Use of skap2::raf1 fusion gene as a target in preparation of reagent for treating langerhans cell histiocytosis
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-09
- Publication Date
- 2026-08-11
AI Technical Summary
尽管如此,临床上仍有约20%的患者在常规检测中未发现驱动遗传变异,给患者的风险分层和靶向治疗带来极大的障碍,仍需进一步探索其致病机制
Smart Images

Figure CN122537534A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of tumor molecular biology technology, specifically to the application of the SKAP2::RAF1 fusion gene as a target in the preparation of a reagent for treating Langerhans histiocytosis. Background Technology
[0002] Langerhans cell histiocytosis (LCH) is a type of myeloid tumor characterized by abnormal aggregation of CD1a and / or CD207-positive dendritic cells accompanied by inflammatory cell infiltration. LCH can occur at any age, but is most common in young children. Clinical manifestations are highly heterogeneous, ranging from focal bone or skin involvement to involvement of multiple organs / systems throughout the body. Invasion of dangerous organs such as the liver, spleen, and bone marrow can be life-threatening. Misdiagnosis and missed diagnosis are frequent, and the recurrence rate is high. Repeated disease progression can lead to irreversible and permanent sequelae such as diabetes insipidus, neurodegeneration, and cirrhosis.
[0003] Recent studies have shown that abnormal activation of the mitogen-activated protein kinase (MAPK) signaling pathway is common in LCH. Point mutations or deletions / insertions of genes such as BRAF (especially V600E), MAP2K1, ARAF, and K / NRAS are found in about 80% of patients, as well as gene fusions of kinases such as BRAF or NTRK3. These genetic changes all lead to increased phosphorylation levels of extracellular signa-regulated kinase (ERK), i.e., continuous activation of the MAPK pathway (Badalian-Very et al., Blood 2010, 116 (11): 1919-1923. Brown et al., Blood 2014, 124 (10): 1655-1658. Nelson et al., Blood 2014, 123 (20): 3152-3155.). Nevertheless, in clinical practice, about 20% of patients do not show driver genetic variants in routine tests, which poses a great obstacle to risk stratification and targeted therapy, and further research is needed to explore their pathogenic mechanisms.
[0004] The Raf-1 proto-oncogene, serine / threonine protein kinase (RAF1), is located on chromosome 3p25 and encodes the serine / threonine kinase Raf-1, a core effector molecule in the MAPK signaling cascade. RAF1 rarely undergoes activating point mutations; its oncogenic mechanism primarily relies on gene fusions resulting from chromosomal translocations or large deletions. These fusion events typically lead to the loss of the N-terminal autorepressive domain and fusion with various partner genes (such as MAP4, CTNNA1, GOLGA4, LRCH3, CTDSPL, PRKAR2A, and TRAK1), forming chimeric proteins with constitutive dimerization capabilities and sustained kinase activity. This activation mechanism causes RAF1 fusion-driven tumors to exhibit different response characteristics to targeted drugs compared to other MAPK pathway-driven mutations (Williams EA et al., Modern Pathology. 2020;33(8):1466-1474. Khaddour K et al., Oncologist. 2025;30(3):oyae297.). In recent years, with the increasing depth of molecular detection, some rare RAF1 fusions have also been found in histiocytic tumors, including LCH, such as KLC1::RAF1 (Koh KN et al., Cancer Research and Treatment. 2025;57(3):873-882. Wright FE et al., Pediatric Blood Cancer. 2025;72(7):e31723.) and MBNL1::RAF1 (Rankin A et al., Oncologist. 2021;26(1):e153-e163.). The Src protein kinase-associated phosphoprotein 2 (SKAP2) gene encodes a signal adaptor protein SKAP2, which participates in the regulation of cell migration, adhesion and immune effector functions in myeloid immune cells by mediating integrin-related signal transduction and regulating cytoskeleton remodeling. SKAP2 gene mutations are associated with a variety of inflammatory diseases, such as type 1 diabetes and Crohn's disease (Wilmink M et al., Biomedicines. 2023;11(10):2788.). SKAP2 gene mutations have also been detected in tumors, such as the SKAP2::BRAF fusion found in melanoma to partially respond to the MEK inhibitor trametinib (Chew SM et al., BMJ Case Rep. 2021;14(6):e238494.).
