Application of STK38 phosphokinase in the treatment of sepsis-related acute kidney injury

Abstract

This invention provides the application of phosphokinase STK38 in the treatment of sepsis-related acute kidney injury (S-AKI). For the first time, the protective role of STK38 in sepsis and S-AKI is clearly established, verifying it as a key endogenous protective kinase, and ALDH1B1 is identified as a novel interacting molecule. Further studies show that ALDH1B1 deficiency promotes lipid peroxidation in sepsis-associated HK-2 cells, leading to the accumulation of its product 4-HNE, while MDA remains largely unchanged. Simultaneously, ALDH1B1 deficiency promotes damage and ferroptosis in sepsis-associated HK-2 cells. Therefore, this invention provides a novel strategy for the treatment of S-AKI by targeting the STK38-ALDH1B1-4-HNE axis.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and provides the application of phosphokinase STK38 in the treatment of sepsis-related acute kidney injury, especially the application of the STK38 ~ ALDH1B1 ~ 4-HNE axis as a target in the preparation of drugs for the treatment of sepsis-related acute kidney injury (S-AKI). Background Technology

[0002] Sepsis, a severe and life-threatening multi-organ dysfunction syndrome caused by a dysregulated host response to infection, is currently a leading cause of death in clinical intensive care units (ICUs). Sepsis can affect the kidneys through inflammation, hypoxia, and oxidative stress, leading to tubular and interstitial damage. Therefore, the kidneys are among the most vulnerable target organs in sepsis patients, highly susceptible to acute kidney injury (AKI). Globally, approximately 49 million people develop sepsis each year, and about 60% of these patients develop AKI, with a mortality rate 2-3 times higher than those without AKI. S-AKI not only increases the risk of death in sepsis patients but also exacerbates the healthcare burden of chronic kidney disease (CKD) and end-stage renal disease (ESRD), making it a major global public health problem.

[0003] The pathogenesis of spontaneous aspiration kidney disease (S-AKI) is complex, with microvascular dysfunction, cell death, inflammation, and metabolic reprogramming likely playing roles. Recent studies have revealed a significant association between the death patterns (especially ferroptosis) of renal tubular epithelial cells, a crucial component of kidney tissue (comprising approximately 50% of all kidney cells), and the progression of S-AKI. Ferroptosis, a form of programmed cell death driven by iron-dependent lipid peroxidation, is characterized by abnormal iron metabolism, lipid peroxide accumulation, and altered mitochondrial morphology. Recent research has found a close association between ferroptosis and various kidney diseases, particularly renal tubular epithelial cell ferroptosis, which plays a key role in ischemia-reperfusion injury, cisplatin-induced AKI, and diabetic nephropathy. Renal tubular epithelial cell ferroptosis is also considered one of the major pathogenic events of S-AKI. GPX4 is a core molecule inhibiting ferroptosis, protecting cells from ferroptosis by reducing lipid peroxides to non-toxic lipid alcohols. Its stable expression is crucial for effectively clearing lipid peroxides and inhibiting cellular ferroptosis. Current studies have shown that promoting GPX4 expression can exert an anti-ferroptosis effect and effectively improve S-AKI.

[0004] Serine / threonine kinase 38 (STK38), also known as nuclear Dbf2p-associated kinase 1 (NDR1), is a member of the NDR / LATS kinase family, a subfamily of the serine / threonine kinase AGC group. This family is highly conserved from yeast to humans and is characterized by the presence of an N-terminal regulatory domain (NTR) and an autorepressive sequence (AIS). STK38 possesses phosphokinase activity. Under steady state, STK38 activity remains low due to dephosphorylation of protein phosphatase 2A (PP2A). Its activation is mediated by autophosphorylation of other kinases at Ser281 and phosphorylation at Thr444. Furthermore, transcription factor family member-specific protein 1 (Sp1) is essential for STK38 promoter activity.

[0005] In mammals, STK38 is found in the cytoplasm and nucleus, sharing 86% amino acid identity with its analog STK38L / NDR2, and is highly conserved between humans and mice. STK38 is not essential for individual development, as STK38-deficient mice can still survive and compensate by upregulating STK38L protein levels. STK38 is primarily expressed in the mouse nervous and urogenital systems, regulating centrosome replication, promoting Fas-induced apoptosis, and being activated by oxidative stress. Recently, the phosphokinase STK38 has been identified as a key regulator of cell cycle, growth and development, cell death, and cancer.

