Phage library construction method based on lysine selective photocyclization strategy of genetic coding and application thereof

Abstract

This invention belongs to the interdisciplinary field of biotechnology and chemical biology, specifically relating to a method for constructing a phage cyclic peptide library based on a genetically encoded lysine-selective photoinduced cyclization strategy and its application. It includes: S1, displaying peptide sequences on the surface of a phage to obtain a phage-displayed peptide library; the peptides contain lysine AAG and a stop codon TAG encoding a non-natural amino acid; the template for the peptide sequence is A-K-X. n -K*-B, where K represents lysine, K* represents a non-natural amino acid, n represents any number of amino acids, and A and B represent any number of amino acids at the C-terminus and N-terminus, respectively; S2, combine the phage library with tRNA pyl CUA / MmPylRS (Y306A / Y384F) orthogonal enzyme co-transformation introduces o-NBAK into the TAG site encoded by the phage gene, forming a complete phage display library; S3, site-selective circularization is performed under ultraviolet light irradiation to obtain a circularized phage display cyclic peptide library, which is then used for target protein screening.

Description

Technical Field

[0001] This invention belongs to the interdisciplinary field of biotechnology and chemical biology, specifically relating to a method for constructing a phage cyclic peptide library based on a genetically encoded lysine-selective photoinduced cyclization strategy and its application. Background Technology

[0002] Cyclic peptides, due to their restricted conformational structure, often exhibit superior binding ability to protein targets that are traditionally difficult to target compared to linear peptides. They also possess advantages in terms of resistance to enzymatic degradation and cell membrane penetration. Therefore, peptide cyclization is considered an important strategy for developing therapeutic agents and biorecognition tools.

[0003] Phage display technology, as an effective platform for high-throughput screening of high-affinity peptides and cyclic peptides, has been widely used in target protein screening and protein-protein interaction studies. However, existing phage display libraries mainly focus on linear peptides or cyclic peptides that depend on natural amino acids. Common methods include using cysteine ​​residues to form disulfide bonds, using chemical cross-linking agents for side chain linkage, or performing in vitro chemical modification of peptides after phage display. These cyclization strategies generally suffer from problems such as limited cyclization sites, insufficient reaction selectivity, poor compatibility with phage biological systems, or the need for additional chemical treatment, making it difficult to achieve precise control and large-scale construction of cyclic peptide libraries.

[0004] In recent years, the genetic coding technology of non-natural amino acids has provided a new approach to expanding the chemical space of phage display systems. By introducing non-natural amino acids with specific reactivity into peptide sequences, the cyclization sites and reaction types of cyclic peptides can be designed with good selectivity, which helps to improve cyclization efficiency and enhance the consistency of cyclic peptide structures. Summary of the Invention

[0005] The purpose of this invention is to overcome the problems of insufficient selectivity, inconsistent conformation, poor compatibility, difficulty in scaling up, and potential side reactions in existing cyclic peptide construction methods, and to provide a phage cyclic peptide library construction method based on a genetically encoded lysine-selective photoinduced cyclization strategy and its application.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a phage cyclic peptide method based on a genetically encoded lysine-selective photoinduced cyclization strategy, wherein a non-natural amino acid (o-NBAK) is introduced into the phage, and under ultraviolet light irradiation conditions, The o-nitrobenzyl group in the peptide undergoes photolysis to generate an active electrophilic intermediate, which is then attacked by the ε-amino group of the adjacent lysine residue to form a stable CN covalent bond, thereby achieving site-selective cyclization of the peptide chain.

[0007] Specifically, the following steps are included: S1. Design random peptide sequences containing AAG (lysine) and TAG (o-NBAK); Specifically, the random sequence is: KVLFGRLCTRK* (K* represents o-NBAK). This peptide sequence and PⅢ protein were constructed into the Pet22b vector.

[0008] S2, using tRNA pyl CUA / MmPylRS (Y306A / Y384F) orthogonal enzyme, introduces o-NBAK into the TAG site encoded by the phage particle gene; Specifically, the Pet22b vector (containing the target fragment) and tRNA pyl CUA / MmPylRS (Y306A / Y384F) orthogonal enzymes were co-transformed at a molar ratio of 1:1. The enzymes were cultured in 100 ml of 2xYT until OD600 = 0.7-0.8, then 2 mM o-NBAK and 1 mM IPTG were added, and expression was carried out overnight at 37°C and 220 rpm. The product was purified using a Ni column.

