Notched-edge green algae MLDP gene knockout mutant strain, its construction method and application

Abstract

This invention belongs to the fields of genetic engineering and biotechnology, specifically relating to notched-edge green algae. MLDP Gene knockout mutant strains, their construction methods, and applications. This invention relates to notched-edge green algae. MLDP The gene knockout mutant strain (ΔMiMLDP) is a gene-editing mutant of notched-edge green algae using CRISPR / Cas9 gene editing technology. MLDP This invention utilizes targeted gene knockout. Compared to the wild type, the MLDP gene knockout mutant obtained in this invention exhibits a significantly altered lipid accumulation phenotype, making it suitable for oil production, biofuel preparation, feed preparation, and as an additive or carrier in the production of food, cosmetics, and pharmaceuticals. This invention represents the first successful implementation of this technology in *Cladosporium cladosporium*. MLDP Targeted knockout of genes provides genetic material for studying the function of MLDP in microalgal lipid metabolism, and also provides new germplasm for creating microalgae with novel lipid composition and lipid droplet structure.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and biotechnology, specifically relating to notched-edge green algae. MLDP Gene( MiMLDP Knockout mutants, their construction methods, and applications. Background Technology

[0002] Notched edge green algae ( Myrmecia incisa Arachidonic acid (ARA) is a single-celled freshwater green algae that has attracted much attention due to its high oil content and ability to efficiently synthesize and accumulate polyunsaturated fatty acids such as arachidonic acid (ARA). It has important application value in the fields of biofuels, functional feeds, and food additives.

[0003] Lipid droplets (LDs) are major organelles in cells that store neutral lipids and play a crucial role in the regulation of lipid metabolism in algae. The major lipid droplet protein (MLDP) is a protein on the surface of lipid droplets, with the highest abundance in lipid droplet proteins of notched-edge green algae, and may play a role in promoting lipid droplet volume increase and stability.

[0004] Currently, modifying microalgal metabolic pathways through gene editing technology has become an important strategy for increasing lipid yield and composition. Gene editing systems such as CRISPR / Cas9 have been successfully applied to gene knockout and functional studies in various microalgae, including *Chlamydomonas reinhardtii* and *Phaeodactylum tricornutum*. However, in notched-edge green algae... MLDP The function of genes in lipid droplet formation and fatty acid synthesis has not yet been elucidated.

[0005] Therefore, the present invention develops a MLDP The gene knockout mutant of notched edge green algae is of great scientific significance and application value for elucidating the biological function of MLDP in microalgal lipid droplet formation, clarifying its role in fatty acid synthesis metabolism, and creating new microalgal germplasm with novel lipid composition and lipid droplet structure. Summary of the Invention

[0006] This invention provides notched edge green algae MLDP The gene knockout mutant (ΔMiMLDP) has the gene segment shown in SEQ ID NO. 6 deleted between positions 770 and 1575 of the MLDP gene sequence shown in SEQ ID NO. 2. This denoted-edge green alga... MLDP The gene knockout mutant no longer expresses the major lipid droplet protein MLDP in notched edge green algae, regulating the lipid accumulation and lipid droplet characteristics in notched edge green algae, as demonstrated by this invention, significantly increasing total lipid content, changing fatty acid composition, improving fatty acid oxidative stability, and stably maintaining the size, composition, and structure of lipid droplets.

[0007] This invention provides notched edge green algae MLDP Gene knockout mutant (ΔMiMLDP), which possesses the notched-edge green algae provided in this invention. MLDP Gene knockout mutant, classified and named notched-edge green algae. Myrmecia incisa The accession number is CGMCC No. 46961.

