ID NO: 190 and SEQ ID NO: 209, SEQ ID NO: 191 and SEQ ID NO: 210, SEQ ID NO: 192 and SEQ ID NO: 211, SEQ ID NO: 193 and SEQ ID NO: 212, SEQ ID NO: 194 and SEQ ID NO: 213, SEQ ID NO: 195 and SEQ ID NO: 214, SEQ ID NO: 196 and SEQ ID NO: 215, SEQ ID NO: 197 and SEQ ID NO: 216, SEQ ID NO: SEQ ID NO: 198 and SEQ ID NO: 217, SEQ ID NO: 199 and SEQ ID NO: 218, SEQ ID NO: 200 and SEQ ID NO: 219, SEQ ID NO: 201 and SEQ ID NO: 220, SEQ ID NO: 202 and SEQ ID NO: 221, SEQ ID NO: 203 and SEQ ID NO: 222, SEQ ID NO: 204 and SEQ ID NO: 223, and SEQ ID NO: 205 and SEQ ID NO: 224.

[0760] 210. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand, the first strand and the second strand comprising sequence pairs selected from the list consisting of: SEQ ID NO: 225 and SEQ ID NO: 244, SEQ ID NO: 226 and SEQ ID NO: 245, SEQ ID NO: 227 and SEQ ID NO: 246, SEQ ID NO: 228 and SEQ ID NO: 247, SEQ ID NO: 229 and SEQ ID NO: 248, SEQ ID NO: 230 and SEQ ID NO: 249, SEQ ID NO: 231 and SEQ ID NO: 250, SEQ ID NO: 232 and SEQ ID NO: 251, SEQ ID NO: 233 and SEQ ID NO: 252, SEQ ID NO: 234 and SEQ ID NO: 253, SEQ ID NO: 235 and SEQ ID NO: 254, SEQ ID NO: SEQ ID NO: 236 and SEQ ID NO: 255, SEQ ID NO: 237 and SEQ ID NO: 256, SEQ ID NO: 238 and SEQ ID NO: 257, SEQ ID NO: 239 and SEQ ID NO: 258, SEQ ID NO: 240 and SEQ ID NO: 259, SEQ ID NO: 241 and SEQ ID NO: 260, SEQ ID NO: 242 and SEQ ID NO: 261, and SEQ ID NO: 243 and SEQ ID NO: 262.

[0761] 211. A nucleic acid molecule according to any one of embodiments 175 to 205, wherein the nucleic acid molecule comprises a first strand and a second strand, the first strand and the second strand comprising sequence pairs selected from the list consisting of: SEQ ID NO: 263 and SEQ ID NO: 282, SEQ ID NO: 264 and SEQ ID NO: 283, SEQ ID NO: 265 and SEQ ID NO: 284, SEQ ID NO: 266 and SEQ ID NO: 285, SEQ ID NO: 267 and SEQ ID NO: 286, SEQ ID NO: 268 and SEQ ID NO: 287, SEQ ID NO: 269 and SEQ ID NO: 288, SEQ ID NO: 270 and SEQ ID NO: 289, SEQ ID NO: 271 and SEQ ID NO: 290, SEQ ID NO: 272 and SEQ ID NO: 291, SEQ ID NO: 273 and SEQ ID NO: 292, SEQ ID NO: 293, SEQ ID NO: 294, SEQ ID NO: 295, SEQ ID NO: 296, SEQ ID NO: 297, SEQ ID NO: 298, SEQ ID NO: 29 ... SEQ ID NO: 274 and SEQ ID NO: 293, SEQ ID NO: 275 and SEQ ID NO: 294, SEQ ID NO: 276 and SEQ ID NO: 295, SEQ ID NO: 277 and SEQ ID NO: 296, SEQ ID NO: 278 and SEQ ID NO: 297, SEQ ID NO: 279 and SEQ ID NO: 298, SEQ ID NO: 280 and SEQ ID NO: 299, and SEQ ID NO: 281 and SEQ ID NO: 300.