[0005] Identifying novel RAF1 gene fusions in LCH is of significant clinical value in filling the molecular gap in "pan-wildtype" cases and guiding precision treatment. LCH lesions have low levels of neoplastic Langerhans cells. High-depth sequencing can uncover rare but crucial RAF1 fusions as pathogenic drivers, allowing for the redefinition of this group of patients with "unknown etiology" as a molecularly defined subtype. Furthermore, identifying RAF1 fusions has extremely high therapeutic guiding significance. Due to its dimerization activation mechanism, these patients are resistant to first-generation type I RAF inhibitors and may even experience anomalous activation, but they are highly sensitive to MEK inhibition and novel type II RAF1 inhibitors (Jain P et al., Oncogene. 2017;36(45):6348-6358, Sievert AJ, Proc Natl Acad Sci USA. 2013;110(15):5957-5962.). Therefore, the discovery and accurate identification of new RAF1 gene fusions have significant diagnostic value, while avoiding iatrogenic harm caused by incorrect medication. Furthermore, they can provide life-saving targeted treatment options for children with relapsed or refractory LCH and serve as an important reference for achieving personalized precision diagnosis and treatment of LCH. Summary of the Invention
[0006] To address the shortcomings of the existing technology, this invention aims to provide an application of the SKAP2::RAF1 fusion gene as a target in the preparation of reagents for treating Langerhans histiocytosis, thereby expanding the scope of LCH-related genetic variation detection.
[0007] To solve the above problems, the present invention adopts the following technical solution:
[0008] In a first aspect, the present invention provides the application of the SKAP2::RAF1 fusion gene as a target in the preparation of reagents for treating Langerhans histiocytosis; the nucleotide sequence of the SKAP2::RAF1 fusion gene is shown in SEQ ID NO.1.
[0009] Furthermore, the reagent reduces the expression of the SKAP2::RAF1 fusion gene.
[0010] Furthermore, the reagents include trametinib and sorafenib.
[0011] Furthermore, the amino acid sequence of the SKAP2::RAF1 fusion gene expression is shown in SEQ ID NO.2.
[0012] Furthermore, the reagent inhibits the aberrant activation of the MAPK pathway caused by the constitutive activation of RAF1 kinase mediated by the SKAP2::RAF1 fusion gene.
[0013] Furthermore, the reagent inhibits cell proliferation promoted by the SKAP2::RAF1 fusion gene.
[0014] In a second aspect, the present invention provides a medicament for treating Langerhans cell histiocytosis, said medicament inhibiting the expression of the SKAP2::RAF1 fusion gene.
[0015] Thirdly, the present invention provides a detection kit for Langerhans histiocytosis, the detection kit comprising reagents for detecting the expression level of the SKAP2::RAF1 fusion gene.
[0016] Fourthly, this invention provides the application of the SKAP2::RAF1 fusion gene as a biomarker in the preparation of a detection reagent for Langerhans cell histiocytosis.
[0017] The beneficial effects of this invention are as follows: This invention screens the SKAP2::RAF1 fusion gene and demonstrates through cell experiments that its pathogenic mechanism of LCH is caused by activating the ERK kinase-activated MAPK pathway. This not only expands the scope of LCH-related genetic variant detection but also further elucidates the abnormal activation mechanism of the MAPK pathway in LCH. Most importantly, in vitro experiments have verified that this fusion is sensitive to the targeted drugs trametinib and sorafenib, which can be used to guide individualized clinical medication for positive children. The detection method developed for this fusion gene can be widely applied to clinical diagnosis and individualized treatment. Attached Figure Description
[0018] Figure 1 This is a partial result of the whole-exome sequencing of the SKAP2 gene.
[0019] Figure 2 This is a partial result of the whole-exome sequencing of the RAF1 gene.
[0020] Figure 3 This is a schematic diagram of the fusion gene SKAP2::RAF1 sequence structure.
[0021] Figure 4 This is a diagram of the Sanger sequencing results.
[0022] Figure 5 The image shows the Western Blot results of HEK-293T cells transfected with the empty vector (Control), SKAP2, RAF1, and SKAP2::RAF1 expression plasmid.
[0023] Figure 6 Proliferation curves of HEK-293T cells transfected with empty vector (Control), SKAP2, RAF1, and SKAP2::RAF1 expression plasmid.
[0024] Figure 7 Western blot results of HEK-293T cells transfected with empty vector (Control), SKAP2, RAF1 and SKAP2::RAF1 expression plasmids for 24 hours after treatment with DMSO or 20 μM trametinib.