[0008] The above-mentioned notched edge green algae of the present invention MLDP Gene knockout mutants can be used to prepare feed; the notched-edge green algae described in this invention MLDP The oil extracted from the gene knockout mutant strain can be used to prepare additives, which can be used in the fields of food, pharmaceuticals, health products, and cosmetics. This invention relates to the notched-edge green algae described above. MLDP Lipid droplets extracted from gene knockout mutant strains can be used to prepare carriers with protective, delivery, controlled release, and synergistic functions, applicable in pharmaceuticals, cosmetics, health products, and food, for the preparation of food, medicines, health products, or cosmetics; [This invention relates to the notched-edge green algae described above.] MLDP Lipid droplets extracted from gene knockout mutant strains can also be used as additives. These additives can be used in the fields of food, pharmaceuticals, health products, and cosmetics to prepare food, pharmaceuticals, health products, or cosmetics. This invention relates to the notched-edge green algae described above. MLDP Oils or lipid droplets extracted from gene knockout mutants can also be used as raw materials for biofuel production.

[0009] This invention provides notched edge green algae MLDP Gene knockout mutants or notched-edge green algae MLDP Application of gene knockout mutants in the preparation of oils, and / or lipid droplets, and / or feed.

[0010] This invention provides an oil, and / or lipid droplets, and / or feed, derived from the notched-edge green algae described above. MLDP Gene knockout mutant strains were obtained.

[0011] This invention provides notched edge green algae MLDP The application of oils produced by gene knockout mutant strains in the preparation of any of the following: additives, food, health products, cosmetics, or pharmaceuticals.

[0012] This invention provides notched edge green algae MLDP The application of lipid droplets produced by gene knockout mutant strains in the preparation of vectors, food, health products, cosmetics, or pharmaceuticals.

[0013] This invention provides notched edge green algae MLDP The oils or lipid droplets produced by gene knockout mutant strains can be used as raw materials for biofuel production or as biofuel applications.

[0014] This invention provides a product prepared from the above-described oils and / or lipid droplets, said product being selected from any of the following: 1) Additives; 2) Carrier; 3) Biofuel feedstock; 4) Food; 5) Health supplements; 6) Cosmetics; 7) Medicines; 8) Biofuels.

[0015] This invention provides notched edge green algae MLDP Gene editing tools for gene knockout mutants are used in the preparation of notched-edge green algae. MLDP Gene knockout mutants or notched-edge green algae MLDP Application in gene knockout mutant strains, wherein the gene editing tool is selected from at least one of the following: 1) The sgRNA target sequences shown in SEQ ID NO.4 and SEQ ID NO.5; 2) The sgRNA-Cas9 RNP complex targeting the target sequences shown in SEQ ID NO.4 and SEQ ID NO.5.

[0016] This invention provides notched edge green algae MLDP The method for preparing gene knockout mutants includes the following steps: a) Construct an sgRNA-Cas9 RNP complex targeting the target sequences shown in SEQ ID NO.4 and SEQ ID NO.5; b) Transform notched edge green algae cells using the sgRNA-Cas9 RNP complex described in step a).

[0017] Step b), the transformation is performed using a physical transfection method. Further, a gene gun method is used, with the following parameters: rupture disc pressure of 1350 psi, vacuum level in the bombardment chamber of 28 in Hg, and target distance (from the barrier to the sample) of 6 cm.

[0018] Furthermore, the method also includes screening the transformed cleft-edge green algae obtained in step b), wherein the screening is 2-fluoroadenine (2-FA) resistance screening and / or sequencing identification screening.

[0019] The lipid accumulation characteristics described in this invention refer to the ability and extent to which organisms (including plants, animals and microorganisms) synthesize and store lipids (mainly triglycerides) in specific tissues or cells, including but not limited to the following three aspects: (1) Total lipid content: refers to the mass percentage of total lipids in a unit dry weight or fresh weight sample; (2) Fatty acid composition: refers to the relative proportion of various fatty acids (such as saturated, monounsaturated and polyunsaturated fatty acids) in lipids; (3) Accumulation kinetics: refers to the time dynamics of lipids starting to synthesize and rapidly accumulating to reach a peak during development.

[0020] The oils and fats mentioned in this invention refer to both total fats and the components of total fats such as triglycerides and fatty acids (e.g., saturated fatty acids, monounsaturated fatty acids, polyunsaturated fatty acids, etc.).