[0006] The inventors previously discovered that STK38 mediates phosphorylation of GPX4 and inhibits its degradation, thereby making liver cancer cells resistant to drug-induced ferroptosis. By reviewing the NCBI GEO dataset (accessed via GSE54514, ID: 108617105) and analyzing RNA extracted from whole blood samples of ICU sepsis patients using microarray analysis, we found that in the first 3 days after admission to the ICU, the expression level of STK38 in the whole blood of sepsis-related deaths was consistently lower than that of survivors, suggesting that STK38 expression levels may be correlated with the clinical severity of sepsis. Furthermore, Stk38-deficient mice produced more pro-inflammatory cytokines than wild-type WT mice, were more affected by cecal ligation-puncture (CLP)-induced sepsis, and exhibited worse disease scores, earlier and higher mortality rates after E. coli infection, consistent with our preliminary experimental results, indicating that STK38 plays a protective role in the sepsis process. However, the function of STK38 in S-AKI has not yet been reported.

[0007] Based on this, this invention aims to study the role and mechanism of phosphokinase STK38 in sepsis-associated acute kidney injury and renal tubular epithelial cell ferroptosis, in order to explore new targeted therapy strategies for S-AKI, which has important theoretical significance and potential clinical application value. Summary of the Invention

[0008] This invention addresses the aforementioned problems by providing the effect of STK38 phosphokinase in antagonizing ferroptosis and alleviating sepsis-related acute kidney injury, and based on the research findings, provides its application in the treatment of sepsis-related acute kidney injury.

[0009] The present invention has conducted the following research:

[0010] (1) The protective role of STK38 in sepsis and S-AKI was clarified, and it was verified as a key endogenous protective kinase: Disease correlation analysis of the GSE54514 dataset showed that the expression level of STK38 in the whole blood transcriptome of sepsis ICU patients 3 days before admission was significantly lower than that of survivors; this point was also confirmed in mouse models, where STK38 expression was significantly higher than that in WT mice. - / - CLP modeling in mice exacerbated systemic inflammatory response, decreased renal function, and significantly reduced survival rate.

[0011] (2) By clarifying the relative contribution of STK38 deficiency in renal parenchymal cells and bone marrow-derived immune cells to S-AKI through bone marrow reconstruction, it was found that STK38 deficiency in proximal renal tubular epithelial cells aggravates acute kidney injury in sepsis.

[0012] (3) Confirmation of the effect of STK38 deficiency in proximal renal tubular epithelial cells on aggravating S-AKI and the type of cell death induced: LPS-induced HK-2 cell death is mainly panapoptosis and ferroptosis, and STK38 deficiency promotes ferroptosis in proximal renal tubular epithelial cells of sepsis, aggravating S-AKI.

[0013] (4) Identify the site where STK38 phosphorylates ALDH1B1 and the specific pathway by which it inhibits the degradation of ALDH1B1 protein: interfere with / overexpress STK38 to inhibit / promote the expression of ALDH1B1 protein, but do not affect its transcription level.

[0014] (5) Analysis of the mechanism by which the STK38-ALDH1B1-4-HNE axis antagonizes ferroptosis in proximal tubular epithelial cells of sepsis: ALDH1B1 negatively regulates ferroptosis in proximal tubular epithelial cells of sepsis, reducing S-AKI. ALDH1B1 deficiency promotes lipid peroxidation in sepsis-induced HK-2 cells, with the accumulation of its product 4-HNE, while MDA shows no significant change.

[0015] Based on the above research, the technical solution of the present invention is as follows:

[0016] In a first aspect, the present invention provides the application of the STK38 ~ ALDH1B1 ~ 4-HNE axis as a target in the preparation of a therapeutic drug for sepsis-associated acute kidney injury (S-AKI).

[0017] Preferably, the present invention provides the use of STK38 agonists in the preparation of drugs for treating S-AKI, and also provides the use of ALDH1B1 inhibitors in the preparation of drugs for treating S-AKI.

[0018] Among them, the STK38 agonist is selected from small molecule agonists that enhance STK38 expression or recombinant vectors carrying the STK38 encoding gene.

[0019] Furthermore, the recombinant vector carrying the STK38 encoding gene was selected from lipid nanoparticles (LNPs) encapsulating the STK38 encoding gene or viral vectors; the viral vector was selected from adeno-associated virus or lentivirus, preferably a kidney-targeting virus, such as AAV9-PHP.S, which has good targeting of glomeruli (podocytes); AAV-Kidney1 / 2 / 3, obtained through in vivo screening, can efficiently transduce renal tubular epithelial cells, especially proximal tubules; AAV-LK01 / 03 has also shown certain renal transduction ability in non-human primates, which is crucial for clinical translation.

