Anti-helicobacter pylori bispecific antibody, kit and use

CN122541579APending Publication Date: 2026-08-11SICHUAN KAIRUIHUACHUANG BIOTECH INC +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-01
Publication Date
2026-08-11

AI Technical Summary

Technical Problem

[0008]本发明所要解决的技术问题是现有幽门螺杆菌抗原检测存在单一靶点灵敏度有限且高亲和力抗体原料依赖进口、成本高,导致其难以满足大规模、高准确性、低成本的临床筛查与普及应用需求

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122541579A_ABST
    Figure CN122541579A_ABST
Patent Text Reader

Abstract

This invention discloses a bispecific antibody against Helicobacter pylori, a reagent kit, and its applications, relating to the field of Helicobacter pylori antibody preparation. It includes Ca05-Va23 and Ca98-Va187 antibodies obtained through gene recombination. Both the Ca05-Va23 and Ca98-Va187 antibodies comprise two functional domain sequences, each including a heavy chain variable region and a light chain variable region, used to specifically recognize Helicobacter pylori CagA and VacA proteins. This invention solves the problems of limited sensitivity of existing Helicobacter pylori antigen detection methods targeting a single target, reliance on imported high-affinity antibody raw materials, and high costs, making it difficult to meet the needs of large-scale, high-accuracy, and low-cost clinical screening and widespread application. The bispecific antibody of this invention simultaneously targets two key virulence factors of HP, enabling experimental dual-target detection, high affinity, and, compared to traditional murine monoclonal antibodies, effectively reducing interference from heterophile antibodies in reagent development, thereby improving detection specificity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of Helicobacter pylori antibody preparation, specifically to an anti-Helicobacter pylori bispecific antibody, a kit, and its applications. Background Technology

[0002] Helicobacter pylori (HP) is a Gram-negative microaerophilic bacterium. First successfully isolated from gastric mucosal biopsy tissue of a patient with chronic active gastritis in 1983, it is currently the only known microorganism capable of surviving in the human stomach. Approximately half of the global population is infected with HP, and 15-20% of these infected individuals will develop clinical disease. As early as 1994, the International Agency for Research on Cancer (IARC) of the World Health Organization classified it as a Group 1 carcinogen for gastric cancer. After infection, Helicobacter pylori adheres to the gastric mucosa and causes damage to gastric epithelial cells by releasing various virulence factors. Persistent infection can lead to severe gastric lesions or peptic ulcer disease.

[0003] The intensity of the host immune response to Helicobacter pylori infection varies depending on the strain and its virulence. Its main virulence factors include urease (UreB), cytotoxin-associated gene A (CagA), and vacuolating cytotoxin A (VacA). In patients with peptic ulcers, Helicobacter pylori infection carrying CagA and VacA genes is more common; furthermore, infection with CagA and VacA-positive strains is positively correlated with the risk of gastric cancer. CagA protein enters cells via the type IV secretion system, altering the cytoskeleton, disrupting tight junctions between cells, and thus promoting cell proliferation and motility, directly or indirectly participating in the carcinogenesis process. VacA is a secretory bacterial toxin that can cause various cellular pathological changes, such as cellular vacuolization. In vivo, VacA can enhance the colonization ability of Helicobacter pylori in the gastric mucosa and promote the development of diseases such as gastritis and gastric cancer. Unlike CagA, which primarily induces malignant proliferation and DNA damage, VacA tends to trigger apoptosis and necrosis, increasing the probability of gene mutations in cells during the endless damage repair process, ultimately leading to carcinogenesis. It is worth noting that not all existing clinical isolates are double-positive for both CagA and VacA; intermediate phenotype strains expressing only one of the virulence factors still possess potential pathogenicity.