[0762] 212. A nucleic acid molecule according to any one of emb...

Claims

1. A composition comprising a first nucleic acid molecule and a second nucleic acid molecule, The first nucleic acid molecule comprises a first strand consisting of 10 to 50 linked nucleosides, wherein the first strand contains a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding NRAS; and The second nucleic acid molecule comprises a first strand consisting of 10 to 50 linked nucleosides, wherein the first strand contains a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding BRAF.

2. The composition according to claim 1, wherein: 1） a) The first strand of the first nucleic acid molecule i) A sequence that is completely complementary to an isolength portion of the mRNA encoding a functional gain variant of NRAS and has at least 90% identity with the sequence; ii) Composed of 20 to 25 linked nucleosides; iii) Composed of 21 linked nucleosides; iv) A sequence that is completely complementary to the mRNA of the same length as the encoding variants NRAS p.(G60R), p.(G60V), p.(G60E), or p.(G60D); v) A sequence that is completely complementary to the isolength portion of the mRNA encoding the variants NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P); vi) A sequence that is completely complementary to the isolength portion of the mRNA encoding the NRAS variants p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V); or vii) A sequence that is completely complementary to the isolength portion of the mRNA encoding variants NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F), or p.(G13Y); b) The first nucleic acid molecule is a single-stranded nucleic acid molecule; c) The first nucleic acid molecule is a double-stranded nucleic acid molecule; optionally, wherein the double-stranded nucleic acid molecule comprises a second strand consisting of 10 to 50 linked nucleosides, wherein the second strand is at least partially complementary to the first strand; optionally x) wherein the second chain is at least 95% complementary to the first chain; y) having a protruding end composed of one, two, three, four, five or more nucleotides at both the 5' and 3' ends of the first chain; and / or z) The first chain has overhangs at both the 5' and 3' ends, each consisting of two nucleotides, optionally wherein the overhangs comprise two thymine nucleotides (TT); and / or d) The first nucleic acid molecule specifically targets DNA sequences selected from the list consisting of: SEQ ID NO: 7 (NRAS_c.178G>C_p.G60R), SEQ ID NO: 9 (NRAS_c.179G>T_p.G60V), SEQ ID NO: 11 (NRAS_c.179G>A_p.G60E), SEQ ID NO: 13 (NRAS_c.181C>A_p.Q61K), SEQ ID NO: 15 (NRAS_c.182A>G_p.Q61R), SEQ ID NO: 17 (NRAS_c.182A>T_p.Q61L), SEQ ID NO: 19 (NRAS_c.182A>C_p.Q61P), SEQ ID NO: 21 (NRAS_c.183A>C_p.Q61H), SEQ ID NO: 23 (NRAS_c.183A>T_p.Q61H), SEQ ID NO: 25 (NRAS_c.35G>T_p.G12V), SEQ ID NO: 27 (NRAS_c.34G>C_p.G12R), SEQ ID NO: 29 (NRAS_c.35G>A_p.G12D), SEQ ID NO: 31 (NRAS_c.34G>A_p.G12S), SEQ ID NO: 33 (NRAS_c.34_35G>C_ p.G12P), SEQ ID NO: 35 (NRAS_c.34G>T_p.G12C), SEQ ID NO: 37 (NRAS_c.35G>C_p.G12A), SEQ ID NO: 39 (NRAS_c.37G>A_p.G13S), SEQ ID NO: 41 (NRAS_c.37G>T_p.G13C), SEQ ID NO: 43 (NRAS_c.37G>C_p.G13R), SEQ ID NO: 45 (NRAS_c.37_38delinsTT_ p.G13F), SEQ ID