Trichoderma harzianum taMTA1 gene deletion engineering bacteria and construction method and application thereof

Abstract

This invention discloses an engineered strain of Trichoderma harzianum with the TaMTA1 gene deletion, its construction method, and its application. The engineered strain is named... Trichoderma afroharzianum Δmta1, with accession number CCTCC NO: M 2026086, was constructed by knocking out the methyltransferase TaMTA1 gene in wild-type *Trichoderma harzianum* K223452. A fermentation broth and a biocontrol agent are also disclosed, along with the application of the *Trichoderma harzianum* TaMTA1 gene-deleted engineered strain, the fermentation broth, or the biocontrol agent in controlling maize diseases. The *Trichoderma harzianum* TaMTA1 gene-deleted engineered strain of this invention significantly improves the control effect against maize diseases, providing a highly efficient and safe engineered strain resource for the biological control of maize diseases.

Description

Technical Field

[0001] This invention relates to the field of agricultural biotechnology, specifically to an engineered strain of *Trichoderma harzianum* with the TaMTA1 gene deleted, its construction method, and its applications, particularly to the deletion of the methyltransferase gene through genetic engineering. TaMTA1 Highly biocontrollable engineered strains were obtained. Background Technology

[0002] Corn is constantly threatened by various fungal diseases such as small leaf spot, large leaf spot, and stalk rot, which seriously affect yield and quality. Trichoderma ( Trichoderma As an important biocontrol agent, it mainly inhibits plant pathogens through multiple mechanisms such as competition, antagonism, and induction of plant resistance, while promoting plant growth, making it an ideal alternative to chemical pesticides.

[0003] Trichoderma can produce a series of secondary metabolites with broad-spectrum resistance, such as antimicrobial peptides and polyketides, which inhibit the growth of pathogenic fungi or spore germination. Currently, more than 180 metabolites produced by Trichoderma have been reported, and they can be divided into at least 11 different categories. Recent studies have focused on discovering novel active metabolites in Trichoderma for the control of plant pathogens.

[0004] Trichoderma harzianum (African Trichoderma) T. afroharzianum Trichoderma harzianum is a highly effective biocontrol fungus discovered in recent years. However, under laboratory conditions, its gene clusters are generally silenced, so there is still room for improvement in the antagonistic activity of its metabolites. This invention is the first to discover that knocking out the protein-coding gene containing the MT-A70 domain in Trichoderma harzianum T30 can effectively control the fungus. TaMTA1 Subsequently, the antibacterial ability of the strain's metabolites was significantly enhanced, laying an important genetic foundation for the development of a new generation of highly efficient and green microbial pesticides. Summary of the Invention

[0005] To address the aforementioned technical problems, the present invention aims to provide a *Trichoderma harzianum*. TaMTA1 Gene-deleted engineered bacteria, their construction methods, and applications: This strain knocked out the methyltransferase T30 of *Trichoderma harzianum* using Agrobacterium-mediated transformation (ATMT) technology. TaMTA1 Gene acquisition, its fermentation broth against race O of maize leaf spot pathogen (… Bipolaris maydis race O ), T race of maize leaf spot pathogen ( Bipolaris maydis race T ), corn leaf blight pathogen ( Exserohilum turcicum ), Crescentoides ( Curvularia lunata Fusarium graminearum ( ) Fusarium graminearum Fusarium pseudoverticum ( Fusarium verticillioides ) and Fusarium pseudograss ( Fusarium pseudograminearumThe inhibition rates of the engineered strain were 49.31%, 21.77%, 51.59%, 35.35%, 26.07%, 14.70%, and 8.61% higher than those of the wild-type strain, respectively. Pot experiment showed that the fermentation broth of the engineered strain had a control effect of 72.45% on maize leaf spot disease and had significantly enhanced antagonistic activity against maize pathogens. It has been deposited at the China Center for Type Culture Collection of Wuhan University.

[0006] The objective of this invention is achieved through the following technical solution: In a first aspect, the present invention provides a Trichoderma harzianum. TaMTA1 Gene-deleted engineered bacteria, named Trichoderma afroharzianum Δmta1, accession number CCTCC NO: M 2026086, deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, on January 12, 2026.

[0007] Secondly, this invention provides an engineered strain of *Trichoderma harzianum* with the TaMTA1 gene deleted, wherein the engineered strain is produced by knocking out wild-type *Trichoderma harzianum*. K223452 Methyltransferases in TaMTA1 Gene acquisition.

