Use of nitrooleic acid for the preparation of a medicament for the treatment of age-related muscle dysfunction

Abstract

This invention belongs to the field of biomedical technology, specifically relating to the application of nitrooleic acid in the preparation of drugs for treating age-related muscle dysfunction. Experiments have demonstrated that nitrooleic acid can significantly improve skeletal muscle morphology and function in mouse models of cardiotoxin-induced muscle atrophy and naturally aging mice, enhancing muscle strength, exercise endurance, and anti-fatigue ability. Simultaneously, it can downregulate the expression of aging markers p16 and p21, as well as SASP inflammatory factors TNF-α and IL-6 in muscle tissue, inhibit muscle atrophy-related genes Trim63 and Fbxo32, upregulate the muscle stem cell marker gene Pax7, and improve oxidative stress, thereby achieving effective intervention for age-related muscle dysfunction. This invention provides a safe, efficient, and highly compliant new drug option for the clinical treatment of sarcopenia, possessing significant application value and market prospects.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of nitrooleic acid in the preparation of drugs for treating age-related muscle dysfunction. Background Technology

[0002] Sarcopenia, also known as skeletal muscle aging or sarcopenia, is characterized by age-related decline in muscle mass, strength, and mobility, and is a significant cause of frailty and disability in the elderly. During natural aging, muscle tissue exhibits significant cellular senescence, age-associated secretory phenotype (SASP) chronic inflammation, excessive protein degradation, and depletion of muscle stem cell function: the accumulation of senescent cells leads to a significant increase in aging markers such as p16 and p21, and the release of large amounts of SASP pro-inflammatory factors (TNF-α, IL-6) from senescent cells induces chronic muscle inflammation; abnormally high expression of key muscle atrophy genes Trim63 and Fbxo32 leads to excessive muscle protein degradation; simultaneously, the decrease in the muscle stem cell marker Pax7 significantly weakens muscle repair and regeneration capacity, collectively resulting in muscle fiber atrophy and muscle weakness.

[0003] Currently, treatment options for sarcopenia are limited, primarily relying on physical therapy, nutritional supplements, and limited medication. For example, Chinese patent CN114680339A discloses a nutritional supplement designed to improve muscle loss and delay aging, rich in easily absorbed amino acids, peptides, and high-quality protein, along with various vitamins and minerals. This supplement includes a nutrient mixture, fermented pea protein peptide powder, corn oligopeptide powder, vitamin K2, and a soy milk powder composition, which can significantly improve walking speed in the elderly (an important indicator of muscle function decline and aging). Chinese patent CN117899181A discloses a traditional Chinese medicine composition for preventing and treating sarcopenia, its preparation method, and its uses. The raw materials of this composition include 9-11 parts of dried tangerine peel, 9-11 parts of Achyranthes bidentata, 9-11 parts of malt, 9-11 parts of Drynaria fortunei, 9-11 parts of Eucommia ulmoides, 9-11 parts of Lycium barbarum, 13.5-16.5 parts of Astragalus membranaceus, and 13.5-16.5 parts of Cibotium barometz. The traditional Chinese medicine composition of this invention can improve muscle strength, muscle mass, and muscle function, reduce body fat, and delay the aging process, without significantly affecting food intake, indicating that this traditional Chinese medicine composition can be used as a drug for treating sarcopenia. However, physical therapy and nutritional supplementation require long-term adherence, resulting in poor compliance, and long-term nutritional supplementation may increase the burden on the kidneys of the elderly; growth hormone and other drug treatments have significant side effects, and their long-term safety and efficacy still need further verification. Clinically, there is an urgent need for new therapeutic drugs that are safe, effective, and have high compliance.