[0020] Furthermore, the ALDH1B1 inhibitor is selected from small interfering RNA molecules, short hairpin RNA, or antisense nucleotides that specifically interfere with the expression of the ALDH1B1 gene.

[0021] Further optimization revealed that the lipid nanoparticles encapsulate kidney-targeting STK38 mRNA, with the nucleic acid sequence shown below:

[0022] Mouse STK38 Forward: TGACAATGACCAAAGTGACACTG (SEQ ID NO.1);

[0023] Mouse STK38 Reverse: TCGTTCTTCATGTTGAGCGATAA (SEQ ID NO. 2).

[0024] The small interfering RNA molecules that interfere with ALDH1B1 gene expression contain four nucleic acid sequences, si-ALDH1B1#1 to si-ALDH1B1#4, as shown below:

[0025] si-ALDH1B1#1: 5′-GAGCGUGGUUUCUUCAUCATT-3′ (SEQ ID NO.3);

[0026] si-ALDH1B1#2: 5′-GAACCGUGGAGAAAGCAAATT-3′ (SEQ ID NO.4);

[0027] si-ALDH1B1#3: 5′-GAAGCCCUGUUCUUCAACTT-3′ (SEQ ID NO.5);

[0028] si-ALDH1B1#4: 5′-GAUGCAGUCAGCAAGAAGATT-3′ (SEQ ID NO. 6).

[0029] In a second aspect, the present invention provides a pharmaceutical composition for treating sepsis-related acute kidney injury, comprising an active ingredient and pharmaceutically acceptable excipients, wherein the active ingredient is selected from STK38 agonists or ALDH1B1 inhibitors, as specifically selected above.

[0030] In a third aspect, this invention provides the application of reagents for detecting the expression levels of STK38 or ALDH1B1 in the preparation of a kit for predicting acute kidney injury in sepsis. By detecting the expression levels of STK38 or ALDH1B1 in the blood of sepsis patients, the occurrence of acute kidney injury can be predicted.

[0031] Methods for detecting gene or protein expression levels in this field are all suitable for this invention, such as PCR, sequencing, or immunohistochemistry.

[0032] The role and effect of invention

[0033] This invention is the first to clearly demonstrate the protective role of STK38 in sepsis and S-AKI, verifying it as a key endogenous protective kinase, and identifying ALDH1B1 as a novel interacting molecule. Further research showed that ALDH1B1 deficiency promotes lipid peroxidation in sepsis-induced HK-2 cells, leading to the accumulation of its product 4-HNE, while MDA remained largely unchanged. Simultaneously, ALDH1B1 deficiency promotes damage and ferroptosis in sepsis-induced HK-2 cells.

[0034] Therefore, this invention explores new targeted treatment strategies for the treatment of S-AKI, which are expected to improve the prognosis of S-AKI patients and reduce the global public health burden. Attached Figure Description

[0035] Figure 1 The study demonstrated the protective effect of STK38 in patients with sepsis and mice: a. disease-related analysis using the GSE54514 dataset, b. WT mice and STK38. - / - Survival rate analysis of mice 7 days after CLP modeling, cf. WT mice and Stk38 mice. - / - Systemic inflammatory response after CLP modeling in mice. ns indicates no statistical significance, **P<0.01, ***P<0.001, ****P<0.0001.

[0036] Figure 2 The study demonstrated the protective effect of STK38 in S-AKI mice: a. Disease-related analysis of the GSE256430 dataset showed a significant decrease in Stk38 transcriptional levels in the kidneys of SA-AKI mice; b. Stk38 - / - Pathological staining and histochemical results after mouse CLP modeling; e. Stk38 - / - In mice, CLP modeling resulted in decreased renal function and increased BUN expression; f. Stk38 - / - Immunofluorescence colocalization results after mouse CLP modeling; gi. Stk38 - / - CLP modeling in mice exacerbated kidney damage and inflammatory response. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0037] Figure 3 The results showed that STK38 deficiency in proximal tubular epithelial cells exacerbated acute kidney injury in sepsis: ab. Dual fluorescence detection results of STK38 and segmental markers in kidney tissue; cd. HK-2 cells showed the most severe damage after approximately 12 hours of LPS stimulation, and the protein and transcriptional levels of STK38 were decreased in proximal tubular epithelial cells in sepsis; e. LPS stimulation after STK38 interference exacerbated proximal tubular epithelial cell damage. **P<0.01, ****P<0.0001.