[0021] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention achieves for the first time in notched-edge green algae. MLDP Targeted knockout of the gene provides genetic material for studying the function of MLDP in the lipid synthesis metabolism of this algae.

[0022] (2) The invention obtained MLDP The gene knockout mutant showed a significantly altered lipid accumulation phenotype compared to the wild type: total lipid content was increased; arachidonic acid (ArA) content decreased by approximately 98%, C16:0 increased by 38.2%, C16:3 was twice that of the wild type, C18:1 increased by 8.0%, and α-linolenic acid (ALA) content did not change significantly. This indicates that the mutant showed a significant increase in total lipids and enhanced oxidative stability of fatty acids.

[0023] (3) The present invention provides MLDP The gene knockout mutant exhibited a significant difference in lipid droplet size compared to the wild type. Under nitrogen-deficient culture conditions, the lipid droplets of the wild-type *Alternaria lobata* gradually increased from 0.58 µm after 48 h of nitrogen-deficient culture to 1.59 µm after 144 h; while the lipid droplet size of the mutant did not change significantly during culture, remaining stable at approximately 0.4–0.5 µm. This stable, small-sized lipid droplet characteristic makes it a promising carrier for drug delivery and cosmetic applications.

[0024] (4) The construction method of the present invention is feasible and has high editing efficiency, providing technical support for gene function research and genetic improvement of notched edge green algae. Attached Figure Description

[0025] Figure 1PCR identification of algal strains obtained by screening and purification after co-transformation with sgMLDP2 and sgMLDP3 gRNAs. Lanes 1-23 correspond to different purified algal strains. No bands were amplified in lanes 2, 7, 10, and 20, while lane 14 amplified a band of approximately 300 bp, indicating that this algal strain... MLDP The gene has undergone significant segment deletion.

[0026] Figure 2 Notched edge green algae MLDP Growth rates of gene knockout mutants and wild-type notched edge green algae.

[0027] Figure 3 Notched edge green algae MLDP Fatty acid composition analysis of gene knockout mutant strains and wild-type cleft-margined green algae. Among them, C15:0 (pentadecanoic acid), C16:0 (palmitic acid / hexadecanoic acid), C18:0 (stearic acid / octadecanoic acid), C20:0 (arachidic acid / eicosanoic acid), C22:0 (docosahexadecanoic acid), C23:0 (tricresanoic acid), and C24:0 (tetracosanoic acid) are saturated fatty acids; C16:1 (hexadecenoic acid / palmitoleic acid), C17:1 (heptadecenoic acid), C18:1n9c (octadecenoic acid / oleic acid), C20:1 (eicosanoic acid), and C22:1n9 (docosahexadecanoic acid) are monounsaturated fatty acids (MUFA); C16:2 (hexadecadienoic acid), C16:2(9,12) (cis-9,12-hexadecadienoic acid), C16:3 (hexadecanetrienoic acid), and C18:2n6c (cis-9,12-octadecadienoic acid) are saturated fatty acids; C18:2n6t (trans, trans)9,12-octadecadienoic acid / trans-linolenic acid), C18:3n6 (6,9,12-octadecadienoic acid / γ-linolenic acid), C18:3n3 (9,12,15-octadecadienoic acid, α-linolenic acid), C18:4n3 (6,9,12,15-octadecathitaranic acid / stearic acid), C20:2 (11,14... C20:3n6 (8,11,14-eicosatrienoic acid), C20:4n3 (8,11,14,17-eicosatraenoic acid), C20:5n3 (5,8,11,14,17-eicosapentaenoic acid / EPA), and C20:4n6 (5,8,11,14-eicosatraenoic acid / arachidonic acid) belong to polyunsaturated fatty acids (PUFAs).