[0004] Nitrooleic acid (NO2-OA) is an endogenous electrophilic nitro fatty acid, mainly produced in the acidic environment of the stomach through a non-enzymatic reaction between nitrates and dietary unsaturated fatty acids. It is widely present in human blood plasma, urine, and various tissues, but no research has yet shown that it can improve age-related muscle dysfunction or treat sarcopenia. Meanwhile, older adults commonly experience insufficient gastric acid secretion, slow postprandial pH recovery in the stomach, and a weaker acidic environment in the stomach, leading to a significant reduction in endogenous nitrooleic acid production, further exacerbating age-related muscle dysfunction. Therefore, the focus of this invention is to explore whether nitrooleic acid supplementation can be used as a treatment for age-related muscle dysfunction. Summary of the Invention

[0005] The technical problem this invention aims to solve is the current lack of treatment options for sarcopenia, which mainly rely on physical therapy, nutritional supplementation, and a small amount of drug therapy. However, physical therapy and nutritional supplementation require long-term adherence, resulting in poor compliance, and long-term nutritional supplementation may increase the burden on the kidneys of the elderly. Drug therapy such as growth hormone has obvious side effects, and its long-term safety and effectiveness still need further verification. There is an urgent clinical need for new therapeutic drugs that are safe, effective, and have high compliance.

[0006] To address the aforementioned issues, this invention has discovered that nitrooleic acid possesses a series of effects on muscle aging, including reducing the expression of muscle tissue aging markers p16 and p21, inhibiting the release of SASP-related inflammatory factors (TNF-α, IL-6), downregulating key muscle atrophy genes Trim63 and Fbxo32, upregulating the muscle stem cell marker Pax7, improving oxidative stress (reducing LPO levels and increasing CAT and GSH levels), and improving skeletal muscle structure and function. Nitrooleic acid can significantly inhibit muscle cell aging, alleviate SASP-mediated chronic inflammation, reduce excessive muscle protein degradation, and protect muscle stem cell function. In naturally aging mouse animal experiments, nitrooleic acid significantly improved skeletal muscle morphology, skeletal muscle function, and motor ability, demonstrating a significant effect on improving age-related muscle dysfunction. This provides a safe, simple, and effective new approach for the treatment of sarcopenia.

[0007] To achieve the above objectives, this invention specifically implements the following technical solution: the application of nitrooleic acid in the preparation of drugs for treating age-related muscle dysfunction. Nitrooleic acid possesses multiple important biological activities: it exerts a potent anti-inflammatory effect, enhances the body's antioxidant capacity, and simultaneously inhibits the expression of muscle atrophy-related genes, reduces muscle protein degradation, and improves tissue metabolism and functional damage. Its mechanism may be related to nitrooleic acid's ability to reduce muscle tissue aging levels, inhibit SASP inflammatory responses, inhibit abnormally high expression of Trim63 and Fbxo32, protect muscle stem cells, and improve oxidative stress. Increased cellular senescence, elevated SASP inflammatory levels, abnormal muscle protein degradation, and decreased muscle regeneration capacity are the core causes of muscle atrophy; improving these pathological processes is key to delaying age-related muscle dysfunction. This invention suggests that nitrooleic acid not only improves the aging phenotype in mice but also directly improves muscle function and reduces symptoms. This discovery adds a new possibility to the current lack of effective treatments for sarcopenia. Furthermore, compared to some drug treatments, the application of nitrooleic acid to treat age-related muscle dysfunction has higher safety and fewer side effects. Secondly, compared to long-term physical therapy and nutritional supplementation, it is simpler and easier to implement, making it more acceptable and easier for patients to accept and follow the treatment plan. Therefore, this invention provides the use of nitrooleic acid in the preparation of medicaments for treating age-related muscle dysfunction.

[0008] The above treatment refers to interventions taken after the onset of symptoms or diseases to eliminate or control them.

[0009] Furthermore, the age-related muscle dysfunction leading to this condition is sarcopenia.

[0010] Furthermore, the drug treats age-related muscle dysfunction by improving skeletal muscle morphology, skeletal muscle function, and / or the body's motor capacity.

[0011] Furthermore, the drug treats age-related muscle dysfunction by reducing muscle tissue aging levels, inhibiting the release of SASP-related inflammatory factors, alleviating inflammatory responses, inhibiting the expression of atrophy genes Trim63 and Fbxo32, upregulating the muscle stem cell marker Pax7, reducing myoprotein degradation, promoting muscle repair and regeneration, and improving oxidative stress (reducing LPO levels and increasing CAT and GSH levels), thereby directly improving muscle function. Individually regulating any of these mechanisms can only produce partial improvements and is insufficient to fully address age-related muscle damage. This invention, by simultaneously regulating multiple pathways such as the inflammatory microenvironment, myoprotein homeostasis, muscle stem cell activity, and the body's oxidative stress levels, achieves synergistic effects through multiple mechanisms, effectively realizing the overall treatment and functional repair of sarcopenia.