[0025] Figure 8 Western blot results of HEK-293T cells transfected with empty vector (Control), SKAP2, RAF1 and SKAP2::RAF1 expression plasmids for 24 hours after treatment with DMSO or 20 μM sorafenib. Detailed Implementation
[0026] The present invention will be further described in detail below with reference to specific embodiments.
[0027] It should be noted that these embodiments are only used to illustrate the present invention and are not intended to limit the present invention. Simple improvements to the method under the premise of the present invention are all within the scope of protection claimed by the present invention.
[0028] Example 1
[0029] Sample collection and gene testing
[0030] Unstained paraffin-embedded sections of skull biopsy tissue and oral pharyngeal swabs were collected from one patient with LCH and subjected to high-depth (500x) whole-exome sequencing. The sequencing protocol is as follows:
[0031] (1) DNA library preparation: Genomic DNA was extracted using the Qiagen DNA Mini Kit (Qiagen, Shanghai, China). The extracted DNA was then quality-checked using a Nanodrop 2000 (Thermal Fisher Scientific, USA). After passing the quality check, the DNA was used for the next step of the experiment. 1-3 μg of genomic DNA was fragmented to an average size of 150 bp using an S220 Focused-ultrasonicator (Covaris, Massachusetts, USA). The sample DNA library was prepared using a library preparation kit (MyGenotics, Beijing, China). The process included end repair, adapter ligation, and PCR amplification, followed by further sequencing using DNBSEQ (DNBSEQT7).
[0032] (2) Capture: The fragmented DNA library was captured using a gene capture kit (MyGenostics Inc., Beijing, China). The biotin-labeled capture probes were designed to include the coding exons of all genes, plus 20 bp upstream and downstream of each exon. The probes were 120 bp in length and used a shingled design with adjacent probes overlapping by 50 bp. The capture experiment was performed according to the instruction manual. First, 500 ng of the DNA library was mixed with buffer BL and GenCap probes (MyGenotics Inc.). The mixture was heated at 95°C for 5 minutes, then placed in a PCR instrument and heated at 65°C for 5 minutes. Afterward, 19 μL of 65°C preheated buffer HY (Mygenotics, Maryland, USA) was added to the mixture, and the mixture was incubated at 65°C for 16–24 hours in a PCR instrument for hybridization. Add 50 μL of Life Technology elution beads to the hybridization solution and wash three times with 50 μL of 1X binding buffer. Resuspend the beads in 50 μL of 1X binding buffer. Then, wash the beads with WB1 buffer for 15 min / cycle at room temperature, and with WB3 buffer for 10 min / cycle at 65°C three times. Elute the bound DNA with buffer and amplify using the following program in a PCR instrument: 95°C for 4 min s (1 cycle); 98°C for 30 s, 65°C for 30 s, 72°C for 30 s (13 cycles); 72°C for 5 min (1 cycle). Purify the PCR products using SPRI beads (Beckman Coulter) according to the manual. Sequencing of the enriched library at both ends on DNBSEQ (DNBSEQ-T7) yielded 150 bp reads.
[0033] Bioinformatics Analysis
[0034] After sequencing, the raw data was saved in FASTQ format and then subjected to bioinformatics analysis: CutAdaptor software (http: / / code.google.com / p / cutadapt / ) was used to filter Illumina sequencing adapters and low-quality reads (<80 bp). After quality control, clean reads were aligned to the UCSC hg19 human reference genome using BWA software (http: / / bio-bwa.sourceforge.net / ). Duplicate reads were removed, and a parameter-driven algorithm was used to correct bases so that the quality values of the bases in the final output BAM file were closer to the reference genome. Mapped reads were used to detect variants. Finally, SNP and InDel variants were detected using the parameter-driven algorithm of Sentieon software. The data was then converted to VCF format. Finally, the variants were further annotated using ANNOVAR software (http: / / annovar.openbioinformatics.org / en / latest / ) and correlated with multiple databases, such as 1000 Genomes, ESP6500, dbSNP, EXAC, Mygenotics, and HGMD. Variability prediction was performed using REVEL, SIFT, PolyPhen-2, MutationTaster, and GERP++.