[0038] Figure 4 The results showed that LPS induced proximal tubular epithelial cell death (including ferroptosis): a. CCK-8 assay showed decreased HK-2 cell viability induced by LPS; b. PI-positive cell count showed that LPS stimulation induced proximal tubular epithelial cell death; c. Treatment with different death inhibitors showed that LPS-induced HK-2 cell death was mainly panapoptosis and ferroptosis; d. Changes in the expression of ferroptosis-related proteins; e. PI fluorescence staining: LPS stimulation for 18 h induced proximal tubular epithelial cell death. ns indicates no statistical significance, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0039] Figure 5The study demonstrates LPS-induced proximal tubular epithelial cell death (including ferroptosis): a. Heatmap comparison of differentially expressed genes between the sepsis HK-2 cell control group and the STK38-deficient group; b. Differential gene KEGG pathway analysis showing that sepsis HK-2 cells in the STK38-deficient group are involved in cell death pathways; cd. PI-positive cell count and fluorescence staining showing that STK38 deficiency promotes proximal tubular epithelial cell death in sepsis; ef. Flow cytometry AV-positive cell proportion and schematic diagram, showing that STK38 deficiency promotes sepsis HK-2 cell death. **P<0.01, ***P<0.001, ****P<0.0001

[0040] Figure 6 The study showed that STK38 deficiency promotes ferroptosis in proximal tubular epithelial cells of sepsis-induced S-AKI: a. Treatment with different death inhibitors showed that STK38 deficiency induced apoptosis, necroptosis, and ferroptosis in sepsis-induced HK-2 cells, but not pyroptosis; bc. Flow cytometry results of AV-positive cells, showing that Fer-1 can partially reverse STK38 deficiency-induced HK-2 cell death; d. Flow cytometry analysis of C11 BODIPY™ proportion showed that STK38 deficiency promotes lipid peroxidation in HK-2 cells; e. Mitochondrial electron microscopy results; fh. Ferro Orange and DCFH-DA fluorescent probe labeling results; i. ELISA results showed that STK38 deficiency promoted increased GSSG and accumulation of lipid peroxidation products MDA and 4-HNE in HK-2 cells; l10. Ferroprepancy-related protein expression results; p. Overexpression of STK38 inhibited ferroptosis in HK-2 cells and alleviated HK-2 cell damage. ns indicates no statistical significance, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0041] Figure 7 This study demonstrates that STK38 binds to ALDH1B1 and maintains its protein stability: a. KEGG pathway analysis results; b. Mass spectrometry analysis of STK38-binding proteins after overexpression of the STK38-Flag plasmid in HEK293T cells, with further KEGG analysis revealing that ALDH1B1 (a member of the aldehyde dehydrogenase 1 family, B1) is the only tryptophan metabolism pathway-related protein; c. Exogenous Co-IP results on HEK293T cells; de. Interference / overexpression of STK38 inhibits / promotes ALDH1B1 protein expression but does not affect its transcriptional level. ns indicates no statistical significance, **P < 0.01.

[0042] Figure 8This study demonstrates the negative regulation of ferroptosis in proximal tubular epithelial cells of sepsis patients by ALDH1B1: a. ALDH1B1 interference efficiency in HK-2 cells; bc. Flow cytometry AV-positive cell proportion and schematic diagram; de. PI-positive cell count and fluorescence staining results; fg. ELISA results; hi. Flow cytometry and ELISA results; jn. ALDH1B1 deficiency promotes damage and ferroptosis in sepsis-affected HK-2 cells; o. Endogenous Co-IP detection results on HK-2 cells. ns indicates no statistical significance, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Detailed Implementation

[0043] Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0044] This invention starts with peripheral blood samples from sepsis patients and further utilizes in vitro cell experiments to explore the molecular mechanism by which phosphokinase STK38 antagonizes ferroptosis in proximal renal tubular epithelial cells in sepsis patients, as detailed below:

[0045] (1) Clinical and animal model validation: Using Stk38- / - mice and CLP sepsis models, the effects of STK38 deficiency on the severity of S-AKI, renal function damage and inflammatory response were clarified; the role of STK38 in renal parenchymal cells and immune cells was distinguished by bone marrow reconstitution experiments.

[0046] (2) Cellular mechanism study: Using LPS-induced HK-2 cells as a model, we will verify whether STK38 deficiency aggravates cell death (especially ferroptosis) and clarify its mechanism of inhibiting lipid peroxidation by regulating key ferroptosis molecules (such as GPX4, SLC7A11, COX2).

[0047] (3) Molecular mechanism analysis: Through transcriptome sequencing, mass spectrometry analysis and immunoprecipitation, it was found that STK38 inhibits the degradation of ALDH1B1 by phosphorylation modification, reduces the accumulation of toxic lipid metabolite 4-HNE, and thus blocks the activation of ferroptosis.