[0028] Figure 4 Wild-type and notched edge green algae MLDP Morphological changes of lipid droplets in knockout mutants at different time points under nitrogen deficiency. Detailed Implementation

[0029] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are only for explaining the present invention and should not be regarded as any limitation thereof. Experimental methods not specified with specific conditions in the embodiments are generally performed under conventional conditions.

[0030] Example 1: Cultivation of notched-edge green algae Notched-edge green algae cells were inoculated into BG-11 medium and incubated at 25°C under a light intensity of 115 μmol·m⁻¹. -2 ·s -1 Shaking culture under a 12h light-dark cycle: 12h conditions.

[0031] Example 2: sgRNA design targeting the MLDP gene by APT The gene serves as a reverse selection marker (the APT gene encodes adenine phosphoribosyltransferase, which catalyzes the production of 2-fluoroadenine nucleotides using 2-fluoroadenine (2-FA) as a substrate. This nucleotide analog interferes with normal cellular metabolism, ultimately leading to cell death). Based on *Clerodendrum notchedum*... APT DNA sequence of gene (MiAPT) (SEQ ID NO:1) and MLDP Gene( MiMLDP The DNA sequence (SEQ ID NO:2) was used to design CRISPR targets in... APT sgRNA target sequences were designed from the first exon region of the gene and parts of the MLDP coding region. The selection criteria were: GC content between 40% and 70% and no significant off-target sites.

[0032] MiAPT DNA sequence (no UTR region, bold text indicates exons, underlined text indicates start and stop codons): ATGTGA (SEQ ID NO:1).

[0033] The full-length DNA sequence of MiMLDP (underlined codons are start or stop codons, and bold text indicates introns) is 2331 bp long: GATTAAGCAGTGGTATCAACGCAGAGTACATGGGGATAAGAAGGGGAGGCCCTGGGGGCAAGAGGAGCGGCACAGCGTCTTGTAAGACTCAGTGATTACAGGTCCGGCTAATGCGACTTCAACTGGATAACAAGCCGCTGTGCAAAGCAGAGGTTCGTGTACCGCCCCGAGGTCTCGTTGCAACAGCAGCCCCGGAGAAAGCCTGCAGGAGGCAAGC ATGTAA GCCAGGCGGGCGTGTAGCCGTCTACTGCCTTTGTTGCCGACAGCGGCAGCTGGACTAGGCGGTAGTTGACCGTCTTATGCCTTGGGCTCATGCGCTGGGGTCCCAAGTGGCGTCATTGTGCAAAACAACCCAGACGAAACGGCATGTCAGGAGCTCCGAGATGAGAGAGGGAATGCGGGTGACAGCTGGCAGGGCCAGCTTGGATCTCGTCATCCCAGCGGTGTGCTTCTGAAACCGGGTGCTGGCAAGTGCAAGCGGGTCTGCAGAACTGTAGTGGATAGCTGTGCCCCTTGCCATTCCACCTTGCAGCCAACGCTACTACGCATGCGGGCATCAACGATGTGGGCAGTGTGAAAGGTGCTGCCTATCAAGTGAGAGAGCGAGCGTGATCTGTGTGTCAGCGGCGGGCCTCTGCGCAGCAGCCGGAATGAGCCCTCGCGTGGGCAGGGGGCAGTTGGCAAGATAAAGTGCCGGCACGAAGGGCAGGATGGACGCGCTGGTTGCAGGTCCTTCTCAAGTTTTGCAATGAGAGCGCACAAGGAGGACCATGTGCACATAACCCATGACCTAGCCGCTGAGCCTGCGGTTGTTACGGGGGAACGCTGTATGATCTGTCGTGTGCAAGCCAGGAGTTGTTTGCTCTGCATGTATGACATCACGTATCAAAGAAGCCCGCATGTGTTTTCAGTCGCTGTTGTTGCTCGAGTTACTAGTCCCGGCTGGTTGGGAGTTGTAGATGATCCTGCTTTCATCAAAAGATTGCAATCACTTGATTGTATC (SEQ ID NO:2).