[0035] The study employed a four-step screening process to identify potential pathogenic mutations in downstream analyses:
[0036] (i) The number of mutated reads must exceed 5, and the mutation rate must be no less than 30%;
[0037] (ii) If the mutation frequency exceeds 5% in the 1000g database, ESP6500 database and internal database, it shall be removed;
[0038] (iii) If the mutation exists in the InNormal database (MyGenostics), it should be excluded;
[0039] (iv) If a synonymous mutation is not included in the HGMD database, it will be removed. After the above screening, the remaining mutations are the potential pathogenic mutations for subsequent analysis.
[0040] Test results
[0041] 1) Discovery of the fusion gene SKAP2::RAF1
[0042] The patient, a male, initially presented with a 12-year-old complaint of a head mass for over a month. He underwent a cranial lesion biopsy at another hospital, and histochemical staining showed positive results for CD1a and Langerin, thus confirming LCH (Low-system hemangioma). Upon admission, further examinations revealed the right frontal bone as the affected organ, clinically classified as a single-system involvement. Whole-exome sequencing of the cranial lesion sample identified a novel fusion gene, its nucleotide sequence shown in SEQ ID NO.1 and the expressed amino acid sequence shown in SEQ ID NO.2. This gene is formed by the SKAP2 gene located on chromosome 7p15.2 and the RAF1 gene located on chromosome 3p25.2. The fusion junction was determined to be chr7:26711983 and chr3:12642046 (e.g., chr7:26711983 and chr3:12642046). Figure 1 (The results showed a break in the SKAP2 gene at chr7:26711983 on chromosome 7p15.2) and Figure 2 (The results showed a break at chr3:12642046 in the RAF1 gene located on chromosome 3p25.2.)
[0043] SEQ ID NO.1:
[0044]
[0045] SEQ ID NO.2:
[0046] .
[0047] The predicted fusion of exons 1-11 of the RAF1 gene and exons 8-16 of the SKAP2 gene with the RAF1 gene will preserve the RAF1 protein kinase domain (e.g., Figure 3 As shown); Sanger first-generation sequencing was performed using primers 5'AGGAAAGCTGGTCAACTCCTACA3' (forward / SEQ ID NO.3) and 5'CCTCCCTGCTGTTTACCACTATG3' (reverse / SEQ ID NO.4) to further confirm the fusion site of SKAP2::RAF1 (as shown). Figure 4 (As shown).
[0048] The child has not yet received chemotherapy and has been monitored for nearly a year, and the bone damage to the right frontal bone has shown some repair.
[0049] 2) Verification of biological functions
[0050] To evaluate the biological function of the SKAP2::RAF1 fusion gene, the target gene fragment was ligated into the CV702 vector (element: CMV enhancer-MCS-3FLAG-SV40-Puromycin, purchased from Jikai Gene Company) to construct a recombinant SKAP2::RAF1 fusion expression plasmid. Its nucleotides are shown in SEQ ID NO.5, and the sequence was confirmed to be correct by DNA sequencing.
[0051] Following the instructions for KeygenMAX 3000 transfection reagent (Jiangsu Keygen Biotechnology Co., Ltd., KGA9705-0.5), the SKAP2::RAF1 fusion gene expression plasmid was transfected into HEK-293T cells. Simultaneously, an empty vector was transfected as a negative control, and SKAP2 and RAF1 gene expression plasmids (purchased from Keygen Biotechnology Co., Ltd.) were transfected as controls. Cells were cultured in high-glucose DMEM medium (Cytiva, SH30022.01, USA) containing 10% fetal bovine serum (Biological Industries, Israel, 04-001-1ACS) at 37°C in a humidified incubator with 5% CO2 for 48 hours after transfection, and then collected. Proteins were extracted using RIPA lysis buffer (Beijing Pulilai Gene Technology Co., Ltd., C1053), separated by electrophoresis on 4-12% Bis-Tris protein gels (Shanghai Yamei Biomedical Technology Co., Ltd., LK408-20), transferred to PVDF membranes, and analyzed by Western blotting using the following antibodies: anti-p44 / 42 MAPK (ERK1 / 2) antibody (Proteintech, 66192-1-Ig), anti-phosphorylated p44 / 42 MAPK (ERK1 / 2) antibody (CST Biotech, 4370S), anti-phosphorylated MEK1 / 2 antibody (CST Biotech, 9154T), anti-MEK1 / 2 antibody (Proteintech, 67410-1-Ig), anti-Vinculin antibody (Proteintech, 26520-1-AP), and anti-Flag antibody (Proteintech, 66008-4-Ig). The results showed that... Figure 5Compared to the control group, overexpression of RAF1 or the SKAP2::RAF1 fusion significantly upregulated the phosphorylation levels of MEK1 / 2 and ERK1 / 2 (p-MEK1 / 2 and p-ERK1 / 2), indicating activation of the MAPK signaling pathway. Therefore, the SKAP2::RAF1 fusion gene plays a crucial role in the pathogenesis of LCH by mediating constitutive activation of RAF1 kinase, leading to aberrant activation of the MAPK pathway.