[0008] As some specific embodiments of the present invention, the wild-type Trichoderma harzianum ( Trichoderma harzianum ) K223452 The accession number is CGMCC No. 17199, the depositary institution is the China General Microbiological Culture Collection Center (CGMCC), the depositary address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit date is April 1, 2019. This strain was originally identified as *Trichoderma harzianum*, but was later reidentified as *Trichoderma harzianum*.

[0009] As some specific embodiments of the present invention, the TaMTA1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0010] Thirdly, the present invention provides a method for constructing the gene-deleted engineered bacteria as described above, comprising the following steps: A1. Amplification using primers shown in SEQ ID NO.2-3. TaMTA1 The 1000 bp homologous arm upstream of the gene was amplified using primers shown in SEQ ID NO.4-5. TaMTA1 The hygromycin resistance gene fragment was amplified by using primers shown in SEQ ID NO. 8-9, along the 1000 bp homologous arm downstream of the gene. A2. By seamless cloning, the upstream homologous arm, hygromycin resistance gene, and downstream homologous arm were ligated into a linearized vector to construct the TaMTA1 gene knockout recombinant plasmid, which was then transformed into Agrobacterium AGL-1. A3. Recombinant Agrobacterium AGL-1 with wild-type Trichoderma harzianum. K223452 The spore suspensions were co-cultured and screened in a medium containing hygromycin to obtain *Trichoderma harzianum*. TaMTA1 Gene-deleted engineered bacteria.

[0011] Fourthly, the present invention provides a fermentation culture medium using the aforementioned *Trichoderma harzianum*. TaMTA1 It was obtained by fermentation culture of gene-deleted engineered bacteria.

[0012] As some specific embodiments of the present invention, the method for preparing the fermentation culture medium includes the following steps: S1, Trichoderma harzianum TaMTA1 Gene-deleted engineered bacteria were inoculated into PDA medium and cultured at a constant temperature to obtain a spore suspension; S2. Inoculate the spores into molasses culture medium, incubate at a constant temperature, filter, and collect the sterile fermentation supernatant to obtain the product.

[0013] As some specific embodiments of the present invention, in step S1, the temperature of the isothermal incubation is 25~30 ℃ and the time is 2~5 days.

[0014] As some specific embodiments of the present invention, in step S2, the inoculation density is 1~10×10⁻⁶. 4 per mL.

[0015] As some specific embodiments of the present invention, in step S2, the temperature of the isothermal culture is 25~30℃, the time is 4~10 days, and the rotation speed is 150~200 rpm.

[0016] As some specific embodiments of the present invention, in step S2, the filtration includes first filtering the mycelium with filter paper to obtain the supernatant, and then filtering with a sterile filter membrane, wherein the pore size of the sterile filter membrane is 0.22 μm.

[0017] As some specific embodiments of the present invention, in step S2, the molasses culture medium includes: molasses 10~50 g / L, soybean peptone 2~10 g / L, beef extract powder 1~5 g / L, (NH4)2SO4 0.2~1.0 g / L, MgSO4 0.5~1.0 g / L, KH2PO4 1~5 g / L, K2HPO4 1~5 g / L, and ZnSO4·7H2O 0.1~1.0 g / L.

[0018] As some specific embodiments of the present invention, in step S1, the PDA culture medium includes: 200 g / L potato (extract), 20 g / L glucose, and 15 g / L agar.

[0019] As some specific embodiments of the present invention, the method for preparing the fermentation culture medium specifically includes the following steps: inoculating the engineered strain into PDA medium, culturing it in a constant temperature incubator at 28 ℃ for 4 days to prepare a spore suspension; inoculating 10 spores into 100 mL of molasses medium... 6 After incubating the spores at 28 °C and 180 rpm for 6 days, the mycelium was filtered through filter paper to obtain the supernatant. The supernatant was then filtered through a 0.22 µm sterile filter membrane and collected for later use.

[0020] Fifthly, the present invention provides a biological control agent prepared using the fermentation culture broth described in any one of the above-mentioned claims.

[0021] Sixthly, the present invention provides a Trichoderma harzianum as described in any of the preceding claims. TaMTA1 Application of gene-deleted engineered bacteria, fermentation broth, or biological control agents in the prevention and control of maize diseases.