NO: 47 (NRAS_c.37_38delinsTA_ p.G13Y), SEQ ID NO: 49 (NRAS_c.38G>T_p.G13V), SEQ ID NO: 51 (NRAS_c.38G>A_p.G13D), SEQ ID NO: 53 (NRAS_c.38G>C_p.G13A), SEQ ID NO: 55 (NRAS_c.180_181delinsTA), SEQ ID NO: 57 (NRAS_c.181_183delinsAAG), SEQ ID NO: 59 (BRAF_c.SEQ ID NO: 61 (BRAF_c.1798G>ApV600M), SEQ ID NO: 63 (BRAF_c.1799_1800delisAT_p.V600D), SEQ ID NO: 65 (BRAF_c.1798_1799delisCG_p.V600R), SEQ ID NO: 67 (BRAF_c.1798_1799delisAA_p.V600K), SEQ ID NO: 69 (BRAF_c.1799_1800delisAA_p.V600E), and SEQ ID NO: 71 (BRAF_c.1799T>ApV600E); and among them. 2） a) The first strand of the second nucleic acid molecule i) A sequence that is completely complementary to an isolength portion of the mRNA containing a functional gain variant encoding BRAF and a sequence having at least 90% identity with the sequence; ii) Composed of 20 to 25 linked nucleosides; iii) Composed of 21 linked nucleosides; or iv) A sequence that is completely complementary to the isolength portion of the mRNA encoding the variants BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E); b) The second nucleic acid molecule is a single-stranded nucleic acid molecule; c) The second nucleic acid molecule is a double-stranded nucleic acid molecule; optionally, wherein the double-stranded nucleic acid molecule comprises a second strand consisting of 10 to 50 linked nucleosides, wherein the second strand is at least partially complementary to the first strand; optionally x) wherein the second chain is at least 95% complementary to the first chain; y) having a protruding end composed of one, two, three, four, five or more nucleotides at both the 5' and 3' ends of the first chain; and / or z) The first chain has overhangs at both the 5' and 3' ends, each consisting of two nucleotides, optionally wherein the overhangs comprise two thymine nucleotides (TT); and / or d) The second nucleic acid molecule specifically targets DNA sequences selected from the list consisting of: SEQ ID NO: 7 (NRAS_c.178G>C_p.G60R), SEQ ID NO: 9 (NRAS_c.179G>T_p.G60V), SEQ ID NO: 11 (NRAS_c.179G>A_p.G60E), SEQ ID NO: 13 (NRAS_c.181C>A_p.Q61K), SEQ ID NO: 15 (NRAS_c.182A>G_p.Q61R), SEQ ID NO: 17 (NRAS_c.182A>T_p.Q61L), SEQ ID NO: 19 (NRAS_c.182A>C_p.Q61P), SEQ ID NO: 21 (NRAS_c.183A>C_p.Q61H), SEQ ID NO: 23 (NRAS_c.183A>T_p.Q61H), SEQ ID NO: 25 (NRAS_c.35G>T_p.G12V), SEQ ID NO: 27 (NRAS_c.34G>C_p.G12R), SEQ ID NO: 29 (NRAS_c.35G>A_p.G12D), SEQ ID NO: 31 (NRAS_c.34G>A_p.G12S), SEQ ID NO: 33 (NRAS_c.34_35G>C_ p.G12P), SEQ ID NO: 35 (NRAS_c.34G>T_p.G12C), SEQ ID NO: 37 (NRAS_c.35G>C_p.G12A), SEQ ID NO: 39 (NRAS_c.37G>A_p.G13S), SEQ ID NO: 41 (NRAS_c.37G>T_p.G13C), SEQ ID NO: 43 (NRAS_c.37G>C_p.G13R), SEQ ID NO: 45 (NRAS_c.37_38delinsTT_ p.G13F), SEQ ID NO: 47 (NRAS_c.37_38delinsTA_ p.G13Y), SEQ ID NO: 49 (NRAS_c.38G>T_p.G13V), SEQ ID NO: 51 (NRAS_c.38G>A_p.G13D), SEQ ID NO: 53 (NRAS_c.38G>C_p.G13A), SEQ ID NO: 55 (NRAS_c.180_181delinsTA), SEQ ID NO: 57 (NRAS_c.181_183delinsAAG), SEQ ID NO: 59 (BRAF_c.1799T>G.p.V600G), SEQ ID NO: 61 (BRAF_c.1798G>A.p.V600M), SEQ ID NO: 63 (BRAF_c.1799_1800delisAT_p.V600D), SEQ ID NO: 65 (BRAF_c.1798_1799delisCG_p.V600R), SEQ ID NO: 67 (BRAF_c.1798_1799delisAA_p.V600K), SEQ ID NO: 69 (BRAF_c.1799_1800delisAA_p.V600E) and SEQ ID NO: 71 (BRAF_c.1799T>A.p.V600E).