[0009] S3. A cyclic peptide structure is formed under ultraviolet light irradiation; Specifically, the purified product was replaced with PBS 7.4. The cyclization reaction was completed using a 24 W UV lamp with a wavelength of 365-375 nm at room temperature for 10-15 minutes.

[0010] Secondly, regarding the construction method of phage cyclic peptides based on a genetically encoded lysine-selective photoinduced cyclization strategy, this invention also provides a method for constructing a phage cyclic peptide library based on a genetically encoded lysine-selective photoinduced cyclization strategy; displaying a polypeptide library containing lysine on a phage, and introducing a non-natural amino acid (o-NBAK) into the phage to cyclize the polypeptide library, specifically including the following steps: S1. Display the polypeptide sequence on the surface of a phage to obtain a phage display polypeptide library; the polypeptide contains lysine (AAG) and a stop codon (TAG) encoding a non-natural amino acid.

[0011] Specifically, template: AKX n -K*-B, where K represents lysine, K* represents a non-natural amino acid, n represents any number of amino acids, and A and B represent any number of amino acids at the C-terminus and N-terminus, respectively.

[0012] Preferably, the polypeptide sequence fused and expressed on the surface of the phage is: KXXXXXXXXXK* Here, X represents a random amino acid, which is introduced at a specified position using the NNK method.

[0013] Based on the above polypeptide sequence, the corresponding DNA sequence is designed as follows: KX9K*-F:5'-CATGCTGCCATGGCTGCCNNKNNKNNKNNKNNKNNKNNKNNKNNKTAGGGTTCAGGTGGATCCAAA-3'. KX9K*-R:5'-CATGTTTGGATCCACCTGAACC-3'. The number of amino acids in the above DNA sequence can be increased or decreased as needed. All changes in polypeptide conformation and other modifications made in this invention shall be considered within the scope of protection of this patent.

[0014] S2, Integrating the phage library with tRNA pyl CUA / MmPylRS (Y306A / Y384F) orthogonal enzyme co-transformation introduces o-NBAK into the TAG site encoded by the phage gene, forming a complete phage display library.

[0015] The non-natural amino acid structures used to construct the phage cyclic peptide library S3. Site-selective cyclization was performed under ultraviolet light irradiation to obtain a cyclized phage display cyclic peptide library, which was then used for target protein screening.

[0016] In one detailed implementation, the method for constructing a phage-displaying cyclic peptide library includes the following steps: S1. Using pSEX81 plasmid as a template, a phage library was constructed using the insertion method, employing the following two primer sequences: KX9K*-F:5'-CATGCTGCCATGGCTGCCNNKNNKNNKNNKNNKNNKNNKNNKNNKTAGGGTTCAGGTGGATCCAAA-3'. KX9K*-R:5'-CATGTTTGGATCCACCTGAACC-3'. The extension was performed, and the extension product and pSEX81 template were digested with restriction endonucleases BamHI and NcoI to produce identical sticky ends. The vector and the target extension fragment were ligated using T4 DNA ligase at 16°C for 36 hours, and the ligation product was replaced with pure water for subsequent experiments.

[0017] S2, Ligation product and tRNA pyl CUA / MmPylRS (Y306A / Y384F) orthogonal enzymes were used at a molar ratio of 1:1 to transform *E. coli* TOP10F' competent cells using electroporation. The electroporation products were plated on 2xYT solid plates to evaluate ligation and transformation efficiency. Helper phages, non-natural amino acids, and IPTG were added to the electroporated library to obtain a complete phage display line peptide library.

[0018] S3, with a titer greater than 10. 10 A phage display linear peptide library was obtained at pfu / mL. The reaction was completed using a 24 W UV lamp at 365-375 nm at 25°C for 10-15 minutes. After the reaction, PEG-NaCl solution was added, and the mixture was incubated overnight at 4°C to allow the phages to precipitate. Following precipitation, the precipitate was centrifuged at high speed, and then resuspended in PBS 7.4 buffer to obtain the non-natural amino acid-modified phage display cyclic peptide library.

[0019] The amount of PEG-NaCl added is 1 / 4 to 1 / 6 of the total volume; the centrifugation conditions can be 10,000 rpm for 25 minutes.

[0020] Thirdly, phage cyclic peptide libraries are used for screening target proteins. The target protein includes, but is not limited to, the MTHFD2 and USP8 binding protein. Take 10 10 A pfu / ml phage display cyclic peptide library was added to 15 μL of streptavidin magnetic beads and incubated at 25°C for 2 hours. Then, 100 mM D-biotin blocking magnetic beads were added. The target protein was then added and incubated at 25°C for 30-60 minutes.