[0048] The specific experimental methods and results analysis are as follows:

[0049] I. Experimental Methods

[0050] 1.1 Establishment of a sepsis model based on cecal ligation and perforation (CLP)

[0051] Based on previous studies, a mature system for establishing a mouse model of sepsis has been established (Wang JF, Anesthesiology 2015; Li XJ, J Surg Res 2015; Zhao YJ, Mediator Inflamm 2014). The basic steps are as follows: After acclimatizing mice for one week at 8-10 weeks, they are anesthetized with 2-3% sevoflurane. A midline abdominal incision is made to expose the abdominal cavity. The cecum is located, ligated 1 / 2 to 2 / 3, and then pierced with a 22G needle to squeeze out a small amount of intestinal contents. The intestine is then returned to the abdominal cavity, and the abdomen is closed. Postoperatively, 1 ml of normal saline is injected subcutaneously for fluid resuscitation.

[0052] 1.2 Western Blot (WB)

[0053] Take 2×10 6 Cells were thoroughly lysed with protein lysis buffer and protease inhibitor, and protein concentration was detected using the BCA method. After denaturation, electrophoresis, and membrane transfer, antibodies were incubated, developing buffer was added, and the cells were developed and photographed using an automated imaging system. Most of the proteins detected have commercially available antibodies. For molecules without ideal antibodies, companies can be commissioned to design and manufacture new antibodies, or plasmids carrying tags such as Flag, HA, and Myc can be constructed for relevant experiments in cell lines, using Flag or HA-tagged antibodies to replace the protein.

[0054] 1.3 Flow cytometry

[0055] Routine flow cytometry was used for detection, and all flow cytometry antibodies used were commercially available reagents. Apoptosis was detected using the PI method (Jia SH, J Clin Invest 2004). Cells were added to PI and Triton X100 buffer and incubated in the dark for 15 min before flow cytometry analysis. The proportion of apoptotic cells was determined based on the PI histogram curve. Cells were pre-stained with BODIPY™ 581 / 591 C11 for 30 min before flow cytometry analysis to detect the degree of lipid peroxidation.

[0056] 1.4 Real-time PCR

[0057] Take 10 7 RNA was extracted from cells using the Trizol / chloroform method and administered according to the standard protocol using the TAKARA reverse transcription real-time quantitative PCR kit. GAPDH was used as an internal control, and data were analyzed using ΔΔCt values.

[0058] 1.5 Immunofluorescence staining

[0059] HK-2 cells were spread onto polylysine slides using a centrifuge smear machine, fixed with paraformaldehyde, permeabilized with Triton X-100, and then incubated with primary and secondary antibodies. DAPI was added to stain the nuclei. Finally, the slides were washed, inverted onto a slide, and blocked with a blocking agent. The cells were then observed and photographed using a laser confocal microscope.

[0060] 1.6 siRNA, plasmid transfection and lentiviral infection

[0061] ALDH1B1 siRNA can be purchased from Qiagen or synthesized from Gemma. For HK-2 cells, transfect with Polyplus siRNA or plasmid transfection reagent (jetPRIME®) for 24-48 hours, followed by LPS stimulation for 18 hours before performing related experiments. Plasmids and lentiviruses can be constructed by commercial companies, following the instructions in the kit.

[0062] The siRNA sequence is as follows:

[0063] si-ALDH1B1#1: 5′-GAGCGUGGUUUCUUCAUCATT-3′ (SEQ ID NO.3);

[0064] si-ALDH1B1#2: 5′-GAACCGUGGAGAAAGCAAATT-3′ (SEQ ID NO.4);

[0065] si-ALDH1B1#3: 5′-GAAGCCCUGUUCUUCAACTT-3′ (SEQ ID NO.5);

[0066] si-ALDH1B1#4: 5′-GAUGCAGUCAGCAAGAAGATT-3′ (SEQ ID NO. 6).

[0067] 1.7 Immunoprecipitation

[0068] After thoroughly mixing the antibody and protein G magnetic beads on a shaker, wash the magnetic beads, add protein suspension and mix again, wash the magnetic beads, add protein loading buffer and boil. The remaining electrophoresis and transfer steps are the same as for Western blotting (WB). After incubating with the antibody for the target protein, perform imaging to observe whether the two proteins interact.

[0069] II. Experimental Results

[0070] (1) STK38 has a protective effect in patients with sepsis and mice.

[0071] By consulting the NCBI GEO dataset (login GSE54514, ID: 108617105), sepsis-related datasets were obtained. Microarray analysis of RNA extracted from whole blood samples of ICU sepsis patients revealed that the expression level of STK38 in the whole blood transcriptome of ICU patients who died from sepsis was significantly lower than that of survivors three days prior to admission. Figure 1 a).