[0012] Furthermore, the effective dose of nitrooleic acid in the drug is not less than 15 mg / Kg.

[0013] Furthermore, the drug also contains pharmaceutically acceptable excipients.

[0014] Preferably, the excipients are selected from one or more of the following: excipients, diluents, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, or preservatives.

[0015] Furthermore, the dosage form of the drug is any one of injection, oral liquid, capsule, tablet or granule.

[0016] Preferably, the drug dosage form is an injection.

[0017] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention first proposes and confirms that nitrooleic acid can be used to treat muscle function decline related to natural aging. It can significantly reduce the expression of muscle tissue aging markers p16 and p21, inhibit the release of SASP-related pro-inflammatory factors TNF-α and IL-6, alleviate chronic inflammation, inhibit the abnormal high expression of muscle atrophy genes Trim63 and Fbxo32, and upregulate muscle stem cell marker Pax7, reduce the LPO content in muscle tissue, and increase the levels of CAT and GSH. It plays a role in inhibiting cell aging, blocking SASP inflammation, reducing protein degradation, protecting muscle regeneration, and improving oxidative stress through multiple pathway synergistic effects. The efficacy is clear and the mechanism is well understood.

[0018] (2) Nitrooleic acid is an endogenous active substance with high safety, few side effects, simple administration method, and high patient compliance, overcoming the shortcomings of poor compliance with existing physical therapy and nutritional supplementation, as well as the insufficient safety of traditional drugs. This invention provides a brand-new drug option for the clinical treatment of sarcopenia, and has important application value and broad development prospects. Attached Figure Description

[0019] Figure 1 Effects of nitrooleic acid on muscle behavior in CTX-induced muscle attenuation in mice. *** indicates P < 0.001 (highly significant), **** indicates P < 0.0001 (highly significant).

[0020] Figure 2 Effects of nitrooleic acid on muscle behavior in naturally aging mice with muscle atrophy. **** indicates P < 0.0001, meaning the difference is highly significant.

[0021] Figure 3 Effect of nitrooleic acid on the cross-sectional area of ​​muscle fibers in naturally aging mice. **** indicates P < 0.0001, meaning the difference is highly significant.

[0022] Figure 4 Comparison of HE staining of cross-sections of mouse gastrocnemius and tibialis anterior muscles with nitrooleic acid.

[0023] Figure 5 The effect of nitrooleic acid on muscle aging marker genes. * indicates P < 0.05, significant difference; ** indicates P < 0.01, highly significant difference; **** indicates P < 0.0001, extremely highly significant difference.

[0024] Figure 6 Effects of nitrooleic acid on muscle oxidative stress indices. Where ** indicates P < 0.01 (extremely significant), *** indicates P < 0.001 (highly significant), and **** indicates P < 0.0001 (highly significant). Detailed Implementation

[0025] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following embodiments are commercially available.

[0026] Nitrooleic acid (NO2-OA) was synthesized in the laboratory using oleic acid as a raw material and nitrotetrafluoroborate as a nitrating reagent via electrophilic nitration. Oleic acid was purchased from Maclean Biochemical Technology Co., Ltd. (batch number: C17268894), nitrotetrafluoroborate from Sigma Chemical Company (batch number: MKCT6843), and dichloromethane from Sinopharm Chemical Reagent Co., Ltd. (batch number: 20250721). The synthesis and purification method was as follows: A certain mass of oleic acid was weighed and added to dichloromethane at a mass-to-volume ratio of 1:10 (g:mL), stirred until completely dissolved and mixed evenly; nitrotetrafluoroborate was added at a molar ratio of 1:2, and the mixture was placed in a light-protected container and stirred vigorously at room temperature for 2 h to complete the nitration reaction. After the reaction was complete, ultrapure water was added to the centrifuge tube containing the reaction sample until it was 1 mL below the maximum mark. The tube was then capped and vortexed for 1 min. The tube was then centrifuged at 4 °C and 3000 r / min for 15 min, and the organic layer was carefully extracted. This centrifugation-extraction process was repeated 5 times, and the organic phases were combined. The organic phase was dried using a nitrogen evaporator to obtain a preliminarily purified sample. The sample was then purified by silica gel column chromatography using hexane / diethyl ether / acetic acid as the elution solvent, with a gradient elution ratio of 110:10:0.5 → 110:15:0.5 → 110:20:0.5. The elution flow rate was the standard column chromatography flow rate of 2. mL / min; preliminary thin-layer chromatography (TLC) experiments confirmed that the 110:10:0.5 interval eluted weakly polar impurities, the 110:15:0.5 to 110:20:0.5 interval was the main nitrooleic acid fraction, and the fractions after 110:20:0.5 were strongly polar impurities; only the nitrooleic acid target fraction within the 110:15:0.5 to 110:20:0.5 interval was collected, and the impurity segments before and after were discarded; the nitrooleic acid target fractions were combined, and the eluent was removed by rotary evaporation under reduced pressure, finally obtaining purified nitrooleic acid, which was stored at -20℃ for subsequent pharmacological function experiments.