[0021] Unbound or weakly bound phages were removed through a washing step. Specifically bound phages were then eluted and recovered, and amplified for the next round of screening. After multiple rounds of in vitro panning, phages specifically binding to the target protein were gradually enriched. Finally, single colonies were selected for DNA sequencing to resolve the amino acid sequences of the peptides interacting with the target protein. The amino acid sequences of the affinity peptide ligands for the MTHFD2 and USP8 binding proteins are: Ac-KGHWRSANRLK*-NH2 and Ac-KASLGTPRRHK*-NH2 (K* represents o-NBAK).

[0022] After synthesizing peptides with high enrichment, a cyclization reaction was carried out. The affinity between the cyclic peptide ligand and the target protein was verified by biophysical experiments to test the feasibility and effectiveness of the cyclization and screening methods.

[0023] Compared with the prior art, the present invention has the following advantages: 1. This invention provides a phage cyclic peptide method based on a genetically encoded lysine-selective photoinduced cyclization strategy. Under ultraviolet light irradiation, the o-nitrobenzyl group in O-NBAK undergoes photolysis, generating an active electrophilic intermediate. This intermediate is then nucleophilically attacked by the ε-amino group of a neighboring lysine residue, forming a stable CN covalent bond, thereby achieving site-selective cyclization of the peptide chain. This method features high site specificity, high controllability of cyclization, conformational consistency, few side reactions, no need for exogenous cross-linking agents, non-enzyme dependence, high system compatibility, suitability for large-scale library construction, and scalable chemical space.

[0024] 2. This method was applied to the construction of phage-displayed cyclic peptide libraries. By introducing polypeptide sequences containing non-natural amino acids into the phage display system, cyclization was achieved using lysine-non-natural amino acid (O-NBAK) photoclick chemistry, resulting in a diverse cyclic peptide library and expanding the cyclization construction of phage cyclic peptide libraries. This method facilitates the acquisition of high-quality cyclic peptide ligands that specifically bind to targets, avoiding the problems of poor biocompatibility and insufficient stability in traditional cyclic peptide construction and screening methods. It can be widely applied in related biotechnology and drug development research. Attached Figure Description

[0025] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the embodiments of the invention to explain the invention and do not constitute a limitation thereof.

[0026] Figure 1 A schematic diagram of a phage display cyclic peptide library for lysine, a non-natural amino acid.

[0027] Figure 2 Mass spectrometry and SDS-PAGE characterization of lysine-non-natural amino acid cyclization modification on capsid proteins.

[0028] Figure 3 This is a pull-down validation diagram of the phage cyclic peptide library.

[0029] Figure 4 Sequencing sequence diagram for phage cyclic peptide library construction.

[0030] Figure 5 This is a graph showing the phage infection activity under different light exposure times.

[0031] Figure 6 A flowchart showing the selection process for bacteriophages.

[0032] Figure 7 This is a graph showing the NGS sequencing analysis of the MTHFD2 selection results.

[0033] Figure 8 This is a diagram of the peptide sequence obtained by panning and sequencing MTHFD2.

[0034] Figure 9 This is an HPLC characterization of the cyclic peptide CMT1 targeting MTHFD2.

[0035] Figure 10 This is a BLI sensing diagram of CMT1 and the target protein MTHFD2.

[0036] Figure 11 This is an SPR sensing diagram of CMT1 and the target protein MTHFD2.

[0037] Figure 12 This is a graph showing the NGS sequencing analysis of the USP8 selection results.

[0038] Figure 13 This is a diagram of the peptide sequence obtained by panning and sequencing USP8.

[0039] Figure 14 This is the HPLC characterization of the cyclic peptide CUS1 targeting USP8.

[0040] Figure 15 This is a BLI sensing diagram of CUS1 and the target protein USP8.

[0041] Figure 16 This is an SPR sensing diagram of CUS1 and the target protein USP8.

[0042] Figure 17 To study the serum stability of cyclic peptides obtained from panning MTHFD2 protein.

[0043] Figure 18 To study the serum stability of cyclic peptides obtained from USP8 protein panning. Detailed Implementation

[0044] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0045] The following detailed embodiments illustrate the method for constructing a phage cyclic peptide library based on a genetically encoded lysine-selective photoinduced cyclization strategy and its applications. Example 1:

[0046] This embodiment provides a method for constructing phage cyclic peptides based on a genetically encoded lysine-selective photoinduced cyclization strategy, including the following steps: S1. Immobilize the pattern peptide 1 KVLFGRLCTRK* (K* stands for o-NBAK) at the N-terminus of the D1D2 domain of the pIII protein, and then combine the recombinant protein with tRNA. pyl CUA / MmPylRS (Y306A / Y384F) was co-transduced into BL21(DE3) Escherichia coli, and the bacterial culture was cultured to OD600 = 0.7-0.8. Then, 1mM IPTG and 2mM o-NBAK were added for expression.