[0052] Following the instructions for using the KeygenMAX 3000 transfection reagent, the empty vector (Control), SKAP2, RAF1, and SKAP2::RAF1 expression plasmid were transfected into HEK-293T cells. After culturing for 24 hours, the cells were collected and cultured at 8 × 10⁻⁶ cells / cells. 3 Cells were seeded at a density of 100 μL / well in 96-well plates, with 100 μL of cell suspension added to each well. A blank well containing 100 μL of high-glucose DMEM medium with 10% fetal bovine serum was also included. Each group had three replicates. At 0, 24, 48, and 72 hours, 20 μL of MTS reagent (Promega, G3580, USA) was added to each well, and the plates were incubated at 37°C in the dark for 2 hours. Absorbance was measured at 490 nm using a microplate reader. The cell proliferation rate was calculated compared to 0-72 hours, and cell proliferation curves were plotted. The results are shown below. Figure 6 As shown, cells expressing SKAP2::RAF1 fusion proliferated significantly faster than cells in other groups, indicating that SKAP2::RAF1 fusion can promote cell proliferation.
[0053] To further investigate the sensitivity of cells expressing the SKAP2::RAF1 fusion to targeted drugs, HEK-293T cells were transfected with an empty vector (Control), SKAP2, RAF1, or SKAP2::RAF1 expression plasmid, respectively. After culturing for 48 h, dimethyl sulfoxide (DMSO, MERCK Pharmaceuticals, USA, as a negative control) or 20 μM of the MEK inhibitor trametinib (Abmole Pharmaceuticals, USA, M1759) was added, respectively. After 24 h of drug treatment, cells were collected, proteins were extracted, and Western blot analysis was performed. The results are as follows: Figure 7 As shown, cells expressing the SKAP2::RAF1 fusion were sensitive to trametinib (p-MEK1 / 2 and p-ERK1 / 2 expression levels were significantly decreased). After culturing cells transfected with the above plasmid for 48 h, DMSO or 20 μM of the RAF1 inhibitor sorafenib (Abmole, M3026, USA) was added, respectively. After 24 h of drug treatment, cells were collected, proteins were extracted, and Western blot analysis was performed. The results are shown below. Figure 8As shown, cells expressing the SKAP2::RAF1 fusion gene are sensitive to sorafenib (p-MEK1 / 2 and p-ERK1 / 2 expression levels are significantly decreased). These results provide a valuable reference for the application of targeted therapies such as trametinib and sorafenib in patients carrying this SKAP2::RAF1 fusion gene.
[0054] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described with reference to preferred embodiments, those skilled in the art should understand that various changes in form and detail can be made without departing from the spirit and scope of the invention as defined in the appended claims.
Claims
1. SKAP2::RAF1 The application of fusion genes as targets in the preparation of reagents for treating Langerhans histiocytosis; SKAP2::RAF1 The nucleotide sequence of the fusion gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The reagent is reduced SKAP2::RAF1 Expression of fusion genes.
3. The application according to claim 1, characterized in that, The reagents include trametinib and sorafenib.
4. The application according to claim 1, characterized in that, The SKAP2::RAF1 The amino acid sequence of the fusion gene expression is shown in SEQ ID NO.
2.
5. The application according to claim 1, characterized in that, The reagent inhibits SKAP2::RAF1 The constitutive activation of the MAPK pathway is mediated by the fusion gene.
6. The application according to claim 1, characterized in that, The reagent inhibits SKAP2::RAF1 Cell proliferation promoted by fusion genes.
7. A drug for treating Langerhans cell histiocytosis, characterized in that, The drug inhibits SKAP2::RAF1 Expression of fusion genes.
8. A diagnostic kit for Langerhans cell histiocytosis, characterized in that, The test kit includes a detection... SKAP2::RAF1 Reagents for fusing gene expression levels.
9. SKAP2::RAF1 Application of fusion genes as biomarkers in the preparation of diagnostic reagents for Langerhans histiocytosis.