3. The composition according to any one of the preceding claims, wherein: (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion encoding a variant NRAS, wherein the variant NRAS contains mutations relative to the wild-type NRAS at positions Q61, G60, G12, and / or G13, and (b) The first strand of the second nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding the variant BRAF, wherein the variant BRAF contains a mutation at position V600 relative to the wild-type BRAF.

4. The composition according to any one of the preceding claims, wherein: (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion encoding a variant NRAS, wherein the variant NRAS contains a mutation at position Q61 relative to the wild-type NRAS, and (b) The first strand of the second nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an equal-length portion of the mRNA encoding the variant BRAF, wherein the variant BRAF contains a mutation at position V600 relative to the wild-type BRAF.

5. The composition according to any one of claims 1 to 4, wherein: (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variants NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P), and (b) The first strand of the second nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variants BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E).

6. The composition according to any one of claims 1 to 4, wherein: (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion encoding the mRNA of variants NRAS p.(G60R), p.(G60V), p.(G60E), or p.(G60D), and (b) The first strand of the second nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variants BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E).

7. The composition according to any one of claims 1 to 4, wherein: (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variants NRAS p.(G12R), p.(G12S), p.(G12D), p.(G12P), p.(G12C), p.(G12A), or p.(G12V), and (b) The first strand of the second nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variants BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E).

8. The composition according to any one of claims 1 to 4, wherein: (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variants NRAS p.(G13V), p.(G13D), p.(G13A), p.(G13S), p.(G13C), p.(G13R), p.(G13F), or p.(G13Y), and (b) The first strand of the second nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variants BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E).

9. The composition according to any one of claims 1 to 5, wherein: (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variants NRAS p.(Q61K), p.(Q61R), p.(Q61H), p.(Q61L), or p.(Q61P), and (b) The first strand of the second nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variant BRAF p. (V600E).

10. The composition according to any one of claims 1 to 5, wherein: (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion encoding the mRNA of the NRAS p.(Q61K) variant, and (b) The first strand of the second nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variants BRAF p.(V600G), p.(V600M), p.(V600D), p.(V600R), p.(V600K), or p.(V600E).

11. The composition according to any one of claims 1 to 5, wherein: (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion encoding the mRNA of the NRAS p.(Q61K) variant, and (b) The first strand of the second nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of the mRNA encoding variant BRAF p. (V600E).

12. The composition according to any one of claims 1 to 5 or 11, wherein: (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion encoding the mRNA of the NRAS p.(Q61K) variant, and (b) The first strand of the second nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of the mRNA encoding variant BRAF p. (V600E).

13. The composition according to any one of claims 1 to 4, 11 or 12, wherein: (a) The first strand of the first nucleic acid molecule contains a sequence that is completely complementary to a sequence having 100% identity with the same length portion encoding the mRNA of the variant NRAS p.(Q61K), and (b) The first strand of the second nucleic acid molecule contains a sequence that is completely complementary to a sequence having at least 100% identity with an isolength portion of the mRNA encoding variant BRAF p. (V600E).

14. The composition according to any one of claims 1 to 5 or 9 to 13, wherein the variant NRAS p.(Q61K) is caused by a c.C181A mutation in the NRAS genome sequence.

15. The composition according to any one of claims 1 to 5 or 9 to 14, wherein the first strand of the first nucleic acid molecule comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 206-224.

16. The composition according to any one of claims 1 to 5 or 9 to 15, wherein the first strand of the first nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO: 206-224.