[0047] S2. The purified fusion protein from S1 was transferred to PBS 7.4 buffer. The cyclization reaction was completed by irradiation with a 24 W UV lamp at 365-375 nm at room temperature for 10-15 minutes followed by incubation for 30 minutes. The molecular weight of the purified product was determined by MS using 10 μM of the product. Figure 2 MS data showed that the photocatalyzed protein sample underwent a corresponding mass shift compared to the unmodified protein, indicating that the fusion peptide on the pIII protein underwent cyclization. Furthermore, SDS-PAGE further confirmed the successful introduction and cyclization of non-natural amino acids. Figure 2 ). Example 2:

[0048] This embodiment provides a method for constructing phage cyclic peptides based on a genetically encoded lysine-selective photoinduced cyclization strategy, including the following steps: S1. Design and construct lysine-free random peptide sequences and embed them into the pSEX81 phage vector. The constructed product and tRNA... pyl CUA / MmPylRS (Y306A / Y384F) was co-transduced into E. coli TOP10F', and expression was performed with 1mM IPTG and 2mMo-NBAK to prepare a phage display linear peptide library. 10 11 A pfu / ml linear peptide library was cyclized by adding 2 mM Biotin-lysine under a 365-375 nm UV lamp at room temperature for 10-15 minutes followed by incubation for 30 minutes. PEG-NaCl was then added and the mixture was incubated overnight at 4°C. The precipitate was resuspended in 200 μL PBS, centrifuged, and the supernatant was collected for later use. Figure 3 ).

[0049] Take 25 μL of streptavidin magnetic beads and add them to the sample prepared above. Incubate at 25°C for 1 h. After magnetic separation, infect the supernatant with TG1 bacterial culture in the logarithmic growth phase and adjust the titer to determine the capture efficiency.

[0050] The specific primers are as follows: KX9K*-F:5'-CATGCTGCCATGGCTGCCNNKNNKNNKNNKNNKNNKNNKNNKNNKTAGGGTTCAGGTGGATCCAAA-3' KX9K*-R:5'-CATGTTTGGATCCACCTGAACC-3'. Example 3:

[0051] This embodiment provides a method for constructing a phage cyclic peptide library based on a genetically encoded lysine-selective photoinduced cyclization strategy, which employs the following steps ( Figure 1 ).

[0052] 1. Constructing phage libraries 1.1 The polypeptide sequence displayed on the surface of the bacteriophage is: KXXXXXXXXXK* (K* represents o-NBAK). Random amino acid mutations are introduced at specified positions using the NNK method, and the corresponding DNA sequence is designed based on the polypeptide sequence.

[0053] KX9K*-F:5'-CATGCTGCCATGGCTGCCGGTGGCTCAGGCGGTAAGNNKNNKNNKNNKNNKNNKNNKNNKNNKTAGGGATCCGGAGATATCAGAGCTGAAAC-3' KX9K*-R:5'-CATGTTTGGATCCACCTGAACCAGC-3'. In the phage vector pSEX81, the library fragments were inserted using the BamHI and NcoI double restriction sites.

[0054] 1.2 Constructing the K-X9-K* Library Primer design K-X9-K*: Take the upstream F and downstream R of the primers, add 10×E Taq buffer, and bring the volume up to the required level with water. Anneal the sample by naturally cooling it from 95℃ to 25℃ in water. Prepare a 50 μL reaction mixture with dNTP Mix (10 mM), Klenow enzyme, ABbuffer B, and water. Extend the sample according to the following induction schedule: 37℃ for 10 minutes, 65℃ for 15 minutes, and 37℃ for 20 minutes. Double digest the extended sample with BamHI and NcoI, and recover the digested products using DNA-PAGE gel. Simultaneously, double digest the pSEX81 phage vector with BamHI and NcoI and recover it using 1% agarose gel. Ligate the target fragment and the phage vector using T4 DNA ligase. Replace the ligation product with pure water and combine with tRNA. pyl CUA / MmPylRS (Y306A / Y384F) was transformed into competent *E. coli* TOP10F' at a molar ratio of 1:1 via electroporation to evaluate ligation and transformation efficiency. The transformants were incubated at 37°C and 220 rpm for one hour. A 10 μL sample was then diluted to determine the titer, and 20 single cloning sites were randomly selected for DNA sequencing. Figure 4 ).

