A method for producing salidroside by engineering saccharomyces cerevisiae based on corn syrup dry powder strengthening

CN122542406APending Publication Date: 2026-08-11NANJING TECH UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610688621.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-19
Publication Date
2026-08-11

AI Technical Summary

Technical Problem

然而,如果直接将其高浓度应用于发酵体系,会对普通的工程酵母底盘造成多重物理与化学胁迫,导致菌体生长极其缓慢甚至停滞,进而导致红景天苷的合成效率与最终产量大幅下降,这也是现有技术中难以实现CSLP高比例替代的根本原因

Benefits of technology

[0050] This invention, through optimization of the fermentation process and precise balance of the strain's chassis-based stress-resistant metabolism, constructed an engineered strain that exhibited exceptional robustness and production capacity in a 5 L automated fermenter. Under a low-cost, fed-batch fermentation mode using corn steep liquor and a combined nitrogen source, the final yield of rhodioloside reached 36.7 g/L. This yield and economic efficiency far exceed those reported in existing literature and patents, completely opening up the possibility of industrial-scale production of rhodioloside through efficient and low-cost microbial fermentation, demonstrating extremely high conversion value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122542406A_ABST
    Figure CN122542406A_ABST
Patent Text Reader

Abstract

This invention discloses a method for producing rhodioloside using engineered brewing yeast fortified with corn steep liquor powder, belonging to the fields of synthetic biology and fermentation engineering. First, this invention establishes an optimal nitrogen source strategy by combining yeast extract with inexpensive corn steep liquor powder (CSLP) in a 1:1 ratio. Furthermore, by constructing a novel engineered yeast strain highly adapted to the CSLP fermentation system, and combining optimized CSLP addition concentration and timing, high-density, low-cost fermentation of rhodioloside was achieved in a 5 L fermenter, with a maximum yield of 36.71 g / L. This invention significantly reduces industrial production costs and provides a novel technological approach for the large-scale green biomanufacturing of rhodioloside.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of synthetic biology, metabolic engineering and genetic engineering, and specifically to a method for efficiently producing rhodioloside using agricultural waste corn steep liquor powder (CSLP) as a supplementary nitrogen source. Technical Background

[0002] Salidroside (Sal) is the core bioactive component of the rare alpine medicinal plant Rhodiola rosea. Modern pharmacology has confirmed its significant pharmacological effects, including anti-hypoxia, anti-fatigue, free radical scavenging (antioxidant), immune regulation, and protection of the nervous and cardiovascular systems. It holds great commercial potential in functional foods, innovative drugs, and high-end cosmetics. However, traditional methods of acquisition heavily rely on extraction from the rhizomes of wild Rhodiola rosea. Because Rhodiola rosea grows primarily in high-altitude, frigid regions, its natural growth cycle is extremely slow, and the basal accumulation of salidroside within the plant is very low. In recent years, the surge in market demand and predatory harvesting have severely damaged the ecological resources of wild Rhodiola rosea, posing a significant risk of endangerment. Therefore, constructing microbial cell factories using synthetic biology and metabolic engineering techniques for the heterologous biosynthesis of salidroside has become a research hotspot for overcoming the limitations of natural resources and achieving sustainable green manufacturing. Saccharomyces cerevisiae, a generally recognized as safe (GRAS) strain, is endotoxin-free and possesses high secretion capacity and genetic ease of handling, making it an excellent host for the production of rhodioloside. However, despite breakthroughs in rhodioloside synthesis achieved by engineered yeasts at the laboratory level, fermentation costs remain the biggest hurdle to industrialization. Existing high-yield fermentation processes, in order to maintain the high cell density and intense heterogeneous pathway catalytic load of engineered strains, heavily rely on high-purity and expensive organic complex nitrogen sources such as yeast extracts and trypsin. In actual scale-up production, these high-end nitrogen sources account for the majority of material costs, resulting in persistently high final manufacturing costs and severely weakening the economic competitiveness of biosynthetic routes.