[0027] Example 1: In vivo experiment of CTX (cardiotoxin) mouse model.

[0028] 1. Experimental Materials and Methods: (1) Experimental animals: SPF-grade male C57BL / 6J mice, 8 weeks old, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The mice were housed in the SPF-grade enclosure of the Laboratory Animal Center of Ocean University of China. The ambient temperature was 22-26℃, the relative humidity was 40%-60%, and the circadian rhythm was 12h light / 12h darkness. They had free access to food and water and were acclimatized for one week before the start of the experiment. The experimental process strictly followed the "Guidelines for Ethical Review of Laboratory Animals" and was approved by the Laboratory Animal Ethics Committee of Ocean University of China.

[0029] (2) CTX (cardiotoxin)-induced mouse muscle injury model: Under sterile conditions, cardiotoxin (CTX) powder was dissolved in sterile physiological saline to prepare a 500 μmol / L stock solution, which was then aliquoted and stored at -20℃. Before use, the solution was diluted to 10 μmol / L, and 50 μL was injected into the anterior tibialis muscle of mice. After respiratory anesthesia, the hind limb hair was removed and the mice were disinfected. The drug solution was injected parallel to the muscle belly using a 30 G needle. After confirming that there was no blood return, the injection was slow. The mice were fed routinely for 1 day after the operation, and then the drug was administered again. The drug was administered continuously for 1 month before testing.

[0030] (3) Behavioral experiments: Grip strength test: The grip strength of the forelimbs of mice was measured using a precision electronic force gauge. A thin horizontal bar was fixed to the front end of the horizontally placed force gauge. The mouse's forelimbs were allowed to grip the horizontal bar tightly. The mouse's tail was gently pulled backward to make its forelimbs detach from the horizontal bar. The pulling force value at the moment the forelimbs detached was recorded simultaneously. Each mouse was measured 3 times, and the maximum pulling force was taken as the final grip strength value. Suspension test: A metal mesh with a length of 30cm, a width of 20cm, and a wire diameter of 1.4mm was placed above an acrylic box 40cm from the bottom. The mouse was placed on the metal mesh. After it gripped firmly, the metal mesh was inverted so that the mouse was suspended under the mesh. The duration from suspension to fatigue and fall was recorded. Spinning rod fatigue test: 1-3 days before the experiment, the mice were placed on a low-speed spinning rod at 10rpm for 15 minutes for adaptive training. During the formal experiment, the mice were placed on a spinning rod fatigue test track at 25rpm and made to run continuously on the spinning rod. The time of the mouse's first fall was recorded, which is the spinning rod latency period. Running endurance test: The mouse's exercise endurance and fatigue resistance were assessed using a treadmill with a rotating wheel. Three adaptive training sessions were conducted before the formal test. During the formal test, the mouse was placed on the track and made to run. When the mouse became fatigued and stopped running, remained at the bottom of the wheel and received electrical stimulation, it was considered to be exhausted if it fell three times within 15 minutes, and the test was terminated. The treadmill speed was set to 30 rpm, the electric shock tolerance time was 2 seconds, and the rest interval was 45 seconds.

[0031] 2. Experimental Results: like Figure 1 As shown, compared with the normal mouse group, the CTX model group mice showed obvious muscle function impairment, with significant decreases in grip strength, running endurance, suspension time, rotarod latency, and motor coordination (P<0.05). This indicates that CTX-induced muscle damage led to a significant decline in muscle strength, exercise endurance, and fatigue resistance in mice. However, after intervention with nitrooleic acid, all of the above behavioral indicators in mice were significantly improved compared with the CTX model group (P<0.05). This suggests that nitrooleic acid can effectively promote the recovery of muscle function after injury, improve muscle strength and exercise endurance, and alleviate the decline in motor ability related to CTX-induced muscle damage, providing a new approach for the treatment of sarcopenia.