[0055] 2. Preparation of phage cyclic peptide libraries The transformed sample constructed in step 1 was inoculated into 1.2 L of 2xYT medium containing 50 μg / mL carbenicillin and 30 μg / mL, and cultured at 37℃ and 220 rpm until OD. 600 The concentration was 0.1-0.2, with the addition of helper phage (10). 14 Infect the culture at 37°C for 2 hours, then add 50 μg / mL kanamycin, 1 mM IPTG, and 2 mM o-NBAK, and incubate at 37°C for 10-12 hours. Remove the bacterial pellet by centrifuging the culture medium at 4°C and 8000 rpm for 20 minutes. Collect the supernatant and add 1 / 4-1 / 6 volume of PEG-NaCl for sedimentation at 4°C (or place on ice for sedimentation for 4-6 hours). Centrifuge at 4°C and 10000 rpm for 20 minutes to collect the pellet, resuspend in 4 mL of PBS, and add 1 mM TCEP to reduce the phage library. Add 30% glycerol and store at -80°C.

[0056] 3. Determination of phage cyclic peptide library titer Take 10 μL of the diluent and add it to 990 μL of 2×YT liquid medium for dilution. Then, serially dilute to 10⁻⁶. -8 -10 -10 Add 100 μL of the diluent to 100 μL of Escherichia coli TG1 culture medium (logarithmic growth phase), incubate at room temperature for 30 minutes, then spread the infection solution evenly on the surface of a solid plate containing 50 μg / mL carbenicillin and 50 μg / mL chloramphenicol, invert it and incubate at 37 ℃ for 12 hours, then remove it and count the titers.

[0057] The effect of light on bacteriophage survival Take 10 11 A pfu / ml linear peptide library (adjusted to 1000 μL with PBS) was divided into 5 equal parts and subjected to light exposure for 0 min, 10 min, 15 min, 20 min, and 25 min. 10 μL of each sample was used to infect logarithmically growing E. coli TG1, and the phage colony count was observed after plating. Figure 5 ). Example 4:

[0058] This embodiment provides a method for screening cyclic peptide ligands, which is constructed using the following steps.

[0059] 1. Cyclic peptide library cyclization Take 10 11 A pfu / ml linear peptide library (adjusted to 300 μL with PBS) was subjected to cyclization under UV light at 365-375 nm at room temperature for 10-15 minutes, followed by incubation for 30 minutes. 1 / 6-1 / 4 volume of PEG-NaCl was added to the reaction volume, and the mixture was incubated overnight at 4°C. The precipitate was resuspended in 100 μL of PBS and centrifuged at 10,000 rpm for 20 minutes at 4°C. The supernatant was then collected for later use.

[0060] 2. Wash 5 μL of streptavidin magnetic beads were washed 8 times with TBS. After magnetic separation, a phage cyclic peptide library was added and the mixture was blocked at 25°C for 4 hours. The supernatant was collected for later use. Target proteins (MTHFD2, USP8) were added to the supernatant and bound at 25°C for 2 hours. Separately, 15 μL of streptavidin magnetic beads were blocked with TBS containing 2% BSA at 37°C for 2 hours. The conjugate and blocked streptavidin magnetic beads were co-incubated at 25°C for 30 minutes. Unbound and low-affinity phages were then washed with 0.5% Tween 20. 100 μL of Gly-HCl (pH 2.2) was added and eluted at 25°C for 60 rpm for 10 minutes. Then, 15 μL of Tris-HCl (pH 9.1) was added to neutralize the elution buffer. 10 μL of the solution was serially diluted and used to infect E. coli TG1 in the logarithmic growth phase, and the titer was measured. Figure 6 ).

[0061] 3. Amplification Infect the eluent with tRNA pyl CUA In *E. coli* TOP10F' containing the / MmPylRS (Y306A / Y384F) orthogonal enzyme, cultured at 37℃ and 220 rpm until OD... 600 The concentration was 0.1-0.2, with the addition of helper phage (10). 14 Infect the culture at 37°C for 2 hours, then add 50 μg / mL kanamycin, 1 mM IPTG, and 2 mM o-NBAK, and incubate at 37°C for 10-12 hours. Remove the bacterial pellet by incubating the culture medium at 4°C and 8000 rpm for 20 minutes. Collect the supernatant and add 1 / 4-1 / 6 volume of PEG-NaCl to precipitate at 4°C (or place on ice to precipitate for 4-6 hours). Centrifuge to collect the supernatant.