[0022] As some specific embodiments of the present invention, the corn diseases include at least one of corn leaf spot, corn leaf blight, corn curvature leaf spot, and corn stalk base rot.

[0023] As some specific embodiments of the present invention, the corn disease is caused by at least one of the following: small leaf spot fungus race O, small leaf spot fungus race T, large leaf spot fungus, crassiforme, Fusarium graminearum, Fusarium verticillatum, and Fusarium pseudograminearum.

[0024] Compared with the prior art, the present invention has the following beneficial effects: (1) Compared with the wild-type strain, the TaMTA1 gene-deleted engineered strain of Trichoderma harzianum of the present invention showed a significant increase in the inhibition rate of O race of small leaf spot of maize, T race of small leaf spot of maize, large leaf spot of maize, Curvularia crescentis, Fusarium graminearum, Fusarium verticillatum and Fusarium pseudograminearum to varying degrees in the fermentation broth of the wild-type strain. (2) Under greenhouse pot conditions, its fermentation liquid has a control effect of more than 70% on corn leaf spot, which is significantly better than wild-type strains. It also has a control effect of significantly better than wild-type strains on corn leaf spot, corn curvature leaf spot and corn stem base rot. Attached Figure Description

[0025] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1This is a schematic diagram of the construction of the TaMTA1 gene knockout cassette in Example 1; Figure 2 This is a plasmid map of the TaMTA1 gene knockout recombinant plasmid in Example 1; Figure 3 The results are PCR detection results of the gene knockout mutant strain in Example 1; Figure 4 The results are the qPCR detection results of the gene knockout mutant strain in Example 1; Figure 5 This is a comparison chart of the inhibition rates of the fermentation broths of wild-type and engineered strains against seven maize pathogens in Example 2. Figure 6 The image shows the control effect of the three treatment groups on maize leaf spot disease in the pot experiment of Example 3; Figure 7 This is a statistical chart showing the average lesion area of ​​the three treatment groups in the pot experiment of Example 3; Figure 8 The diagram shows the control effect of the three treatment groups on corn stalk rot in the pot experiment of Example 3; Figure 9 The image shows the plasmid map of the pCambia1300qh plasmid constructed in Example 1. Detailed Implementation

[0026] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.

[0027] Example 1: Trichoderma harzianum TaMTA1 Construction of gene deletion mutants The starting strain used in this embodiment is *Trichoderma harzianum* strain. K223452 Its accession number is CGMCCNo.17199, the accession date is April 1, 2019, the depositary institution is China General Microbiological Culture Collection Center, and the depositary address is Institute of Microbiology, Chinese Academy of Sciences, No.3, No.1 Beichen West Road, Chaoyang District, Beijing.

[0028] For ease of description, this invention uses Trichoderma harzianum strains. K223452 The strain, referred to as wild-type strain T30 (T30 being our laboratory's work number), had a methyltransferase-encoding gene identified in its genome, which was named... TaMTA1 Its CDS length is 1101 bp, encoded as 367 aa, and contains a highly conservative MT-A70 structure domain (PF05063).

[0029] TaMTA1 The nucleotide sequence of the gene is shown in SEQ ID NO.1:

[0030] In this embodiment, the gene encoding methyltransferase in wild-type strain T30 was knocked out through Agrobacterium-mediated transformation. TaMTA1 A methyltransferase-deficient mutant strain was obtained. The construction method specifically includes the following steps: 1. Constructing gene knockout vectors (1) with TaMTA1 Using 1000 bp homologous arm sequences upstream and downstream of the gene as templates, specific primers TaMTA1-Up-F / R and TaMTA1-Down-F / R were designed.

[0031] The sequence of TaMTA1-Up-F (SEQ ID NO.2): acgacggccagtgccaagcttACCGCCTCGATGCTTCAC; The sequence of TaMTA1-Up-R (SEQ ID NO.3): gttgacctccGTCGGCGCATGAGATTATACACTCA; The sequence of TaMTA1-Down-F (SEQ ID NO.4): gcgtcaatttCATTGGTATAATGTCAATGCCGTGGAAC; The sequence of TaMTA1-Down-R (SEQ ID NO.5): tgattacgaattcgagctcggtaccATATGCCTGTATAGCATCATCTCGAACAG.