[0032] Example 2: In vivo experiment in naturally aging mice.

[0033] 1. Experimental Materials and Methods: (1) Experimental animals: SPF-grade male C57BL / 6J mice, 8 weeks old, weighing 20-22g, and 20 months old, weighing 35-45g, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The mice were housed in the SPF-grade enclosure of the Laboratory Animal Center of Ocean University of China, with an ambient temperature of 22-26℃, relative humidity of 40%-60%, a circadian rhythm of 12h light / 12h darkness, and free access to food and water. The experiments began after one week of acclimatization. The experimental procedures strictly followed the "Guidelines for Ethical Review of Laboratory Animals" and were approved by the Laboratory Animal Ethics Committee of Ocean University of China.

[0034] (2) Behavioral experiments: Grip strength test: The grip strength of the mouse forelimbs was measured using a precision electronic force gauge. A thin horizontal bar was fixed to the front end of the horizontally placed force gauge. The mouse was allowed to grip the horizontal bar tightly with its forelimbs. The mouse tail was gently pulled backward to make the forelimbs detach from the horizontal bar. The pulling force value at the moment the forelimbs detached was recorded simultaneously. Each mouse was tested 3 times, and the maximum pulling force was taken as the final grip strength value. Suspension experiment: A metal mesh with a length of 30cm, a width of 20cm, and a wire diameter of 1.4mm was placed above an acrylic box 40cm from the bottom. The mouse was placed on the metal mesh. After it gripped the mesh firmly, the metal mesh was inverted so that the mouse was suspended below the mesh. The duration from the time the mouse was suspended until it fell due to fatigue was recorded. Rotary bar fatigue test: 1-3 days before the experiment, mice were placed on a low-speed 10rpm rotary bar for 15 minutes for acclimatization training. During the formal experiment, mice were placed on a rotary bar fatigue test track with a rotation speed of 25rpm and made to run continuously on the rotary bar. The time of the mouse's first fall was recorded as the rotary bar latency period. Running endurance test: A mouse treadmill with a rotating wheel was used to assess exercise endurance and fatigue resistance. Three acclimatization training sessions were conducted before the formal test. During the formal experiment, mice were placed on the track and made to run. When a mouse became fatigued and stopped running, remained at the bottom of the rotating wheel, and received electrical stimulation, falling three times within 15 minutes was considered exhaustion, and the experiment was terminated. The treadmill speed was set to 30rpm, the electric shock tolerance time was 2s, and the rest interval was 45s.

[0035] (3) H&E staining and statistical analysis of muscle fiber cross-sectional area (CSA): Fresh muscle tissue was fixed in 4% paraformaldehyde for 24 hours and then dehydrated with graded alcohols. The tissue was embedded in paraffin blocks. The embedded tissue was cut into 4µm thick tissue sections. After dewaxing, the nuclei were stained with hematoxylin and the cytoplasm was stained with eosin. After staining, the sections were dehydrated, sealed, and dried to obtain image information. The sections were then scanned using a panoramic scanner (3D HISTECH, Hungary) to obtain high-resolution images for observation and analysis. The average CSA area was calculated using ImageJ. Three fields of view were selected for each section, and the area of ​​80-90 muscle fibers was counted in each field of view.

[0036] (4) RNA extraction and quantitative real-time PCR (qPCR): Total RNA was extracted and isolated using an animal total RNA rapid extraction kit (Shanghai Sangon Biotech, China). The purity and concentration of RNA were determined using a Nano-Drop system (Thermo Fisher Scientific, USA). 1 μg of total RNA was reverse transcribed into cDNA using a 5X All-In-One RT MasterMix (abm, Canada). Real-time quantitative PCR was performed using a 2× Universal Blue SYBR Green qPCR Master Mix (Saiwell, China). The qPCR procedure was as follows: incubation at 50°C for 2 minutes, followed by incubation at 95°C for 10 minutes. PCR was performed at 95°C for 15 seconds, followed by incubation at 60°C for 1 minute, for a total of 40 cycles. During the melting curve phase, the incubation was at 95°C for 15 seconds, at 60°C for 1 minute, and at 95°C for 15 seconds. Gene expression in each sample was then analyzed using a QuantStudio™ 6 Pro Real-Time PCR system (Thermo Fisher Scientific, USA). Using GAPDH as an internal reference. Utilizing 2 -ΔΔCT The formula was used to calculate the relative expression levels of each gene. PCR primers are shown in Table 1.