[0004] Currently, clinical diagnostic methods for Helicobacter pylori infection mainly include the urea breath test, endoscopic mucosal biopsy, and fecal antigen testing. The urea breath test relies on specialized equipment, making large-scale rapid screening difficult; while endoscopic mucosal biopsy is an invasive procedure, requiring highly skilled personnel, costly, and has low patient acceptance. In contrast, antigen testing offers advantages such as simplicity, speed, stability, and low manufacturing cost, making it suitable for both clinical specimen testing and epidemiological surveys.

[0005] However, existing commercially available diagnostic reagents mostly target single targets, resulting in limited sensitivity, especially for the aforementioned intermediate phenotype strains, which are prone to false negatives. For example, multiple clinical studies have indicated that immunoassay methods based on a single CagA or VacA antigen can experience a 15%–30% decrease in sensitivity in populations infected with strains expressing only one virulence factor, significantly impacting early diagnosis and efficacy assessment. Furthermore, the distribution of Helicobacter pylori virulence factors varies across different regions, making it difficult for single-target detection to cover all major pathogenic strains, further increasing the risk of false negatives.

[0006] Besides sensitivity issues, the persistently high price of antibody raw materials has also limited the widespread adoption and application of this technology. Currently, most high-affinity monoclonal antibodies used in mainstream reagents rely on imports, and their research and purification costs are high, making it difficult to reduce the cost per test and limiting their application in primary healthcare and large-scale screening scenarios. Therefore, developing novel detection systems with multiple targets, low cost, and high sensitivity has become an important research direction for improving the diagnostic coverage and accuracy of Helicobacter pylori infection.

[0007] Therefore, this application is hereby submitted. Summary of the Invention

[0008] The technical problem this invention aims to solve is that existing Helicobacter pylori antigen detection methods suffer from limited sensitivity against a single target and high cost due to reliance on imported high-affinity antibody raw materials, making it difficult to meet the needs of large-scale, high-accuracy, and low-cost clinical screening and widespread application. The objective is to provide a bispecific antibody against Helicobacter pylori, a reagent kit, and its applications.

[0009] This invention is achieved through the following technical solution: In a first aspect, the present invention provides a bispecific antibody against Helicobacter pylori, comprising Ca05-Va23 antibody and Ca98-Va187 antibody obtained through gene recombination. Both the Ca05-Va23 antibody and the Ca98-Va187 antibody include two functional domain sequences, each functional domain sequence including a heavy chain variable region and a light chain variable region, for specifically recognizing Helicobacter pylori CagA protein and Helicobacter pylori VacA protein.

[0010] Furthermore, the Ca05-Va23 antibody and the Ca98-Va187 antibody can be conjugated to a marker selected from at least one of fluorescent materials, biotin, radioisotopes, metal nanomaterials, and enzymes.

[0011] In some embodiments, the functional domains of the Ca05-Va23 antibody are the scFv1 region and the scFv2 region, respectively. The amino acid sequence of the heavy chain variable region of the scFv1 region is one of SEQ ID NO: 1-81, and the amino acid sequence of its light chain variable region is one of SEQ ID NO: 82-162. The amino acid sequence of the heavy chain variable region of the scFv2 region is one of SEQ ID NO: 163-189, and the amino acid sequence of its light chain variable region is one of SEQ ID NO: 190-216.

[0012] In some embodiments, the functional domains of the Ca98-Va187 antibody are the scFv3 region and the scFv4 region, respectively. The amino acid sequence of the heavy chain variable region of the scFv3 region is one of the amino acid sequences shown in SEQ ID NO: 217-297, and the amino acid sequence of its light chain variable region is one of the amino acid sequences shown in SEQ ID NO: 298-378. The amino acid sequence of the heavy chain variable region of the scFv4 region is one of the amino acid sequences shown in SEQ ID NO: 379-405, and the amino acid sequence of its light chain variable region is one of the amino acid sequences shown in SEQ ID NO: 406-432.

[0013] In some embodiments, the scFv1 and scFv3 regions specifically recognize different epitopes of the CagA protein, and the scFv2 and scFv41 regions specifically recognize different epitopes of the VacA protein.