[0003] To achieve genuine cost reduction and efficiency improvement, introducing bulk industrial or agricultural waste as alternative fermentation substrates has become a key breakthrough. Corn steep liquor powder (CSLP), a byproduct of corn starch deep processing, is extremely inexpensive and rich in free amino acids, vitamins, and trace elements, making it an ideal candidate for a low-cost nitrogen source. However, directly applying it at high concentrations to the fermentation system would subject ordinary engineered yeast substrates to multiple physical and chemical stresses, leading to extremely slow or even stagnant cell growth. This, in turn, results in a significant decrease in the synthesis efficiency and final yield of rhodioloside, which is the fundamental reason why it is difficult to achieve a high proportion of CSLP substitution in existing technologies. Summary of the Invention

[0004] The purpose of this invention is to provide a method for promoting the production of rhodioloside by engineered brewing yeast, by adding corn steep liquor powder to the fermentation medium to increase the yield of rhodioloside.

[0005] Another objective of this invention is to provide an engineered Saccharomyces cerevisiae strain fortified with corn steep liquor powder. The recombinant Saccharomyces cerevisiae possesses a rhodioloside synthesis pathway. By overexpressing specific stress-resistant genes, either alone or simultaneously, it relieves the stress and metabolic inhibition on cell growth caused by complex impurities in the inexpensive corn steep liquor powder system. At the same time, it utilizes the abundant trace elements and cofactors in the corn steep liquor powder to synergistically enhance the catalytic efficiency of key enzymes in the synthesis pathway, thereby further promoting the large-scale accumulation of rhodioloside.

[0006] The present invention also provides a method for constructing the above-mentioned recombinant Saccharomyces cerevisiae strain.

[0007] This invention also provides the application of the above-mentioned engineered Saccharomyces cerevisiae strain in the low-cost, large-scale synthesis of the natural product rhodioloside.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A method for promoting the production of rhodioloside by engineered brewing yeast involves activating and culturing the engineered brewing yeast to obtain a seed culture, which is then inoculated into a fermentation medium. At least one of the following is added to the fermentation medium: corn steep liquor powder, soybean meal powder, peanut cake powder, beer lees, wine lees, urea, ammonium sulfate, and ammonium chloride.

[0010] The fermentation medium consisted of: 10–40 g / L glucose, 7–35 g / L nitrogen source, and 1.0–4.0 mM Ca. 2+ 0.5~3.0mM Fe 2+ .

[0011] The total nitrogen source concentration is 7~35 g / L, and the nitrogen source includes yeast extract mixed with at least one of corn steep liquor powder, soybean meal powder, peanut cake powder, beer lees, wine lees, urea, ammonium sulfate, and ammonium chloride.

[0012] Preferably, the nitrogen source in the fermentation medium is yeast extract and corn steep liquor powder.

[0013] The mass ratio of corn steep liquor powder to yeast extract in the culture medium is (1~4):(1~4).

[0014] Preferably, the corn steep liquor powder and yeast extract are mixed and used in a mass ratio of 1:1, 1:2, 1:3, 1:4, 4:1, 3:1, or 2:1.

[0015] Preferably, the corn steep liquor powder and yeast extract are mixed in a mass ratio of 1:1.

[0016] Preferably, the final concentration of the corn steep liquor powder is 7~28 g / L.

[0017] Preferably, corn steep liquor powder is added during fermentation from 0 h to 48 h.

[0018] Preferably, corn steep liquor powder is added after 24 hours.

[0019] Preferably, starting from 24 hours of fermentation, corn steep liquor powder solution is added in batches, with each addition increasing the final concentration of corn steep liquor powder in the fermentation system by 7~28 g / L.

[0020] The fermentation conditions are: fermentation temperature 28~30℃, fermentation time 3~8 days.