[0037] Table 1: PCR primers: Mouse Fbxo32 AGTGAGGACCGGCTACTGTG GATCAAACGCTTGCGAATCT Trim63 GTGACCACAGAGGGTAAAGAAGA AGAAGACACACTTCCCTATTGTACC Pax7 TCTCCAAGATTCTGTGCCGAT CGGGGTTCTCTCTCTTATACTCC MYHC TTGAAAAGACGAAGCAGCGAC AGAGAGCGGGACTCCTTCTG MYOG TTGCTCAGCTCCCTCAACCAGGA TGCAGATTGTGGGCGTCTGTAGG P16 CGCAGGTTCTTGGTCACTGT TGTTCACGAAAGCCAGAGCG P21 AGATCCACAGCGATATCCAGAC ACCGAAGAGACAACGGCACACT GAPDH AGCTTGTCATCAACGGGAAG TTTGATGTTAGTGGGGTCTCG TNF-α GAGCACAGAAAGCATGATCCG TAGACAGAAGAGCGTGGTGG IL-6 CTTCTTGGGACTGATGCTGGTGAC AGGTCTGTTGGGAGTGGTATCCTC .

[0038] (5) Determination of LPO, CAT, and GSH content / activity in muscle tissue (using commercially available reagent kits).

[0039] The remaining tissue of the left gastrocnemius muscle of mice (approximately 50 mg) was added to pre-cooled physiological saline to prepare a muscle tissue homogenate at a mass-to-volume ratio of 1:9 (g / mL). The homogenate was centrifuged at 3000 rpm for 10 min at 4°C, and the supernatant was collected and stored on ice. The LPO content, CAT activity, and GSH content in the homogenate supernatant were determined strictly according to the instructions of the commercially available kit. ① LPO content determination: The lipid peroxidation (LPO) detection kit was used to determine the LPO content by colorimetric method. The reagents were added according to the kit requirements, mixed well, and incubated at 37℃ for 30 min. The absorbance value was measured at a wavelength of 532 nm. The LPO content in muscle tissue was calculated according to the standard curve. ② CAT activity assay: The catalase (CAT) activity assay kit was used to determine the activity of CAT in muscle tissue by colorimetric method. The reagents were added according to the kit instructions, mixed well, and incubated at 25°C for 10 min. The reaction was terminated by adding the stop solution, and the absorbance value was measured at a wavelength of 405 nm. The activity of CAT in muscle tissue was calculated according to the standard curve. ③ GSH content determination: The glutathione (GSH) content was determined by colorimetric method using a glutathione (GSH) assay kit. The reagents were added according to the kit requirements, mixed well, and incubated at 37°C for 15 min. The absorbance value was measured at a wavelength of 412 nm. The GSH content in muscle tissue was calculated based on the standard curve.

[0040] (6) Statistical analysis: All data are expressed as mean ± SD. Graph Pad Prism 10.0 software (Graph Pad Prism software, La Jolla, CA, USA) was used. Unpaired t-tests were used to analyze significant differences between two groups, and one-way ANOVA was used to analyze significant differences among multiple groups. P < 0.05 was considered statistically significant.