[0014] In some embodiments, the functional domain sequences of the Ca05-Va23 antibody and the Ca98-Va187 antibody are derived from hybridoma cells prepared using mouse monoclonal antibody technology.

[0015] Secondly, the present invention provides a method for preparing a bispecific antibody against Helicobacter pylori, comprising the following steps: Recombinant proteins VacA-P88-His and CagA-His were prepared using an Escherichia coli expression system; Monoclonal antibodies against VacA-P88 and CagA were prepared using mouse monoclonal antibody technology. Bispecific antibodies against VacA-P88 and CagA were constructed using gene recombination technology.

[0016] Thirdly, the present invention provides a kit for detecting Helicobacter pylori, the kit comprising a bispecific antibody against Helicobacter pylori as described in any one of claims 1-4, for detecting whether a sample contains Helicobacter pylori, and for distinguishing the virulence type of Helicobacter pylori, the virulence type including VacA+ and / or CagA+.

[0017] In some embodiments, the kit includes a reagent strip, wherein the reagent strip includes a sample pad and a detection pad; The sample pad is coated with labeled detection antibodies; The test pad is provided with a test line and a control line, wherein the test line is coated with capture antibody and the control line is coated with goat anti-mouse IgG antibody. The detection antibody and the capture antibody are selected from Ca05-Va23 and Ca98-Va187, respectively.

[0018] In some embodiments, the reagent strip is a colloidal gold test strip or a fluorescent test strip, wherein the colloidal gold particles have a particle size of 55-65 nm; the sample pad is a pretreated glass fiber membrane, and the detection pad is a nitrocellulose membrane; a stacking pad is also provided between the sample pad and the detection pad.

[0019] In this protocol, the detection method differs depending on the type of test strip. When the test strip is a colloidal gold test strip, the detection antibody is labeled with colloidal gold; when the test strip is a fluorescent test strip, the detection antibody is labeled with fluorescent material.

[0020] Fourthly, the present invention also provides the application of the above-mentioned bispecific antibody in the preparation of Helicobacter pylori detection products.

[0021] It should be noted that the testing products in this plan include, but are not limited to, kits, as well as testing reagents and other products.

[0022] Compared with the prior art, the present invention has the following advantages and beneficial effects: 1. The set of bispecific antibodies provided in this embodiment of the invention can simultaneously target two key virulence factors of HP, achieving dual-target detection.

[0023] 2. The set of bispecific antibodies provided in the embodiments of the present invention has high affinity.

[0024] 3. The bispecific antibodies provided in this embodiment of the invention are human-mouse chimeric antibodies. Compared with traditional mouse monoclonal antibodies, they can effectively reduce the interference of heterophilic antibodies in reagent development, thereby improving detection specificity. Attached Figure Description

[0025] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of the present invention and should not be considered as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort. In the drawings: Figure 1The SDS-PAGE spectra of VacA-P88-His and CagA-His recombinant proteins after affinity chromatography purification provided in this embodiment of the invention. Figure 2 The affinity detection results of the monoclonal antibody provided in the embodiments of the present invention; Figure 3 This is a nucleic acid agarose gel electrophoresis pattern of the PCR amplification products of the heavy and light chain genes of monoclonal antibodies provided in this embodiment of the invention; Figure 4 This is a schematic diagram of a bispecific antibody provided in an embodiment of the present invention; Figure 5 The results validate the colloidal gold test strip prepared with bispecific antibodies provided in this embodiment of the invention. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. The illustrative embodiments and descriptions of the present invention are only used to explain the present invention and are not intended to limit the present invention.

[0027] Unless otherwise specified, all reagents involved in the embodiments of this invention are commercially available products and can be purchased through commercial channels.

[0028] Current technologies for detecting Helicobacter pylori infection have low accuracy and low sensitivity, and there are cases of missed diagnoses and misdiagnoses.

[0029] To address the aforementioned problems, this invention provides a set of reagents and applications for detecting Helicobacter pylori using bispecific antibodies.