17. The composition according to any one of claims 1 to 5 or 9 to 16, wherein the first strand of the first nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO: 206-224.

18. The composition according to any one of claims 1 to 17, wherein the variant BRAF p.(V600E) is caused by the c.1799_1800delisAA mutation in the BRAF genome sequence.

19. The composition according to any one of claims 1 to 18, wherein the first strand of the second nucleic acid molecule comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1287-1306.

20. The composition according to any one of claims 1 to 19, wherein the first strand of the second nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO: 1287-1306.

21. The composition according to any one of claims 1 to 20, wherein the first strand of the second nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO: 1287-1306.

22. The composition according to any one of claims 1 to 17, wherein the variant BRAF p.(V600E) is caused by a c.T1799A mutation in the BRAF genome sequence.

23. The composition according to any one of claims 1 to 17 or 22, wherein the first strand of the second nucleic acid molecule comprises a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NO: 1326-1344.

24. The composition according to any one of claims 1 to 17, 22 or 23, wherein the first strand of the second nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO: 1326-1344.

25. The composition according to any one of claims 1 to 17 or 22 to 24, wherein the first strand of the second nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO: 1326-1344.

26. The composition according to any one of claims 1 to 5 or 9 to 25, wherein the first strand of the first nucleic acid molecule comprises a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence shown in SEQ ID NO:

213.

27. The composition according to any one of claims 1 to 17 or 22 to 26, wherein the first strand of the second nucleic acid molecule comprises a sequence having at least 80%, at least 90%, or at least 95% identity with the sequence shown in SEQ ID NO: 1334.

28. The composition according to any one of claims 1 to 5, 9 to 17, or 22 to 27, wherein the first strand of the first nucleic acid molecule comprises a sequence having at least 95% identity with the sequence shown in SEQ ID NO: 213, and wherein the first strand of the second nucleic acid molecule comprises a sequence having at least 95% identity with the sequence shown in SEQ ID NO: 1334.

29. The composition according to any one of claims 1 to 5, or 9 to 17, or 22 to 28, wherein the first strand of the first nucleic acid molecule comprises the sequence shown in SEQ ID NO: 213, and wherein the first strand of the second nucleic acid molecule comprises the sequence shown in SEQ ID NO: 1334.

30. The composition according to any one of claims 1 to 29, comprising at least two nucleic acid molecules targeting different NRAS alleles.

31. The composition according to any one of claims 1 to 30, comprising at least three nucleic acid molecules targeting variants of NRAS, wherein the at least three nucleic acid molecules targeting variants of NRAS target different NRAS alleles.

32. A pharmaceutical composition comprising the composition according to any one of claims 1 to 31 and a pharmaceutically acceptable excipient.

33. A method for treating an acquired nevus in a subject, the method comprising administering to the subject a therapeutically effective amount of the composition according to any one of claims 1 to 31 or the pharmaceutical composition according to claim 32.

34. A method for treating an acquired nevus in a subject, the method comprising administering to the subject a combination of a first nucleic acid molecule and a second nucleic acid molecule, wherein the administration occurs simultaneously or sequentially in any order. The first nucleic acid molecule is defined as any one of claims 1 to 5 or 9 to 17, and the second nucleic acid molecule is defined as any one of claims 1 to 31.

35. A method for preventing melanoma in a subject, the method comprising administering to the subject a therapeutically effective amount of the composition according to any one of claims 1 to 31 or the pharmaceutical composition according to claim 30.

36. The composition according to any one of claims 1 to 31 or the pharmaceutical composition according to claim 30, used in a method of treating an acquired nevus in a subject.

37. The composition according to any one of claims 1 to 31 or the pharmaceutical composition according to claim 30, used in a method for preventing melanoma in a subject.

38. Use of a composition according to any one of claims 1 to 31 or a pharmaceutical composition according to claim 30 for reducing or removing acquired nevi.

39. A cosmetic method for reducing or removing acquired nevi in ​​a subject, the method comprising administering to the subject a composition according to any one of claims 1 to 31.

Images