[0041] 2. Experimental Results: Compared with the young mouse group, the naturally aged control group mice showed significant muscle function decline and abnormal related indicators, such as Figure 2 As shown, the grip strength, running endurance, suspension time, rotarod latency, and motor coordination of naturally aging mice were all significantly decreased (P<0.05), indicating a significant decline in muscle strength, exercise endurance, and fatigue resistance. In contrast, the behavioral indicators of mice treated with nitrooleic acid were significantly improved compared to the aging control group (P<0.05), gradually approaching the levels of younger mice. Simultaneously, abnormal changes occurred in the cross-sectional area of ​​the tibialis anterior and gastrocnemius muscle fibers in naturally aging mice (P<0.05), such as... Figure 3 , Figure 4As shown, natural aging leads to significant abnormalities in mouse muscle fibers, with a marked reduction in cross-sectional area. Nitrooleic acid can effectively regulate and improve muscle fiber morphology. H&E-stained sections reveal that the naturally aging control group exhibited significant muscle fiber atrophy and disordered arrangement, while the nitrooleic acid intervention group showed significant improvement in muscle fiber morphology, with a more regular arrangement, effectively protecting the integrity of skeletal muscle structure. Furthermore, as... Figure 5 As shown, natural aging significantly upregulates the expression of aging marker genes p16 and p21, while nitrooleic acid effectively downregulates their expression, thereby inhibiting the aging of muscle tissue cells and reducing the accumulation of senescent cells. Simultaneously, senescent cells release large amounts of SASP inflammatory factors TNF-α and IL-6, inducing chronic muscle inflammation. Nitrooleic acid can significantly inhibit the expression of these pro-inflammatory factors, blocking SASP-mediated inflammatory damage and creating a favorable microenvironment for muscle repair. Secondly, the expression of muscle atrophy-related genes Trim63 and Fbxo32 is significantly increased in naturally aging mice. These two genes are key to controlling muscle protein degradation; their abnormally high expression leads to excessive muscle protein degradation and muscle fiber atrophy. Nitrooleic acid can effectively inhibit the expression of these two genes, reducing muscle protein loss and thus slowing down the muscle atrophy process. Finally, Pax7, as a marker gene for muscle stem cells, is crucial for maintaining muscle stem cell function and promoting muscle repair and regeneration. Natural aging leads to a decrease in its expression, weakening muscle regeneration capacity. Nitrooleic acid can significantly upregulate its expression, protecting muscle stem cell function and aiding in muscle fiber repair and regeneration, thus regulating muscle aging and atrophy at the molecular level. In addition, the oxidative stress indicators of naturally aging mice also showed significant abnormalities, such as Figure 6 As shown, natural aging increases LPO content and decreases CAT activity and GSH content in mouse muscle tissue. However, nitrooleic acid intervention can significantly reduce LPO content, increase CAT activity and GSH content, effectively improve the oxidative stress state of muscle tissue, and alleviate the adverse effects of oxidative damage on muscle.

[0042] The results above show that nitrooleic acid can effectively improve age-related muscle function decline in naturally aging mice through multiple synergistic mechanisms, such as enhancing muscle motor function, regulating muscle fiber state, protecting skeletal muscle morphology, inhibiting cell senescence and SASP inflammation, regulating related gene expression, and improving oxidative stress. Therefore, it can be used to prepare drugs for the treatment of sarcopenia.

[0043] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.

Claims

1. Application of nitrooleic acid in the preparation of drugs for treating age-related muscle dysfunction.

2. The application as described in claim 1, characterized in that: The age-related muscle dysfunction is referred to as sarcopenia.

3. The application as described in claim 1 or 2, characterized in that: The drug can improve skeletal muscle morphology, increase muscle strength, and enhance exercise endurance, thereby treating age-related muscle dysfunction.

4. The application as described in claim 1 or 2, characterized in that: The drug achieves its therapeutic effects by inhibiting cell senescence, blocking SASP inflammation, reducing chronic inflammation, reducing muscle protein degradation, protecting muscle stem cell function, and improving oxidative stress.

5. The application as described in claim 1 or 2, characterized in that: The drug can reduce the expression levels of aging markers p16 and p21 in muscle tissue; inhibit the expression of aging-related secretory phenotypes SASP pro-inflammatory factors TNF-α and IL-6, thereby alleviating chronic muscle inflammation; inhibit the expression of muscle atrophy-related genes Trim63 and Fbxo32; upregulate the expression of muscle stem cell marker gene Pax7; reduce LPO content in muscle tissue; and increase CAT activity and GSH levels.

6. The application as described in claim 1 or 2, characterized in that: The effective dose of nitrooleic acid in the drug is not less than 15 mg / kg.

7. The application as described in claim 1 or 2, characterized in that: The drug also contains pharmaceutically acceptable excipients selected from one or more of excipients, diluents, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, or preservatives.

8. The application as described in claim 1 or 2, characterized in that: The dosage form of the drug is injection, oral liquid, capsule, tablet or granule.

Images