[0030] Example 1: Preparation of VacA-P88-His and CagA-His recombinant proteins 1. Construction and identification of prokaryotic expression vectors Cultured on trypsin-soybean agar plates containing 5% sheep blood under microaerophilic conditions. H. pylori Wild-type strain Hp-26695 (ATCC). Subsequently, this strain was cultured in sulfite-free Brucella broth supplemented with 0.5% activated carbon. according to H. pylori The HpGP-26695 (ATCC) genome sequence (GenBank CP079087.1) was used to design and synthesize specific primers: p88-EcoRI-F (SEQ ID NO: 433) and primer p88-Xho1-R (SEQ ID NO: 434) for amplifying the VacA-P88 gene fragment (SEQ ID NO: 435). The PCR product was recovered and cloned into the pET-28a-Sumo expression vector. Similarly, primers CagA-EcoRI-F (SEQ ID NO: 436) and CagA-XhoI-R (SEQ ID NO: 437) were designed for the CagA gene to amplify the CagA sequence (SEQ ID NO: 438), and the recovered PCR product was cloned into the pET-22b expression vector.

[0031] 2. Induced expression of fusion proteins The correctly identified recombinant expression plasmids were transformed into competent *E. coli* BL21(DE3) cells. Single colonies were picked and inoculated into 5–10 mL of LB broth containing ampicillin (Amp), and cultured at 37°C with shaking for 4–5 h. IPTG was then added, and expression was induced overnight at 16°C. After induction, the bacterial cells were collected, sonicated, and the supernatant and precipitate were collected separately. The expression of the fusion protein was analyzed by 10% SDS-PAGE electrophoresis and Coomassie brilliant blue staining.

[0032] 3. Large-scale expression and purification of fusion proteins The successfully verified positive clone strain was activated, and 2 mL of the activated bacterial solution was inoculated into 200 mL of LB liquid medium containing ampicillin. The culture was then incubated at 37°C with shaking until OD (dose expiratory volume). 600 When the pH value reaches 0.6–0.8, after inducing expression with IPTG for 18–20 h, the bacterial cells are collected by centrifugation. The bacterial cells are then sonicated, and the supernatant is collected. Protein purification and endotoxin removal are performed according to the His-tagged protein / GST-tagged protein purification packing instructions. The purity of the purified protein sample is determined by 10% SDS-PAGE electrophoresis. The results are as follows: Figure 1 As shown.

[0033] Example 2: Preparation of corresponding monoclonal antibodies against VacA-P88 and CagA 1. Mouse Immunization and Hybridoma Cell Preparation The recombinant protein obtained in Example 1 was diluted with physiological saline, emulsified with Freund's complete adjuvant, and immunized Balb / c mice via intraperitoneal injection. Fourteen days after the initial immunization, a booster immunization was performed using recombinant protein emulsified with Freund's incomplete adjuvant. A total of 2-3 immunizations were performed. Seven days after the final immunization, blood was collected from the tail of the mice, serum was separated, and serum antibody titers were detected using an indirect ELISA method. The titers met the requirements for cell fusion. Three days before cell fusion, mice were boosted with 100 μg of recombinant protein.

[0034] Balb / c mouse spleen B lymphocytes were mixed with sp2 / 0 myeloma cells in logarithmic growth phase at a ratio of 1:3, and cell fusion was performed using electrofusion technology (parameters: DC pulse intensity 500 V, DC square wave pulse duration 30 μs, DC square wave pulse interval 0.5 s, repeated twice; AC voltage 45 V, duration 20 s; Dacay rate: 10%, post-fusion time 7 s). After fusion, cells were screened in HAT medium, and antibody specificity in the cell culture supernatant was detected using indirect ELISA. Positive well cells were subcloned multiple times until a monoclonal hybridoma cell line stably secreting specific antibodies was obtained.