[0034] The designed sgRNA target sequences are as follows: sgAPT target sequence: 5'-TGGTATGGATCTGACAGAGT-3' (SEQ ID NO:3), located at positions 1265 - 1284 of the complementary sequence (5'-3') of the DNA sequence shown in SEQ ID NO:1; sgMiMLDP2 target sequence: 5'-TCCCCCTCACTCAAGGCAGC-3' (SEQ ID NO:4), located at positions 882-901 of the DNA sequence shown in SEQ ID NO:2; The target sequence of sgMiMLDP3 is 5'-GGTGCAAGCTCATAGCGCTG-3' (SEQ ID NO:5), located at positions 937-956 of the DNA sequence shown in SEQ ID NO:2.

[0035] The DNA sequence missing from MiMLDP (SEQ ID NO:6) is 804 bp in length. GCTGACAGTGTGGCTGCCCTCTAGGTGGATGGCGTGTTCCATGCAGCGTCAGAGCTGTTTGCTCACAATAGCTTCGTGGGTGACGCATTTGAGCGGCAGCGGGGCTACCACTCCCCCTCACTCAAGGCAGCCGGGGAGGAGTACCTGCACAAGCTGGAAGAGGCCTGGTGCAAGCTCATAGCGCTGCCCCCAGGTGTGCCCCGTCCATGCCTGGTTTTCAGCCGCAGCGCGGCTGCCGATGTACCTGACCCTTCGCGTCGTTGCCAACTTGCTATCATTGCAGGCAGTGTCAGCTTGCTGCATCTTTTGGCTTGTGCGCAACCGGTGATGGTGACTTGAGGCCGGCATGTGTCGCAGTCAACAAGCTCCTGGAGAGCACTGCGCCGTCCGTCGATTTCACCCGCCGCAAGTACCTGGCCGCGCACGATGTGGTGGTGGGGTCCACCTCCTACAATAAGGCCTTGGCAACGGCCGCCAGCATGCTGGATCAGGTCAGCAGCTGTGTGGCAGCTGGCTCCGTTGCTCTTGCGTCCTGCTACCTCTTGCAGCCTTGCAAGCTGTCGTGGGCTGTCCGCAGGTCAAGGATACTTTTGTGTACAAGGCCGCTGCTAGCAAGCTGTACCCAGTCATCTCGCCGCTGGCGGACCCAGCCCTCAGCAAGATCACACATTCAGCCTGCTACAGCGCTGTTGTTGACCACCTGAAGCCAACTGGCCCCTCAAGCGACAGCGTGCACCACGCCGACCAGGCGTGGCGAGTCCTGTCTTGTGCCCAGTGCTAAGCCAGGCGGGCGTGTAGCCGTCT Example 3: Construction of CRISPR / Cas9 RNP To simultaneously achieve targeted editing of APT gene and MLDP gene, the RNP complexes targeting APT (RNP-APT) and the RNP complexes targeting MLDPThe RNP complexes (RNP-MLDP2 and RNP-MLDP3) were assembled. The assembly reaction was carried out under aseptic conditions, with the components added sequentially in the following reaction system: After gently mixing the above reaction system, incubate at 37°C for 10 min to complete RNP assembly. Mix the assembled RNP-APT with an equal volume of the RNP-MLDPs complex, gently mix, and place on ice for later use in gold powder coating and gene gun bombardment experiments.

[0036] Example 4: Transformation and Mutant Screening of Notched-edge Green Algae (1) Algal cell preparation: Collect notched-edge green algae cells in the logarithmic growth phase by centrifugation, wash twice with sterile water, spread evenly on the surface of BG11 solid medium, and adjust the cell density to 5×10⁻⁶. 6 per mL.

[0037] (2) Transformation: A Bio-Rad PDS-1000 / He benchtop gene gun was used with the following parameters: rupture disc pressure 1350 psi, vacuum in the bombardment chamber 28 in Hg, and target distance (from the barrier to the sample) 6 cm. 16 µl of the RNP complex (Cas9 protein: sgRNA = 1:1.5 molar ratio) was mixed with gold powder and bombarded. After bombardment, 15 ml of recovery medium was added, and the mixture was incubated in the dark for 24 h.