[0032] The upstream 1000 bp homologous arm sequence of the TaMTA1 gene (SEQ ID NO.6): ACCGCCTCGATGCTTCACGTCCAGCGCATCATTCCCGGCATCGACCCCAACCGACCTATGCGTTTCATCCTTGTCGAGGGGTCGGAGCAGTTCAAGCCCGAATACTGGAACCGCATCGTTGCGGTGTTTACAACAGGCCAGACGTGGCAGTTCAAGAATTACAAGTGGAGCAATCCCAACGAGCTGTTCAAGCACACCATGGGCGTGTTCGTTGGATGGAGAGGCGACCTGCCGCCGGATAATATCCGCGGCTGGGGCCATCGTGTCATGAGCACCAGTGTGGACCGCTGGCGAGGCGAAGACGACGTTGCCTCGCGATTCAGAGATAAGGAGGTTGTGGAGTATATCTGGAAGTCTATTGAGATGAACATGCGGAGCAAAGGATGGAGGAAAGACGCTGCCCCAACGTCGATATAAGCCAAAAACTTGCCGGTCCTTTGGGCAAAGTTGAAAAGGATGGGAAATAGTGAGCGGTATCAAGGGATTGGAAAGGATGAACAAAGATGCCAAAGATAACACAAAGGCGCGAGCCATTGTCATGGCATAGCCGGGGCTATTGGTGATTTGGGAGAGAATGTACAACAAACTCTGCACGTATACATTTTTCCTTGTTCGTTTTGGAGCGACGGCGTTTTGGGTTTTTCTTTCCTTTCACCTTCTTTTTCTAACAAAGGGTAGAAGAGAAGAGTGGAAGGACGAGTAAAAGTAAGATAATAAAGAAAATTGAAAATGAAAGAATCTATTGCCATTTTTAGCAAATTGTATAAACGATTGTAATGGATGGATGTGATTGATGTAATCCTATTGGCCCTTTCCTGCCTGTACTAGCGCTAACCCGTTGGCAAGTAAATCTTGAATCACTTTGACGGAAGGCCTTTGCGTTTGCTTGCCATATATTCAAGCAGCGACTCTTCAAATGGCTTTGTCTCTTTATTTGTGATATGAACCATATGTTTGTCATTGATTATAGCATAATGAGTGTATAATCTCATGCGCCGAC; TaMTA1 1000 bp downstream homologous arm sequence (SEQ ID NO.7): CATTGGTATAATGTCAATGCCGTGGAACCGGGATCCGAAGTAGAAAGGAATGGTCTTATAGCCATTTTGTTCAAGTTCAAGAATAATATACATAAGGTACATACATACATACATGCCACGTTCTATGCATCCAAGTCGTACACTGGCCAGTCGCCATCATCCCCTCTTTTCCTGTATATTCCCAATCGGAGAAGAAAACCCGTAGTGCTCGCTCCCTCTTTTTGGTATTCCGTTTTCCATTATCCCATTTTTAAAGTTATTCCATTTCATGAAGTTGTCGTTGTCTTCTCTGCTGATTTCACAGCCTTGTCCTTACCCAGAATCTGATCCCACCTAGGATCCAGAACAACATTGTTCTCCCACTTAACCTCTCCCGCCAACATCTTCTTAGCCAATTTACCCAGCTCCACCCTTTCCTTGGGCACCGGCTCCTGGCTCTTGAGCGGGATCTGGAACCGCTGCCTTACGAGCTGCTCCTCGTTCCGCTTCTCAATCGTGTCCTCGCGCATCTTCCACAGCTCGTTGCTCCAGGGCTCCAGGTCCGCCGGCACCTCGGGCCACTGGAACGGCTTGGCCAGCTCGACCGTCATGATCTTCTGCGGCTGCGGGCGGTACCAGGAGCGCGAGCTGGTGCTGCGCTGGGTGAGCGGCTGCTGCTTGACGTAGGACCGGACGGCGGTGACTTCGACGCTGTAGAGGTTCCAGAGGTAGTCTCGCAGGTCGAACTTTGTGAATCGCAGGGGCACCTTGAAGCAGGCCTCGTTGGGGGGGAGGTGTTCTTTTCGGAGCATCGTGATGACATGGTTTGGCCTGGGGGGGGACTGGTGGTGAGTTATTGCGCAAGGGAGAGTCTCACGGGCTGTAGAGAGAGTTGGCGTACAAGAAAACTTGCTTTTGGCCCAGCTTGAAGGCGGGCAATTGGCGCGCGGCCGCTTTCACTGCCTCGGCCATGGCTGCAGTGTGAATTGGATCTGTTCGAGATGATGCTATACAGGCATAT。

[0033] (2) Hygromycin resistance gene Hph Using this as a template, primers Hph-F and Hph-R were designed.