[0035] The obtained monoclonal cell lines were acclimatized and cultured using serum-free hybridoma medium and then cryopreserved in serum-free cryopreservation solution. The cell culture supernatant was collected and purified by Protein A affinity chromatography to obtain purified antibodies (such as...). Figure 2 (As shown), after dialyzing in 0.01 mol / L phosphate buffer, the protein concentration was determined by ultraviolet spectrophotometry.

[0036] By specifically screening antibodies secreted by multiple monoclonal cell lines (using recombinant proteins and HP strains of different genotypes), antibodies with high titers that specifically recognize bacterial characteristic virulence proteins were identified. Ultimately, two cell lines capable of stably secreting high-titer monoclonal antibodies were obtained.

[0037] Antibody screening and identification 2.1 Antibody titer detection (indirect ELISA method): Coating: Dilute the inactivated bacterial solution with coating diluent and add 0.1 mL to each well of a polystyrene microplate. Incubate overnight at 4°C.

[0038] Blocking: Discard the solution in the wells, wash twice with washing buffer, add 0.3 mL of 1% BSA solution, and incubate at 37°C for 3 hours.

[0039] Sample loading: Discard the solution in the wells and wash 3 times with washing buffer; prepare a series of antibody solutions of different concentrations and add them to the above-coated reaction wells, and incubate at 37°C for 1 hour; at the same time, set up antibody dilution buffer as a blank control.

[0040] Add enzyme-labeled antibody: Discard the solution in the wells, wash 4 times with washing buffer, add 0.1 mL of freshly diluted enzyme-labeled antibody to each reaction well, and incubate at 37°C for 1 hour.

[0041] Color development: Discard the solution in the wells, wash 5 times with washing buffer, add 0.1 mL of freshly prepared 3,3',5,5'-tetramethylbenzidine solution to each reaction well, and incubate at 37°C for 1 hour.

[0042] Termination and detection: Add 0.05 mL of 2M sulfuric acid to each reaction well to terminate the reaction, and measure the absorbance value of each well at a wavelength of 450 nm to calculate the antibody titer.

[0043] 2.2 Antibody pairing screening Purified antibodies were used as capture antibodies and gold-labeled antibodies for paired detection. Capture antibody solutions at concentrations of 1.0–2.0 mg / mL were coated onto nitrocellulose (NC) membranes, while gold-labeled antibody solutions at concentrations of 0.5–1.0 mg / mL were sprayed onto glass fiber pads. Antigen solutions of varying concentrations were prepared and spotted onto the sample pads. Through chromatography, positive results were detected at the T-line on the NC membrane. Antibody pairs with good pairing and high sensitivity were selected for subsequent experiments.

[0044] Example 3: Preparation of VacA-P88 and CagA Bispecific Antibodies Antibody variable region sequence acquisition Total RNA was extracted from the selected hybridoma cells and transcribed into cDNA. VH and VL gene fragments were obtained by PCR amplification using specific primers targeting the antibody heavy chain variable region (VH) and light chain variable region (VL). The PCR products were then ligated into the PMD-19T vector via TA cloning and Sanger sequencing. The correct VH and VL amino acid sequences were analyzed using the IMGT / V-QUEST online tool.

[0045] Construction of bispecific antibody expression vector Bispecific antibody genes were constructed using methods such as overlap extension PCR. The heavy chain was amplified by splicing according to the sequence "VH (anti-VacA-P88)-CH1-linker-VH (anti-CagA)-linker-VL (anti-CagA)"; the light chain was amplified according to the sequence "VL (anti-VacA-P88)-CL". The amplified products were ligated into a eukaryotic expression vector using in-fusion cloning technology. The ligation product was transformed into competent *E. coli* DH5α, and single clones were selected for sequencing verification. Recombinant plasmids with correct sequences were prepared in large quantities using an endotoxin-free plasmid extraction kit and stored for later use (e.g., ...). Figure 3 and Figure 4 (As shown).