[0072] Stk38 was specifically knocked out after mouse CLP modeling to construct Stk38. - / - CLP mice. 7-day survival analysis revealed that, compared to WT mice, Stk38... - / - The survival rate of mice after CLP modeling was significantly reduced. Figure 1 b); Compared to WT mice, Stk38 - / - After CLP modeling in mice, systemic inflammatory response was aggravated, serum IL-6 and TNF-α increased, and TNF-α increased in peritoneal lavage fluid, but IL-6 showed no significant change. Figure 1 c- Figure 1 f).

[0073] (2) STK38 has a protective effect in S-AKI mice.

[0074] PCR results showed that the level of Stk38 transcription in the kidneys of SA-AKI mice was significantly reduced. Figure 2 a) Pathological staining and histochemical results showed that Stk38 - / - After CLP modeling in mice, kidney damage worsened, with renal tubular dilation, epithelial cell cast formation, cell swelling, intracellular vacuolation, brush border disappearance, and decreased STK38 / NDR1 protein expression. Figure 2 b-2d); Stk38 - / - After CLP modeling in mice, renal function decreased and BUN expression increased. Figure 2 e); Immunofluorescence co-localization results showed that Stk38 - / - Increased aggregation of renal macrophages and neutrophils after CLP modeling in mice Figure 2 f); Analysis of renal inflammatory response showed that Stk38 - / - After CLP modeling in mice, the expression levels of three inflammatory factors, KIM-1, IL-6, and TNF-α, increased in kidney tissue, exacerbating kidney damage and inflammatory response. Figure 2 g-2i).

[0075] (3) STK38 deficiency in proximal renal tubular epithelial cells exacerbates acute kidney injury in sepsis.

[0076] Dual fluorescence detection was performed on the kidney tissues of WT and CLP mice. The results showed that STK38 was mainly expressed in the glomerular and proximal tubular cells of WT mice, and STK38 expression in the proximal tubules of WT mice was downregulated after CLP modeling. Figure 3 a-3b); Using proximal renal tubular epithelial cells (HK-2 cells) as experimental cells, LPS stimulation was performed, and Western blot analysis was conducted on the cells at 3h, 6h, 12h, and 24h. The results showed that HK-2 cells suffered the most severe damage around 12h. Figure 3 c); Based on the literature, 18 hours was selected as the stimulation time point for cell experiments. STK38 protein and transcriptional levels were decreased in proximal renal tubular epithelial cells of sepsis patients. Figure 3 d), LPS stimulation following STK38 interference exacerbates proximal tubular epithelial cell damage ( Figure 3 e).

[0077] (4) LPS induces proximal renal tubular epithelial cell death (including ferroptosis).

[0078] After inducing HK-2 cells with LPS, cell viability was detected using the CCK-8 assay. Compared with normal HK-2 cells, the viability of LPS-induced HK-2 cells was significantly decreased. Figure 4 a); PI-positive cell counts showed that LPS stimulation induced proximal tubular epithelial cell death ( Figure 4 b).

[0079] HK-2 cells were divided into control group (ctrl group), DMSO group, DMSO+LPS group, Z-VAD+LPS group, Z-YVAD+LPS group, Nec-1+LPS group, and Fer-1+LPS group. The model group was treated with DMSO first and then stimulated with LPS, while the experimental groups were treated with the same concentration of different cell death inhibitors and then stimulated with LPS. All of these treatments were able to inhibit the degree of proximal tubular epithelial cell death induced by LPS stimulation. Figure 4 c); LPS stimulation induced HK-2 cell damage and ferroptosis, upregulated the expression of kidney injury markers KIM-1 and NGAL, downregulated the expression of the ferroptosis negative regulator protein GPX4, and upregulated the expression of lipid peroxidation-related proteins ACSL4, MDA, and 4-HNE, indicating that LPS-induced HK-2 cell death was mainly characterized by panapoptosis and ferroptosis. Figure 4 d); PI fluorescence staining was used to detect cells at different time points, showing that LPS stimulation for 18 h induced proximal renal tubular epithelial cell death ( Figure 4 e).

[0080] (5) STK38 deficiency promotes proximal tubular epithelial cell death in sepsis.

[0081] RNA sequencing was performed on sepsis-positive HK-2 cells in the control group and the STK38-deficient group, and differentially expressed genes were analyzed. Figure 5 a) and differential gene KEGG pathway analysis ( Figure 5 (b) This shows that the STK38-deficient sepsis HK-2 cells are involved in the cell death pathway. PI-positive cell counting and fluorescence staining results showed that STK38 deficiency promotes the death of proximal renal tubular epithelial cells in sepsis ( Figure 5 c-5d). Flow cytometry analysis of the proportion of AV-positive cells in both cell types showed that the proportion of AV-positive cells was significantly increased in STK38-deficient LPS-stimulated cells, promoting sepsis HK-2 cell death (c-5d). Figure 5 e-5f).