[0021] The conditions for shake-flask fermentation are: temperature 28~30℃, shaker speed 180 rpm, and fermentation cycle 3-6 days.

[0022] The batch feeding fermentation process in a 5 L fermenter is as follows: (1) Seed liquid is introduced into the fermenter at an inoculation rate of 1~10% (v / v), temperature 28~30℃, rotation speed 300~500 rpm, and relative dissolved oxygen 30~40%;

[0023] (2) The initial glucose concentration is 20 g / L, and the concentration in the feed glucose control tank is controlled below 4 g / L;

[0024] (3) Starting from the 24th hour of fermentation, add 25 mL of 100~300 g / L corn steep liquor dry powder solution every 12 hours, and continue to add materials until the end of fermentation. The total fermentation cycle is 5 days.

[0025] The fermentation medium formula is: glucose 10~40 g / L, yeast extract 7~35 g / L, corn steep liquor powder 7~28 g / L, Ca 2+ 1.0~4.0 mM, Fe 2+ 0.5~3.0 mM.

[0026] An engineered Saccharomyces cerevisiae strain fortified with corn steep liquor powder, based on an initial engineered Saccharomyces cerevisiae strain capable of synthesizing rhodioloside, overexpresses the global amino acid response regulator gene GCN4, the UDP-glucose pyrophosphorylase gene UGP1, and the trehalose synthase gene TPS1, and knocks out the glycogen synthase gene GSY2. The encoding gene of the global amino acid response regulator gene GCN4 is shown in SEQ ID No. 1; the encoding gene sequence of the UDP-glucose pyrophosphorylase gene UGP1 is shown in SEQ ID No. 2; the encoding gene sequence of the trehalose synthase gene TPS1 is shown in SEQ ID No. 3; the encoding gene of the glycogen synthase gene GSY2 is shown in SEQ ID No. 4, and the upstream and downstream 600 bp sequences GSY2-U and GSY2-D of the glycogen synthase gene GSY2 are shown in SEQ ID No. 6 and SEQ ID No. 7.

[0027] It also includes the introduction of the moderate expression intensity promoter GPM1p, the sequence of which is shown in SEQ ID No. 5.

[0028] The initial engineered Saccharomyces cerevisiae capable of synthesizing rhodioloside can be, for example, modified by expressing ribulose-5-phosphate isomerase and transketolase in Saccharomyces cerevisiae to increase the supply of precursors; expressing reverse methyltransferase and phenylalanine decarboxylase to regulate the tyrosine branching pathway; and finally, expressing UDP-glycosyltransferase to achieve efficient biosynthesis of rhodioloside.

[0029] For example, it can be any one of the Saccharomyces cerevisiae Sc-05, Sc-06, Sc-07, and Sc-08 constructed with reference to CN121343793A.

[0030] The method for constructing the above-mentioned recombinant Saccharomyces cerevisiae strain includes:

[0031] The GCN4 and UGP1 genes were expressed by constructing the Saccharomyces cerevisiae expression plasmid pRS305-TEF1p-UGP1-CYC1t-TDH3p-GCN4-CYC1t using the expression plasmid pRS305. This plasmid was then introduced into the initial engineered Saccharomyces cerevisiae capable of synthesizing rhodioloside, thus obtaining Saccharomyces cerevisiae Sc-2.

[0032] The moderately expressed promoters GPM1p and TPS1 genes were introduced into the Saccharomyces cerevisiae Sc-2 by constructing the Saccharomyces cerevisiae expression plasmid pRS306-GPM1p-TPS1-CYC1t-KanMX using the expression plasmid pRS306, thus obtaining Saccharomyces cerevisiae Sc-3.

[0033] The GSY2 gene was generated by constructing a yeast targeted knockout plasmid pUG6-ΔGSY2 by knocking out plasmid pUG6, and the GSY2 gene in the yeast Sc-3 was knocked out by homologous recombination to obtain the engineered yeast Sc-66 based on corn steep liquor fortification.