[0046] Bispecific antibody expression, purification and validation Expression: HEK293F cells were cultured in serum-free medium at 37℃ and 5% CO2, and passaged every 48-72 hours. The cells were cultured until the cell density reached 1 × 10⁻⁶ cells / year. 6When the cell count is 10 μg / mL, take 10 mL of serum-free 293 medium, add 50 μg each of heavy and light chain plasmids, mix well, and incubate at room temperature for 5 min. Then add 300 μL of polyethyleneimine (PEI, 1 mg / mL), mix well, and incubate at room temperature for 20 min. After incubation, add the mixture to HEK293F cells, continue culturing for 5 days, and then collect the cell supernatant.

[0047] Purification: After filtering the cell supernatant, purify it according to the instructions for protein A affinity chromatography packing.

[0048] Preliminary validation: The purified antibody was subjected to SDS-PAGE electrophoresis to verify its purity and molecular weight (e.g., Figure 3 (As shown).

[0049] Bispecific antibody specificity verification The bispecific binding activity of the antibody was verified using an indirect ELISA method.

[0050] S1. Coating of the microplate: Prepare a recombinant CagA and VacA protein solution using coating buffer, add 100 μL per well to the microplate, and coat overnight at 4°C; then discard the liquid, add 300 μL of washing buffer and wash twice, discard the washing buffer and pat the microplate dry on absorbent paper.

[0051] S2. Blocking of the microplate: Add 300 μL of blocking solution to the microplate, incubate at 37°C for 3 hours, then discard the blocking solution and wash the plate 3 times using the same method.

[0052] S3. Detection: The bispecific antibody was serially diluted and added to each well, incubated at 37°C for 1 h; the liquid in the wells was discarded, and the plate was washed 3 times as before. Horseradish peroxidase (HRP)-labeled mouse anti-human IgG secondary antibody was added, and the plate was incubated at 37°C for 1 h; the liquid in the wells was discarded, and the plate was washed 4 times as before. Under light-protected conditions, 100 μL of 3,3',5,5'-tetramethylbenzidine solution was added to each well, and the plate was incubated at 37°C for 5 min; finally, 50 μL of stop solution was added to each well, and the absorbance of each well was measured at 450 nm using a microplate reader. The results showed that the prepared bispecific antibody could specifically bind to recombinant CagA and VacA proteins, respectively.

[0053] Example 4: Preparation of colloidal gold test strips for detecting pathogenic Helicobacter pylori 1. Preparation of colloidal gold solution and gold-labeled antibody 1.1 Preparation of Colloidal Gold A 0.01% chloroauric acid solution was heated to a gentle boil. While stirring continuously, a mixed reducing solution consisting of tannic acid (0.001-0.01%) and sodium citrate (0.01-0.1%) was rapidly added. Boiling continued for 3-5 minutes. The solution initially turned black, then purple-red, eventually becoming a clear, purple-red colloidal gold solution. The solution was removed from the heat and cooled, then brought to a final volume of 200g. 0.1% BSA or 0.05% Tween-20 was added as a stabilizer to prevent aggregation. Transmission electron microscopy (TEM) characterization showed that the gold nanoparticles were uniform in size and morphology, with a particle size of approximately 60 nm.

[0054] 1.2 Antibody labeling Take 1 mL of colloidal gold solution, add 10 μL of 0.2 M K₂CO₃ solution to adjust the pH, and immediately vortex to mix. Then add an appropriate amount of purified antibody and incubate at room temperature for a certain period of time. Add 10 μL of 20% BSA solution for blocking and let stand for 10 minutes. Finally, centrifuge at 12000 rpm for 10 minutes at 4℃, discard the supernatant, and resuspend the precipitate with an appropriate amount of resuspension buffer to obtain the gold-labeled antibody, which can be stored at 4℃ for later use.

[0055] 2. Coating of the test line (T line) and the quality control line (C line) 2.1 Test line (T line) Bispecific antibodies were prepared into solutions with a concentration of 1.0–2.0 mg / mL using 0.02 M PBS buffer at pH 7.4, and used as T-line coating antibodies.