[0062] 4. Sequencing Complete MTHFD2 ( Figure 7 ,8) and USP8 ( Figure 12 13) After three rounds of screening, the products from the three rounds of screening were infected with E. coli TG1 in the logarithmic growth phase and grown to OD. 600 Plasmids were extracted after step 1.0. A second-generation sequencing library was constructed based on the NGS sequencing primers, and decoding was performed.

[0063] NGS-F:AATGATACGGCGACCACCGAGATCTACACTATAGCCTTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGCTCGTATGTTGTGTG NGS-R:CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTCGTCTTTCCAGACGTTAG 5. Solid-phase synthesis of peptides 5.1 Fmoc-o-NBAK for solid-phase synthesis In solid-phase synthesis, because o-NBAK is a non-natural amino acid and cannot be synthesized directly like conventional amino acids, Fmoc-protected o-NBAK needs to be synthesized separately. The synthetic structure is as follows: Fmoc-o-NBAK 5.2 Peptide Synthesis The linear peptide was synthesized using a solid-phase synthesis method. Firstly, because the non-natural amino acid is located at the C-terminus of the peptide, it needs to be coupled to an amino resin before synthesis. Therefore, amino acid E is first coupled to the resin to improve the coupling of Fmoc-o-NBAK, followed by the synthesis of the Fmoc-o-NBAK non-natural amino acid. The remaining amino acids were synthesized using conventional solid-phase synthesis. The purity and structure of the synthesized peptide were first verified by high-resolution mass spectrometry (ESI-HRMS). A certain amount of crude peptide was purified by preparative reversed-phase high-performance liquid chromatography (HPLC), analyzed by analytical HPLC, and then lyophilized. Subsequently, the linear peptide was photocyclized, and the resulting cyclic peptide was purified by preparative reversed-phase HPLC and further verified for purity and structure by analytical HPLC and ESI-HRMS.

[0064] Based on the enriched peptide sequences obtained from sequencing results, the following peptides were synthesized, including but not limited to: The peptide sequences screened for MTHFD2 are as follows: Ac-KGHWRSANRLK*-NH2 (MT1) (K* represents o-NBAK); The peptide sequences screened for USP8 are as follows: Ac-KASLGTPRRHK* -NH2(US1); Its purity and structure were verified by analytical HPLC and ESI-HRMS. For the MTHFD2 protein, ESI before cyclization was performed. + -HRMS: calcd. for C 75 H 114 N 26 O 22 [M + 2H] 2+ m / z = 866.4378, found 866.4355, ESI after circumsimplification + -HRMS: calcd. for C 75 H 110 N 26 O 20 [M + 2H] 2+ m / z = 848.4273, found848.9280( Figure 9 For the USP8 protein, the pre-cyclization ESI... + -HRMS: calcd. for C 69 H 112 N 24 O 22 [M + 2H] 2+ m / z = 815.4270, found 815.4249, ESI after cyclization + -HRMS: calcd. for C 69 H 108 N 24 O 20 [M + 2H] 2+ m / z = 797.4164, found 797.4160 ( Figure 14 ). Example 5:

[0065] This embodiment performs performance tests on the cyclic peptide prepared in Example 4, as detailed below.

[0066] 1. Biolayer Interference (BLI) to determine the affinity between target proteins and linear and cyclic peptides. The linear peptide MT1 was diluted with 0.05% PBS-Tween 20 to 0.18 μM, 0.54 μM, 1.62 μM, 4.86 μM, and 14.58 μM, and the cyclic peptide CMT1 was diluted to 25 nM, 50 nM, 100 nM, 200 nM, and 400 nM. The target protein MTHFD2 was diluted with 0.05% PBS-Tween 20 to 20 μg / mL, and background conditions were set without the target protein and without the peptide ligand. The affinity of the target protein for the peptide ligand under different concentration gradients was globally fitted after background subtraction. The mean value of three parallel experiments was used to calculate the affinity between the MT1 linear peptide and MTHFD2 as 1.8 ± 0.8 μM; similarly, the affinity between the CMT1 cyclic peptide ligand and MTHFD2 was calculated to be 85 ± 20 nM. Figure 10 ).

[0067] The linear peptide US1 was diluted with 0.05% PBS-Tween 20 to 3 μM, 6 μM, 12 μM, 24 μM, and 48 μM, and the cyclic peptide CUS1 was diluted to 300 nM, 600 nM, 1200 nM, 2400 nM, and 4800 nM. The target protein USP8 was diluted with 0.05% PBS-Tween 20 to 10 μg / mL. Backgrounds without target protein and without peptide ligand were set. After background subtraction, the affinity of the target protein for the peptide ligand under different concentration gradients was globally fitted. The mean value of three parallel experiments was used to calculate that there was no affinity between the US1 linear peptide ligand and USP8, and the affinity of the CUS1 cyclic peptide ligand was 920 ± 50 nM. Figure 15 ).