[0034] The sequence of Hph-F (SEQ ID NO.8): atgcgccgacGGAGGTCAACACATCAATGCCTATTTTG; The sequence of Hph-R (SEQ ID NO.9): tataccaatgAAATTGACGCTTAGACAACTTAATAACACATTGC.

[0035] Hph Gene sequence (SEQ ID NO.10):

[0036] (3) Amplification using TaMTA1-Up-F / R primer pair TaMTA1 The upstream 1000 bp homologous arm of the gene was amplified using the TaMTA1-Down-F / R primer pair, and the downstream 1000 bp homologous arm was amplified using the Hph-F and Hph-R primer pairs. The respective PCR reaction systems and procedures are shown below: Table 1. PCR Reaction System

[0037] PCR reaction procedure: Pre-denaturation 95 °C, 3 min; 35 cycles: denaturation 95 °C, 15 s, annealing 58 °C, 15 s, extension 72 °C, 45 s; complete extension 72 °C, 5 min; store at 12 °C.

[0038] After purification and recovery, it is obtained TaMTA1 1000 bp upstream homologous arm of the gene TaMTA1 The gene has a 1000 bp homologous arm downstream, as well as a fragment of the hygromycin resistance gene.

[0039] (4) Using commercially available pCambia1300 as a backbone, the plant-derived hygromycin resistance expression cassette driven by the CaMV 35S promoter in its T-DNA region was removed and replaced with a fungal resistance expression cassette of the Aspergillus nidulans Trpc promoter-hph gene-CaMV 35S polyA terminator. An upstream multiple cloning site (HindIII / PstI) and a downstream multiple cloning site (KpnI / EcoRI) were introduced on either side of this cassette, while completely preserving the T-DNA boundary sequence, kanamycin resistance gene, and pVS1 replicon. The constructed pCambia1300qh plasmid map is shown below. Figure 9 As shown.

[0040] The linear vector pC1300qh was obtained by digesting plasmid pCambia1300qh with HindIII and KpnI enzymes (Thermo Fisher Scientific) at 37℃ for 30 min. The enzyme digestion system is shown in Table 2 below: Table 2 Enzyme digestion system

[0041] After purification and recovery TaMTA1 Upstream arm of the gene, hygromycin Hph resistance gene fragment, TaMTA1 The downstream arms of the gene were mixed in a 1:1:1 molar ratio, and the three fragments were ligated into the digested pC1300qh linear vector using recombinase to form... TaMTA1 Gene knockout recombinant plasmids (e.g.) Figure 2 (as shown), TaMTA1 Upstream arm of the gene, hygromycin Hph resistance gene fragment, TaMTA1 The downstream arm of a gene constitutes a gene knockout cassette (e.g. Figure 1 (As shown). Following the instructions for the ClonExpress Ultra One Step Cloning Kit V3 (Novizan), the amounts of vector and insert fragment were designed, and the reaction was carried out at 50℃ for 30 min. The homologous recombination system is shown in Table 3 below: Table 3. Homologous Recombination System

[0042] The ligation product obtained above was transformed into Escherichia coli DH5α. Single colonies that were verified to be correct by colony PCR were sent to Zhejiang Youkang Biotechnology Co., Ltd. for sequencing. Plasmids with correct sequencing results were stored at -20 ℃ for later use.

[0043] 2. Reorganization and Transformation The gene knockout recombinant plasmid, with correct sequencing, was transformed into strain AGL-1. Agrobacterium containing the recombinant plasmid was cultured at 28°C for 48 h on LB agar plates containing the corresponding antibiotic (50 mg / L Kana + 20 mg / L Rif). Single colonies were picked and placed in LB broth containing the same antibiotic, and cultured at 28°C and 220 rpm until OD600 = 0.6-0.8. The cells were collected by centrifugation at 4000 g for 5 min, resuspended in IM induction medium (containing 200 µM acetylsalicylic acid and 40 mM MES, pH 5.3) and adjusted to OD600 = 0.2, and induced for another 4–6 h. Simultaneously, the *Trichoderma harzianum* T30 spore suspension was adjusted to a final concentration of 5 × 10⁻⁶ spores in IM liquid medium. 5 Cells / mL, germination at 28℃ for 6 h.