[0056] 2.2 Quality control line (C line) Goat anti-mouse IgG antibody was prepared into a solution with a concentration of 0.5~1.0 mg / mL using 0.02 M PBS buffer at pH 7.4, and used as the C-line coating antibody.

[0057] 3. Sample pad pretreatment Cut glass cellulose membranes to the appropriate size and dry them thoroughly in an oven. Immerse the dried sample pads in the pretreatment solution, and then dry them in an oven at 50 degrees Celsius for more than 1 hour.

[0058] 4. Assembly of test strips The test strip is made by sequentially stacking and pasting a base plate, a sample pad (colloidal gold pad), a detection pad (nitrocellulose membrane, NC membrane), and an absorbent pad. The components are arranged sequentially along the sample flow direction, with adjacent parts overlapping by 1-2 mm. The total length of the test strip is approximately 6 cm, and the width is approximately 3.5 mm, with the sample pad approximately 2 cm long, the detection pad approximately 2.5 cm long, and the absorbent pad approximately 2 cm long. On the detection pad, the T line (coated with bispecific antibody) is closer to the sample pad end, and the C line (coated with goat anti-mouse IgG) is closer to the absorbent pad end. The T line and C line are spaced a certain distance apart. The sample pad has been coated with and dried with gold-labeled antibodies before use. Example 5: Application of Colloidal Gold Test Strip for Detecting Pathogenic Helicobacter pylori 1. Specificity verification Inactivated Helicobacter pylori bacterial suspensions with different virulence factors were prepared, including strains with (CagA+ / VacA+), (CagA+ / VacA-), (CagA- / VacA+), and (CagA- / VacA-) virulence factors. 60 μL of each bacterial suspension was slowly and vertically added to the sample application end of the test strip (i.e., the end of the colloidal gold pad furthest from the NC membrane). The strip was incubated at room temperature for 10-15 minutes, and the results were observed.

[0059] The results showed that CagA+ and / or VacA+ strains (i.e., the first three types) all showed clear bands at the control line (C line) and test line (T line); while (CagA- / VacA-) strains only showed color at the C line, with no color at the T line. This indicates that the test strip can specifically detect Helicobacter pylori containing CagA and / or VacA virulence factors (e.g., CagA and VacA). Figure 5 (As shown).

[0060] 2. Sample Collection Fresh stool samples were collected using sampling swabs and immediately placed in a storage tube containing lysis buffer. The samples were then thoroughly shaken for at least 10 seconds. The processed samples should not be stored at room temperature for more than 6 hours, at 2–8°C for no more than 3 days, and at -20°C for no more than 6 months.

[0061] 3. Sample testing Add 60 μL of the treated sample vertically and slowly to the sample application end of the test strip, let it stand at room temperature for 10-15 minutes, and determine the result based on the color development of the C and T lines on the NC membrane.

[0062] Based on the above experimental results, the colloidal gold immunochromatographic detection method established in this invention can simultaneously target two key virulence factors of Helicobacter pylori (CagA and VacA), exhibiting high specificity. This method is simple and rapid to operate, and helps to significantly improve the detection rate and diagnostic accuracy of pathogenic Helicobacter pylori.

[0063] This invention relates to the following sequences, where X1 is S, T, or A; X2 is I, L, or V; and X3 is D, E, or N. The sequence shown underlined is an FR sequence, and the sequence enclosed in a box is a CDR sequence.