[0068] 2. Surface plasmon resonance (SPR) determination of affinity The linear peptide MT1 was diluted with 1x PBS-P+ to 0.2 μM, 0.4 μM, 8 μM, 1.6 μM, and 3.2 μM, and the cyclic peptide CMT1 was diluted to 50 nM, 100 nM, 200 nM, 400 nM, and 800 nM. The target protein MTHFD2 was diluted with 1x PBS-P+ to 20 μg / mL. MTHFD2 was immobilized on the NTA chip surface using a standardized amino-peptide conjugation method. Different concentrations of peptides were sequentially used to bind to the target protein. A 1:1 binding model was used for fitting analysis. After three parallel experiments, the mean value was calculated to yield an affinity of 1.14 ± 0.5 μM between the MT1 linear peptide and MTHFD2. Similarly, the affinity between the CMT1 cyclic peptide ligand and MTHFD2 was calculated to be 116 ± 30 nM. Figure 11 ).

[0069] The linear peptide US1 was diluted with 1x PBS-P+ to 6 μM, 12 μM, 24 μM, 48 μM, and 96 μM, and the cyclic peptide CUS1 was diluted to 200 nM, 400 nM, 800 nM, 1600 nM, and 3200 nM. The target protein USP8 was diluted with 1x PBS-P+ to 20 μg / mL. The protein USP8 was immobilized on the NTA chip surface using a standardized amino-peptide conjugation method. Different concentrations of peptides were sequentially used to bind to the target protein. Finally, a 1:1 binding model was used for fitting analysis. The affinity between the US1 linear peptide and USP8 was calculated by averaging the results from three parallel experiments. Similarly, the affinity between the CUS1 cyclic peptide ligand and USP8 was calculated to be 1.1 ± 0.5 μM. Figure 16 ).

[0070] 3. Serum stability study of cyclic peptides Sample incubation: Prepare a 0.01 mol / L stock solution of MTHFD2 and USP8 cyclic peptide. Add 30 μL of the stock solution to 570 μL of mouse plasma, immediately vortex to mix, and then quickly remove 50 μL of the mixture and add it to a centrifuge tube, timing the incubation at 0 h. Incubate the remaining mixture in a 37°C water bath, removing 50 μL of sample at 0, 0.5, 1, 2, 4, and 8 h. After removing the sample, immediately add an equal volume of ice-cold acetonitrile to precipitate the protein. After vortexing and mixing, centrifuge at 13000g for 15 min at 4°C, collect the supernatant, and analyze it by RP-HPLC. Analyze the peak areas of the sample at different time points, and calculate the analyte MTHFD2 using a first-order kinetic equation. Figure 17 ) and USP8 ( Figure 18 The half-life (t) 1 / 2 ).

[0071] In summary, this invention establishes a genetically encoded lysine-selective photoinduced cyclization strategy by introducing the non-natural amino acid o-NBAK into phage-displayed peptides and utilizing the mild and biocompatible PANAC reaction. This enables close-range induced macrocyclization reactions with precise spatiotemporal control. For the first time, a lysine-selective cyclic peptide library was constructed on phages through the introduction of non-natural amino acids, demonstrating a robust and versatile platform for discovering cyclic peptide molecules with well-defined structures and biological activities.

[0072] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention. No reference numerals in the claims should be construed as limiting the scope of the claims.

Claims

1. A method for constructing phage cyclic peptides based on a genetically encoded lysine-selective photoinduced cyclization strategy, characterized in that, Includes the following steps: S1. Design a random peptide sequence containing AAG and TAG; the random peptide sequence is: KVLFGRLCTRK*, where K* represents o-NBAK; construct the peptide sequence and PⅢ protein into the Pet22b vector; S2, using tRNA pyl CUA The / MmPylRS (Y306A / Y384F) orthogonal enzyme introduces o-NBAK into the TAG site encoded by the phage particle gene; the Pet22b vector containing the target fragment and tRNA... pyl CUA / MmPylRS (Y306A / Y384F) orthogonal enzymes were co-transformed at a molar ratio of 1:1; cultured in 100 ml of 2xYT until OD600 = 0.7-0.8, then 2 mM o-NBAK and 1 mM IPTG were added, and expression was carried out overnight at 37℃ and 220 rpm. The product was purified by Ni column chromatography. S3. A cyclic peptide structure is formed under ultraviolet light irradiation; the purified product is replaced with PBS 7.4 and the cyclization reaction is completed using a 24 W ultraviolet lamp with a wavelength of 365-375 nm at room temperature for 10-15 minutes.