[0082] (6) STK38 deficiency promotes ferroptosis in proximal renal tubular epithelial cells of sepsis and exacerbates S-AKI.

[0083] Normal HK-2 cells stimulated by LPS served as the control group, while STK38-deficient HK-2 cells served as the experimental group. These cells were further divided into the following treatment groups: LPS stimulation alone, LPS stimulation followed by DMSO, LPS stimulation followed by Z-VAD, LPS stimulation followed by Z-YVAD, LPS stimulation followed by Nec-1, and LPS stimulation followed by Fer-1. PI-positive cell counts were then performed in each group. The results showed that STK38 deficiency induced apoptosis, necroptosis, and ferroptosis in sepsis-affected HK-2 cells, but did not induce pyroptosis. Different death inhibitors alleviated the degree of cell death. Figure 6 a).

[0084] The proportion of AV-positive cells was detected by flow cytometry in control cells, LPS+DMSO group cells, STK38 KO+LPS+DMSO group cells, and STK38 KO+LPS+Fer-1 group cells. The results showed that the death inhibitor Fer-1 could partially reverse STK38 deficiency-induced sepsis HK-2 cell death. Figure 6 b-6c).

[0085] Using normal HK-2 cells and LPS-stimulated HK-2 cells as the test subjects, the proportion of C11BODIPY™ was detected by flow cytometry, showing that STK38 deficiency promotes lipid peroxidation in sepsis-affected HK-2 cells. Figure 6 d); Mitochondrial electron microscopy results showed that STK38 deficiency promoted typical ferroptosis features in sepsis HK-2 cells, such as reduced mitochondrial volume, increased membrane density, disappearance of cristae, and rupture of the outer membrane. Figure 6 e); FerroOrange and DCFH-DA fluorescent probe labeling results showed that STK38 deficiency promoted intracellular Fe in sepsis-related HK-2 cells. 2+ Accumulation and ROS generation ( Figure 6 f-6h); ELISA results showed that STK38 deficiency promoted increased GSSG in sepsis-associated HK-2 cells and accumulation of lipid peroxidation products MDA and 4-HNE (f-6h). Figure 6 i-6k); Western blotting (WB) was used to detect the expression of ferroptosis-related proteins in the two groups of cells. The results showed that STK38 deficiency promoted the downregulation of GPX4 and SLC7A11 expression, and the upregulation of COX2, ACSL4, MDA, and 4-HNE expression in sepsis-positive HK-2 cells. It also inhibited SLC7A11 transcription and promoted the transcription of the ferroptosis-sensitive marker PTGS2, but did not affect the transcriptional level of GPX4. Figure 6 l-6o). Conversely, overexpression of STK38 via a lentiviral vector inhibited ferroptosis in sepsis HK-2 cells and reduced sepsis HK-2 cell damage (l-6o). Figure 6 p).

[0086] (7) STK38 binds to ALDH1B1 and maintains its protein stability.

[0087] KEGG pathway analysis of RNA from normal HK cells and STK38-deficient cells showed that, compared with the WT group, differentially expressed genes in STK38-deficient sepsis HK-2 cells were mainly enriched in the tryptophan metabolism pathway. Figure 7 a); Mass spectrometry analysis of STK38-Flag plasmid overexpression in HEK293T cells revealed STK38 binding proteins. Further KEGG analysis showed that the only tryptophan metabolism pathway-related protein was ALDH1B1 (a member of the aldehyde dehydrogenase 1 family, B1). Figure 7 b), and STK38 interacts with ALDH1B1 ( Figure 7 C). Interference / overexpression of STK38 can inhibit / promote ALDH1B1 protein expression, but does not affect its transcriptional level. Figure 7 d-7e).

[0088] (8) ALDH1B1 negatively regulates ferroptosis in proximal renal tubular epithelial cells of sepsis, reducing S-AKI.

[0089] Interference RNAs for ALDH1B1 were designed—si-ALDH1B1#1 ~ si-ALDH1B1#4, with sequences shown above.