[0044] 3. Screening and Cultivation An equal volume of the induced Agrobacterium tumefaciens suspension was mixed with a suspension of Trichoderma harzianum T30 spores. 200 μL of this mixture was evenly spread onto an IM co-culture plate (containing 200 µM acetylsylcholine) lined with cellophane and incubated in the dark at 23 °C for 48 h. After co-culture, the plate was sealed with a covering agar containing 300 µg / mL termethin + 200 µg / mL hygromycin and incubated at 28 °C for 3–7 days. Single colonies with clear edges and normal growth were selected and transferred to CYA plates containing the same antibiotics. This process was repeated for 5 generations. Single spores were isolated from stably growing strains to ensure the acquisition of homozygous transformants.

[0045] 4. Verification The missing data obtained by the above construction method TaMTA1 The engineered strain of the gene could not be detected by PCR. TaMTA1 ,like Figure 3 As shown, lanes 1-4 are for amplification. TaMTA1 The genes, from left to right, are template genomic DNA from T30 and three gene knockout mutants: Δmta1-1, Δmta1-3, and Δmta1-12; and can be detected by PCR. Hph Gene fragments, lanes 5-8 are for amplification hph The genes, from left to right, were template genomic DNA derived from T30 and three gene knockout mutants: Δmta1-1, Δmta1-3, and Δmta1-12. They were undetectable by qPCR. TaMTA1 Gene expression (e.g.) Figure 4 As shown in the figure, the knockout of this gene was confirmed.

[0046] Furthermore, to ensure the genetic stability of the engineered strain and rule out the possibility of multiple copy insertions, whole-genome resequencing and T-DNA insertion site analysis were performed on the obtained engineered strain Δmta1. The results showed that a single T-DNA insertion event was detected on chromosome sca3 in the engineered strain's genome, specifically located at 3494417–3495518, corresponding to the left and right border insertion sites of the T-DNA. This confirmed that the hygromycin resistance gene was a single-copy insertion, without random integration.

[0047] The above-mentioned missing TaMTA1 The engineered strain of the gene was named Trichoderma afroharzianum Δmta1 is deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M 2026086 and deposit date of January 12, 2026.

[0048] Example 2 Plate Antibacterial Experiment This embodiment tests the antibacterial effect of the above-mentioned engineered strain's metabolic fluid by performing a plate inhibition experiment, the steps of which are as follows: Wild-type Trichoderma harzianum T30 and engineered strain CCTCC M 2026086 were inoculated into PDA medium and cultured at 28℃ for 4 days to prepare spore suspensions. Spore suspensions were then inoculated into 100 mL molasses medium (molasses 30 g / L, soybean peptone 5.2 g / L, beef extract 4 g / L, (NH4)2SO4 0.6 g / L, MgSO4 0.7 g / L, KH2PO4 2 g / L, K2HPO4 2 g / L, ZnSO4·7H2O 0.5 g / L) for 10 days. 6Spores were cultured at 28℃ and 180 rpm for 6 days. The fermentation broth was collected, and the supernatant was obtained by filtering the mycelia through filter paper. The supernatant was then filtered through a 0.22 µm sterile filter membrane, and the filtrate was placed in a sterile centrifuge tube for later use. 7.5 mL of fermentation broth was mixed thoroughly with 22.5 mL of PDA medium and poured into petri dishes, 10 mL per dish. After cooling, mycelial cakes of different plant pathogens were inoculated into the center of each petri dish and incubated at 28℃ for 72 h. The diameter of the pathogens was measured using the cross-hatching method, and the inhibition rate was calculated using the following formula: Inhibition rate (%) = (Control colony diameter - Treated colony diameter) / Control colony diameter.

[0049] The results are shown in Tables 4-10, and Figure 5 .

[0050] Table 4. Inhibition rate (%) of fermentation supernatant from wild strain T30 and engineered strain Δmta1 against race O of maize leaf spot pathogen.

[0051] Table 5. Inhibition rate (%) of fermentation supernatant of wild strain T30 and engineered strain Δmta1 against race T of maize leaf spot pathogen.

[0052] Table 6. Inhibition rate (%) of fermentation supernatant of wild strain T30 and engineered strain Δmta1 against maize leaf spot pathogen (Helicobacter pylori).