[0038] (3) Screening: The revived algal cells were spread on BG-11 solid medium containing 2-FA (60 μmol / mL) and screened at 25 °C with 115 μmol photons / (m 2 •s) Resistance stress screening was carried out under light conditions for 23 days until resistant monoclonal antibodies appeared.

[0039] Example 5: Molecular identification of MLDP gene knockout mutants Resistant single clones were selected and inoculated into liquid selection medium for expansion culture. Genomic DNA was extracted from each candidate algal strain, and PCR primers targeting the MLDP gene were designed. Upstream primer MLDP-F: 5'-TGGCCGGTGAGTACAGACA-3' (SEQ ID NO:7); Downstream primer MLDP-R: 5'-TTGGCTTCAGGTGGTCAACA-3' (SEQ ID NO:8).

[0040] Using wild-type algal strains as controls, PCR amplification was performed followed by sequencing. The sequencing results were compared with the wild-type sequence for identification. MLDP The status of gene editing.

[0041] Notched edge green algae MLDP Electrophoresis diagram of PCR identification of gene knockout mutants (partial mutants) is shown below. Figure 1 As shown, lane 14 amplified a band of approximately 300 bp, indicating that this algal strain... MLDP The gene has undergone significant segment deletion.

[0042] One resistant clone was obtained from 57 resistant clones. MLDP The gene knockout-positive mutant strain was named ΔMiMLDP. Sequencing results showed that... MiMLDP A large 804 bp deletion occurred at the gene target location between 771-1574 bp, causing the protein to cease expression.

[0043] Notched-edge green algae obtained by this invention MLDP The gene knockout mutant strain (ΔMiMLDP) was deposited on April 14, 2026, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 46961, and classified as *Chlorella notchedis*. Myrmecia incisa The preservation result was that the specimen survived.

[0044] Example 6: Analysis of growth characteristics of mutant strains wild-type algae and MLDP Gene knockout mutant strains were inoculated into BG-11 medium, with the initial algal density adjusted to 2.3 × 10⁻⁶. 5 The cells / mL were cultured under the same conditions, and the cells were counted every 24 hours to plot the growth curve.

[0045] The results are as follows Figure 2 As shown, the growth rate of the MLDP gene knockout mutant was not significantly different from that of the wild type (no significant difference / significantly decreased / significantly increased), indicating that MLDP gene knockout does not affect the normal growth of notched-edge green algae.

[0046] Example 7: Determination of lipid content in mutant strains (1) Total lipid extraction: Wild-type and mutant algal cells cultured to the stable period were collected, 50 mg of algal powder was weighed after freeze-drying, and total lipids were extracted using the modified Bligh-Dyer method. The total lipid content (% dry weight) was calculated by weighing.

[0047] (2) Fatty acid composition analysis: Total lipid samples were subjected to methyl esterification and the fatty acid composition was analyzed by gas chromatography-mass spectrometry (GC-MS).

[0048] Total lipid content: Compared with the wild type (total lipid content 20.2% dry weight), the total lipid content of the MLDP knockout mutant increased to 29.8% dry weight, an absolute increase of 9.6 percentage points and a relative increase of about 47.5%.

[0049] Fatty acid composition ( Figure 3 Compared with the wild type, the MLDP knockout mutant showed a decrease of approximately 98% in arachidonic acid (ArA), an increase of 38.2% in C16:0, a doubling of C16:3 compared to the wild type, an increase of 8.0% in C18:1, and no significant change in α-linolenic acid (ALA) content.

[0050] In MLDP knockout mutants, the content of arachidonic acid (ArA) in polyunsaturated fatty acids (PUFAs) was significantly reduced, approaching 0; while the contents of C16:0, C16:1, C16:2, C16:3, and C18:1 were significantly increased.