[0090] Compared with HK-2 WT cells, transfection with ALDH1B1 siRNA significantly inhibited the expression of ALDH1B1 in HK-2 cells. Figure 8a). In HK-2 WT cells, inhibition of ALDH1B1 nearly doubled the proportion of AV-positive cells in flow cytometry; after LPS stimulation, the proportion of AV-positive cells increased in both normal and ALDH1B1-inhibited cells, but the increase in ALDH1B1-inhibited cells was more significant, indicating that ALDH1B1 deficiency promotes sepsis-related HK-2 cell death. Figure 8 b-8c); PI-positive cell counts and fluorescence staining results showed that ALDH1B1 deficiency promoted sepsis HK-2 cell death (b-8c); Figure 8 d-8e); ELISA results showed that ALDH1B1 deficiency promoted a decrease in GSH and an increase in GSSG in sepsis-related HK-2 cells (d-8e); Figure 8 f-8g); further analysis using flow cytometry and ELISA revealed that ALDH1B1 deficiency promoted lipid peroxidation in sepsis-positive HK-2 cells, leading to the accumulation of its product 4-HNE, while MDA showed no significant change. Figure 8 h-8i).

[0091] Further investigation into the effects of ALDH1B1 deficiency on ferroptosis revealed downregulation of GPX4 expression, upregulation of ACSL4, MDA, and 4-HNE expression, upregulation of renal injury molecular markers KIM-1 and NGAL expression, and upregulation of transcription of the key lipid peroxidation enzyme ACSL4 and the ferroptosis sensitivity marker PTGS2. This indicates that ALDH1B1 deficiency promotes sepsis-induced HK-2 cell damage and ferroptosis. Figure 8 j-8n); Endogenous Co-IP assays on HK-2 cells showed that LPS promoted the binding of STK38 to ALDH1B1 (j-8n); Figure 8 o).

[0092] The undescribed parts of this invention are the same as or implemented using existing technology. The applicant declares that this invention is illustrated through the above specific embodiments, but the invention is not limited to the above detailed methods, i.e., it does not mean that the invention must rely on the above detailed methods to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the product of this invention, additions of auxiliary components, and selection of specific methods all fall within the protection and disclosure scope of this invention.

Claims

1. Application of STK38 ~ ALDH1B1 ~ 4-HNE axis as a target in the preparation of drugs for the treatment of sepsis-associated acute kidney injury (S-AKI).

2. The application according to claim 1, characterized in that, The application refers to the use of STK38 agonists in the preparation of drugs for treating S-AKI or the use of ALDH1B1 inhibitors in the preparation of drugs for treating S-AKI.

3. The application according to claim 2, characterized in that, The STK38 agonist is selected from small molecule agonists that enhance STK38 expression or recombinant vectors carrying the STK38 encoding gene; the ALDH1B1 inhibitor is selected from small interfering RNA molecules, short hairpin RNA or antisense nucleotides that specifically interfere with ALDH1B1 gene expression.

4. The application according to claim 3, characterized in that, The recombinant vector carrying the STK38 coding gene is selected from lipid nanoparticles or viral vectors that encapsulate the STK38 coding gene, and the viral vector is selected from adeno-associated virus or lentivirus.

5. The application according to claim 4, characterized in that, The lipid nanoparticles encapsulate kidney-targeting STK38 mRNA, with nucleic acid sequences as shown in SEQ ID NO. 1 and 2; the nucleic acid sequences of the small interfering RNA molecules that interfere with ALDH1B1 gene expression are shown in any one of SEQ ID NO. 2 to 6.

6. A pharmaceutical composition for treating sepsis-related acute kidney injury, characterized in that, It includes an active ingredient and pharmaceutically acceptable excipients, wherein the active ingredient is selected from STK38 agonists or ALDH1B1 inhibitors.

7. The pharmaceutical composition for treating sepsis-related acute kidney injury according to claim 6, characterized in that, The active component is selected from small molecule agonists that enhance STK38 expression or recombinant vectors carrying the STK38 encoding gene, or from small interfering RNA molecules, short hairpin RNA or antisense nucleotides that specifically interfere with the expression of the ALDH1B1 gene.

8. The pharmaceutical composition for treating sepsis-related acute kidney injury according to claim 7, characterized in that, The nucleic acid sequence of the STK38 encoding gene is shown in SEQ ID NO.1 and 2; the nucleic acid sequence of the small interfering RNA molecule that interferes with the expression of the ALDH1B1 gene is shown in any one of SEQ ID NO.2 to 6.

9. Application of reagents for detecting STK38 or ALDH1B1 expression levels in the preparation of a kit for predicting acute kidney injury in sepsis.

10. The application according to claim 9, characterized in that, The samples used to detect STK38 or ALDH1B1 expression levels were taken from the patient's blood. The reagents are selected from those required for detection using PCR, sequencing, or immunohistochemistry methods.

Images