[0053] Table 7. Inhibition rate (%) of fermentation supernatant from wild strain T30 and engineered strain Δmta1 against Curvularia crescentis

[0054] Table 8. Inhibition rate (%) of fermentation supernatant from wild strain T30 and engineered strain Δmta1 against Fusarium graminearum.

[0055] Table 9. Inhibition rate (%) of fermentation supernatant of wild strain T30 and engineered strain Δmta1 against Fusarium verticillatum.

[0056] Table 10 Inhibition rate (%) of fermentation supernatant of wild strain T30 and engineered strain Δmta1 against Fusarium oxysporum.

[0057] The results of the plate inhibition experiment showed that the Trichoderma engineered strain Δmta1 constructed in this invention significantly improved the inhibition rate against different maize pathogens compared with the wild type.

[0058] Example 3: Greenhouse Pot Experiment This embodiment tests the effect of the fermentation broth of the above-mentioned Trichoderma engineered strain on inhibiting maize diseases in a pot experiment.

[0059] The experimental steps for inhibiting leaf diseases in maize are as follows: Maize seedlings of the Zhengdan 958 variety at the three-leaf-one-heart stage with uniform growth were selected and randomly divided into three treatment groups, with three plants in each group, and three replicates were set up. The three treatment groups were: ① 30% molasses medium (CK); ② sprayed with fermentation broth of wild-type strain T30; ③ sprayed with fermentation broth of engineered strain CCTCC M 2026086. The preparation method of the fermentation broth was the same as in Example 2. 24 h before inoculation with pathogens, the maize plants in each treatment group were foliar sprayed with 5 mL of fermentation broth or 30% molasses medium per plant. 24 h after treatment, the spore suspensions of race O of maize small leaf spot pathogen, maize large leaf spot pathogen (Helicobacter lumbricoides), and Curvularia lunata (concentration of 1×10⁻⁶) were inoculated on the 2nd-3rd leaves of the maize plants, respectively. 5 (Spores / mL), inoculate 4 sites per leaf, with 10 µL of spore suspension at each site. After inoculation, incubate in the dark at 28 ℃ and 100% relative humidity for 24–36 h, then transfer to normal light conditions. Investigate disease incidence on day 3 post-inoculation, measure and calculate lesion area and control efficacy.

[0060] In a pot experiment to control maize stalk rot, the inoculation method differed from that used for maize leaf diseases, but all other procedures were the same. The specific inoculation procedure was as follows: Select maize plants of the Zhengdan 958 variety with uniform growth at the jointing stage. After creating a wound at the base of the stem using a sterile needle, inject 20 µL of a suspension of Verticillium pseudospores (concentration of 1×10⁻⁶). 7 (number of lesions / mL). After inoculation, the cells were cultured under normal light conditions. On day 7, the disease incidence was investigated, and the lesion area and control effect were measured and calculated.

[0061] The formula for calculating the control effect is as follows: Control effect (%) = (Control lesion area - Treated lesion area) / Control lesion area × 100%. The results are shown in Table 11-14 below.

[0062] Table 11. Control efficacy of fermentation supernatant from wild strain T30 and engineered strain Δmta1 against maize leaf spot disease.

[0063] like Figure 6 and 7 The image shown is a diagram illustrating the results of a pot experiment on the control of maize leaf spot disease. Figure 6 The graph shows the control effects of three treatment groups on maize leaf spot disease. Figure 7 This is a statistical graph showing the average lesion area of ​​the three treatment groups.

[0064] Table 12. Control efficacy of fermentation supernatant from wild strain T30 and engineered strain Δmta1 against maize leaf spot disease.

[0065] Table 13. Control efficacy of fermentation supernatant from wild strain T30 and engineered strain Δmta1 against maize curvularia leaf spot.

[0066] Table 14. Control efficacy of fermentation supernatant from wild strain T30 and engineered strain Δmta1 against maize stalk rot.

[0067] like Figure 8 The figure shown illustrates the control effects of three treatment groups on corn stalk rot in a pot experiment.

[0068] In Tables 11-14 above, different lowercase letters in the same row (or column) indicate significant differences (P<0.05), while the same letter indicates no significant differences (P>0.05).