[0051] Compared to the wild type, the mutant showed a significant increase in total lipids and enhanced oxidative stability of fatty acids.

[0052] Example 8: Detection of oil droplet changes in mutant strains Samples were collected at 0, 24, 48, 72, 96, 120, and 144 h of nitrogen-deficient culture. Algal cells were collected by centrifugation at 5500 r / min at 4℃, washed three times with PBS buffer, and then stained with lipid droplet fluorescence. The lipophilic fluorescent dye Bodipy 493 / 503 (prepared in DMSO stock solution) was used for staining; this dye can rapidly penetrate the cell membrane and specifically bind to lipid droplets. Under light-protected conditions, the dye was added to the resuspended algal solution to a final concentration of 1 μg / mL and incubated at room temperature for 20–30 min. After staining, the staining solution was removed by centrifugation, and the cells were washed three times with PBS. Observation and photography were performed using a fluorescence microscope (40× objective lens) with an excitation wavelength of 490 nm and an emission wavelength of 510–520 nm.

[0053] The results are as follows Figure 4 As shown, in wild-type algae, lipid droplets gradually merged and enlarged (0.58-1.59 µm) with prolonged nitrogen-deficient culture time. In mutants, the size of lipid droplets did not change significantly during nitrogen-deficient culture, remaining at around 0.42±0.06 µm, providing an ideal natural carrier material for cosmetic or drug delivery.

Claims

1. Notched-edge green algae MLDP Gene knockout mutants are characterized by, As shown in SEQ ID NO.2 MLDP The gene segment shown in SEQ ID NO.6 is missing between positions 770 and 1575 of the gene sequence.

2. Notched-edge green algae MLDP Gene knockout mutants are characterized by, This mutant strain possesses the notched-edge green algae described in claim 1. MLDP Gene knockout mutant, classified and named notched-edge green algae. Myrmecia incisa The accession number is CGMCC No. 46961.

3. The notched-edge green algae as described in claim 1 MLDP Gene knockout mutants or the notched-edge green algae as described in claim 2 MLDP Application of gene knockout mutants in the preparation of oils, and / or lipid droplets, and / or feed.

4. An oil, and / or fat droplets, and / or feed, characterized in that, The notched edge green algae as described in claim 2 MLDP Gene knockout mutant strains were obtained.

5. The use of the oils and / or lipid droplets as described in claim 4 in the preparation of any one of additives, carriers, biofuel feedstocks, food, health products, cosmetics, pharmaceuticals, or biofuels.

6. A product prepared from the oils and / or lipid droplets as described in claim 4, characterized in that, The product is selected from any of the following: 1) Additives; 2) Carrier; 3) Biofuel feedstock; 4) Food; 5) Health supplements; 6) Cosmetics; 7) Medicines; 8) Biofuels.

7. The notched-edge green algae of claim 1 MLDP Gene editing tools for gene knockout mutants are used in the preparation of notched-edge green algae. MLDP Gene knockout mutants or notched-edge green algae MLDP Its application in gene knockout mutant strains is characterized by, The gene editing tool is selected from at least one of the following: 1) The sgRNA target sequences shown in SEQ ID NO.4 and SEQ ID NO.5; 2) The sgRNA-Cas9 RNP complex targeting the target sequences shown in SEQ ID NO.4 and SEQ ID NO.

5.

8. Notched-edge green algae MLDP A method for preparing gene knockout mutant strains, characterized by the following steps: include: a) Construct an sgRNA-Cas9 RNP complex targeting the target sequences shown in SEQ ID NO.4 and SEQ ID NO.5; b) Transform notched edge green algae cells using the sgRNA-Cas9 RNP complex described in step a).

9. The preparation method according to claim 8, characterized in that, Step b), the transformation is performed using the gene gun method, with the following parameters: rupture disc pressure of 1350 psi, vacuum degree of 28 in Hg, and target distance of 6 cm.

10. The preparation method according to claim 8, characterized in that, It also includes screening the transformed notched edge green algae obtained in step b).

Images