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071] SEQ ID NO: 433: CTGATATCGGATCCGAATTCCTAAAACAAGCCGAAGAAGC SEQ ID NO: 434: TGGTGGTGGTGGTGCTCGAGGGTGTTTGTAGGTAAATTTGTG VacA-P88 sequence SEQ ID NO: 435: SEQ ID NO: 436: CTGATATCGGATCCGAATTCATGACTAACGAAACTATTGATCA SEQ ID NO: 437: TGGTGGTGGTGGTGCTCGAGATCTTTCACCGAGCCTTTAA CagA sequence SEQ ID NO: 438: The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A bispecific antibody against Helicobacter pylori, characterized in that, The antibodies include Ca05-Va23 and Ca98-Va187 antibodies obtained through gene recombination. Both the Ca05-Va23 and Ca98-Va187 antibodies include two functional domain sequences, each of which includes a heavy chain variable region and a light chain variable region, for the specific recognition of Helicobacter pylori CagA protein and Helicobacter pylori VacA protein.

2. The anti-Helicobacter pylori bispecific antibody according to claim 1, characterized in that, The functional domains of the Ca05-Va23 antibody are the scFv1 region and the scFv2 region. The amino acid sequence of the heavy chain variable region of the scFv1 region is shown in one of SEQ ID NO: 1-81, and the amino acid sequence of its light chain variable region is shown in one of SEQ ID NO: 82-162. The amino acid sequence of the heavy chain variable region of the scFv2 region is shown in one of SEQ ID NO: 163-189, and the amino acid sequence of its light chain variable region is shown in one of SEQ ID NO: 190-216.

3. The anti-Helicobacter pylori bispecific antibody according to claim 2, characterized in that, The functional domains of the Ca98-Va187 antibody are the scFv3 and scFv4 regions, respectively. The amino acid sequence of the heavy chain variable region of the scFv3 region is shown in one of the sequences of SEQ ID NO: 217-297, and the amino acid sequence of its light chain variable region is shown in one of the sequences of SEQ ID NO: 298-378. The amino acid sequence of the heavy chain variable region of the scFv4 region is shown in one of the sequences of SEQ ID NO: 379-405, and the amino acid sequence of its light chain variable region is shown in one of the sequences of SEQ ID NO: 406-432.

4. The anti-Helicobacter pylori bispecific antibody according to claim 3, characterized in that, The scFv1 and scFv3 regions specifically recognize different epitopes of the CagA protein, while the scFv2 and scFv4 regions specifically recognize different epitopes of the VacA protein.

5. The anti-Helicobacter pylori bispecific antibody according to claim 1, characterized in that, The functional domain sequences of the Ca05-Va23 antibody and the Ca98-Va187 antibody are derived from hybridoma cells prepared using mouse monoclonal antibody technology.

6. A method for preparing a bispecific antibody against Helicobacter pylori, characterized in that, Includes the following steps: Recombinant proteins VacA-P88-His and CagA-His were prepared using an Escherichia coli expression system; Monoclonal antibodies against VacA-P88 and CagA were prepared using mouse monoclonal antibody technology. Bispecific antibodies against VacA-P88 and CagA were constructed using gene recombination technology.

7. A kit for detecting Helicobacter pylori, characterized in that, The kit contains a bispecific antibody against Helicobacter pylori as described in any one of claims 1-4, for detecting whether a sample contains Helicobacter pylori, and for distinguishing the virulence type of Helicobacter pylori, the virulence type including VacA+ and / or CagA+.

8. The kit for detecting Helicobacter pylori according to claim 7, characterized in that, The kit includes reagent strips, wherein each reagent strip includes a sample pad and a detection pad; The sample pad is coated with labeled detection antibodies; The test pad is provided with a test line and a control line, wherein the test line is coated with capture antibody and the control line is coated with goat anti-mouse IgG antibody. The detection antibody and the capture antibody are selected from Ca05-Va23 and Ca98-Va187, respectively.

9. The kit for detecting Helicobacter pylori according to claim 7, characterized in that, The reagent strip is a colloidal gold test strip or a fluorescent test strip, wherein the colloidal gold particles have a particle size of 55-65 nm; the sample pad is a pretreated glass fiber membrane, and the detection pad is a nitrocellulose membrane; a stacking pad is also provided between the sample pad and the detection pad.

10. The use of a bispecific antibody as described in any one of claims 1-4 in the preparation of a Helicobacter pylori detection product.