[0069] The results of the pot experiment showed that the fermentation broth of the engineered Trichoderma strain Δmta1 constructed in this invention significantly reduced the lesion area of ​​common leaf diseases in maize. The average lesion area of ​​maize leaf spot disease in the engineered strain treatment group was significantly lower than that in the control group on 30% molasses medium, and also significantly lower than that in the wild-type strain T30 treatment group, indicating that the engineered strain has a significantly better control effect on maize leaf spot disease than the wild-type strain. Similarly, the engineered Trichoderma strain Δmta1 of this invention also significantly reduced the lesion area of ​​maize stalk rot, indicating that the engineered strain also has a significantly better control effect on maize stalk rot than the wild type.

[0070] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A species of Trichoderma harzianum from Africa TaMTA1 Gene-deleted engineered bacteria, characterized in that, Named Trichoderma afroharzianum Δmta1, with accession number CCTCC NO: M 2026086.

2. An engineered strain of *Trichoderma harzianum* with the TaMTA1 gene deleted, characterized in that, The gene-deleted engineered bacteria were created by knocking out wild-type Trichoderma harzianum. K223452 Methyltransferases in TaMTA1 Gene acquisition; The wild-type African Trichoderma harzianum K223452 Its accession number is CGMCC No. 17199; The TaMTA1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. A method for constructing a gene-deleted engineered bacterium as described in claim 2, characterized in that, Includes the following steps: A1. Amplification using primers shown in SEQ ID NO.2-3. TaMTA1 The 1000 bp homologous arm upstream of the gene was amplified using primers shown in SEQ ID NO. 4-5. TaMTA1 The hygromycin resistance gene fragment was amplified using primers shown in SEQ ID NO.6-7, 1000 bp downstream of the gene; A2. By seamless cloning, the upstream homologous arm, hygromycin resistance gene, and downstream homologous arm were ligated into a linearized vector to construct the TaMTA1 gene knockout recombinant plasmid, which was then transformed into Agrobacterium AGL-1. A3. Recombinant Agrobacterium AGL-1 was co-cultured with spore suspension of wild-type Trichoderma harzianum K223452 and screened in a medium containing hygromycin to obtain the engineered strain of Trichoderma harzianum with TaMTA1 gene deletion.

4. A fermentation culture medium, characterized in that, It is obtained by fermentation culture of the gene-deleted engineered bacteria as described in claim 1 or 2.

5. The fermentation broth according to claim 4, characterized in that, The preparation method of the fermentation culture medium includes the following steps: S1. Inoculate the engineered strain of Trichoderma harzianum with the TaMTA1 gene deletion into PDA medium and culture at a constant temperature to obtain a spore suspension; S2. Inoculate the spore suspension into molasses culture medium, incubate at a constant temperature, filter, and collect the sterile fermentation supernatant to obtain the spore suspension.

6. The fermentation broth according to claim 5, characterized in that, Includes at least one of the following technical features:

1. In step S1, the constant temperature incubation is 25~30 ℃, and the time is 2~5 days; 2. In step S2, the inoculation density is 1~10×10⁻⁶. 4 The culture volume was 10 cells / mL, and the isothermal culture temperature was 25~30 ℃, the time was 4~10 days, and the rotation speed was 150~200 rpm; Third, in step S2, the filtration includes first filtering the mycelium with filter paper to obtain the supernatant, and then filtering with a sterile filter membrane, wherein the pore size of the sterile filter membrane is 0.22 μm; IV. In step S2, the molasses culture medium comprises: molasses 10~50 g / L, soybean peptone 2~10 g / L, beef extract powder 1~5 g / L, (NH4)2SO4 0.2~1.0 g / L, MgSO4 0.5~1.0 g / L, KH2PO4 1~5 g / L, K2HPO4 1~5 g / L, and ZnSO4·7H2O 0.1~1.0 g / L.

7. A biological control agent, characterized in that, It is prepared using the fermentation culture medium as described in any one of claims 4-6.

8. The application of an engineered strain of Trichoderma harzianum TaMTA1 gene deletion as described in claim 1 or 2, a fermentation culture broth as described in any one of claims 4-6, or a biological control agent as described in claim 7 in the control of maize diseases.

9. The application according to claim 8, characterized in that, The corn diseases include at least one of corn leaf spot, corn leaf blight, corn curvature leaf spot, and corn stalk rot.

10. The application according to claim 8 or 9, characterized in that, The corn disease is caused by at least one of the following: small leaf spot fungus race O, small leaf spot fungus race T, large leaf spot fungus, crassiforme, Fusarium graminearum, Fusarium verticillatum, and Fusarium pseudograminearum.

Images