2. A method for constructing a phage cyclic peptide library based on a genetically encoded lysine-selective photoinduced cyclization strategy, characterized in that, Includes the following steps: S1. Display the polypeptide sequence on the surface of a phage to obtain a phage-displayed polypeptide library; the polypeptide contains lysine AAG and a stop codon TAG encoding a non-natural amino acid; The template for the polypeptide sequence is AKX. n -K*-B, where K represents lysine, K* represents a non-natural amino acid, n represents any number of amino acids, and A and B represent any number of amino acids at the C-terminus and N-terminus, respectively; S2, Integrating the phage library with tRNA pyl CUA / MmPylRS (Y306A / Y384F) orthogonal enzyme co-transformation introduces o-NBAK into the TAG site encoded by the phage gene, forming a complete phage display library; S3. Site-selective cyclization was performed under ultraviolet light irradiation to obtain a cyclized phage display cyclic peptide library, which was then used for target protein screening.

3. The method for constructing a phage cyclic peptide library based on a genetically encoded lysine-selective photoinduced cyclization strategy according to claim 2, characterized in that: In S1, the polypeptide sequence fused to the surface of the phage is: KXXXXXXXXXK*, where X represents a random amino acid, and random amino acid mutations are introduced at a specified position using the NNK method.

4. The method for constructing a phage cyclic peptide library based on a genetically encoded lysine-selective photoinduced cyclization strategy according to claim 3, characterized in that: The polypeptide sequence was subjected to random amino acid mutations at designated positions using the NNK method, and the corresponding DNA sequence is as follows: KX9K*-F:5'-CATGCTGCCATGGCTGCCNNKNNKNNKNNKNNKNNKNNKNNKNNKTAGGGTTCAGGTGGATCCAAA-3' KX9K*-R:5'-CATGTTTGGATCCACCTGAACC-3'.

5. The method for constructing a phage cyclic peptide library based on a genetically encoded lysine-selective photoinduced cyclization strategy according to claim 2, characterized in that: In S2, the ligation product is combined with tRNA. pyl CUA / MmPylRS (Y306A / Y384F) orthogonal enzymes were used to transform E. coli TOP10F' competent cells by electroporation at a molar ratio of 1:

1. The electroporation products were plated on 2xYT solid plates to evaluate ligation and transformation efficiency. Helper phages, non-natural amino acids, and IPTG were added to the electroporated library to obtain a complete phage display line peptide library.

6. The method for constructing a phage cyclic peptide library based on a genetically encoded lysine-selective photoinduced cyclization strategy according to claim 2, characterized in that: In S3, the titer is greater than 10. 10 A phage display linear peptide library was obtained at pfu / mL. The reaction was completed using a 24 W UV lamp at 365-375 nm at 25°C for 10-15 minutes. After the reaction, PEG-NaCl solution was added, and the mixture was incubated overnight at 4°C to allow the phages to precipitate. Following precipitation, the precipitate was centrifuged at high speed, and then resuspended in PBS 7.4 buffer to obtain the non-natural amino acid-modified phage display cyclic peptide library.

7. The method for constructing a phage cyclic peptide library based on a genetically encoded lysine-selective photoinduced cyclization strategy according to claim 6, characterized in that: The amount of PEG-NaCl added is 1 / 4 to 1 / 6 of the total volume; the centrifugation conditions can be 10,000 rpm for 25 minutes.

8. The application of a phage display cyclic peptide library constructed according to any one of claims 2-7 in screening target protein-specific cyclic peptide ligands.

9. A method for screening cyclic peptide ligands, characterized in that, Includes the following steps: S1. The target protein is immobilized on streptavidin magnetic beads and co-incubated with a phage display cyclic peptide library constructed by any of the methods described in claims 2-7; the target protein is MTHFD2 or USP8 binding protein. S2. After incubation, the specifically bound phages are eluted and recovered, and cyclic peptide ligands with specific binding are screened out.

10. The method for screening cyclic peptide ligands according to claim 9, characterized in that, The amino acid sequence of the affinity peptide ligand for MTHFD2 is Ac-KGHWRSANRLK*-NH2, and the amino acid sequence of the affinity peptide ligand for the USP8 binding protein is Ac-KASLGTPRRHK*-NH2, where K* represents o-NBAK.

Images