[0034] The application of the global amino acid response regulatory factor gene GCN4, UDP-glucose pyrophosphorylase gene UGP1, and trehalose synthase gene TPS1, and the glycogen synthase gene GSY2 knockout gene in high-yield rhodioloside in engineered Saccharomyces cerevisiae strains fortified with corn steep liquor powder.

[0035] The aforementioned engineered brewing yeast based on corn steep liquor powder fortification and its application in the efficient production of rhodioloside.

[0036] The application involves activating and seeding *Saccharomyces cerevisiae* Sc-66, then inoculating it into a fermentation medium to produce rhodioloside.

[0037] More specifically, it includes the following steps:

[0038] (1) Inoculate Saccharomyces cerevisiae Sc-66 into YPD solid medium and culture at 28~30℃ for 2-3 days to activate the strain.

[0039] (2) Take a single colony from YPD solid medium, inoculate it into seed medium at 30℃ and incubate at 180 rpm for 24 h to obtain seed liquid for fermentation culture.

[0040] (3) Inoculate the seed liquid into the fermentation medium and ferment at 30℃ and 180 rpm for 5 days.

[0041] A batch feeding method can be adopted. Specifically, after the brewing yeast Sc-66 is seed cultured, it is inoculated into a fermenter containing fermentation medium. Fermentation is carried out at 30℃ and 300 rpm for 24 hours. Then, 100~300 g / L corn steep liquor dry powder solution is added in batches, 25 mL every 12 hours, and cultured for 5 days.

[0042] This invention begins by elucidating the metabolic response mechanism of chassis cells in a complex waste matrix, and develops customized engineered strains specifically adapted to inexpensive composite nitrogen sources. This invention no longer views CSLP merely as an alternative nitrogen source, but rather as a cofactor library for specific enzymes. Through precise control of the fed-batch fermentation process, coupled with targeted pathway modification, on the one hand, the abundant trace metal ions in CSLP are utilized as catalytic cofactors, greatly improving the catalytic efficiency of key enzymes in the overexpression pathway; on the other hand, by disrupting the synthesis pathway of intracellular ineffective polysaccharides (glycogen), the accumulation of endogenous complex macromolecules in the fermentation system is significantly reduced, thereby offsetting the impurity burden introduced by CSLP and ensuring efficient filtration of the fermentation broth and easy product extraction. This is a key technological barrier to completely overcome the low-cost, high-purity, and green industrial-scale production of rhodioloside.

[0043] It is generally believed in the art that inexpensive and complex corn steep liquor powder can cause growth stress and is unsuitable as a primary nitrogen source for the fermentation of higher glycosides. This invention, through screening inexpensive nitrogen sources and fine-tuning the fermentation process, has determined the optimal application strategy for corn steep liquor powder. Results show that when corn steep liquor powder and yeast extract are mixed in a 1:1 ratio and the addition time is optimized, not only is the cost of the fermentation medium significantly reduced, but the initial fermentation yield of rhodioloside is unexpectedly increased significantly from 7.95 g / L to 8.42 g / L, demonstrating the synergistic promoting effect of complex nitrogen sources on rhodioloside synthesis at a specific ratio.

[0044] When fermenting corn steep liquor powder, cells need to activate trehalose synthase (TPS1) to synthesize trehalose to resist osmotic pressure and weak acid stress from impurities. However, this process drastically consumes UDP-glucose, the direct precursor for rhodioloside synthesis, leading to severe pathway competition. This invention cleverly employs the following combined modification strategy to overcome this technical bias:

[0045] (1) Simultaneous overexpression of global amino acid regulator GCN4 and trehalose synthase TPS1 greatly enhanced the strain’s tolerance and assimilation ability to corn steep liquor powder.

[0046] (2) In order to avoid TPS1 overexpression and the competition for precursors, this invention creatively uses a medium-strength promoter to precisely regulate its expression level so that it is just enough to maintain the cell's resistance to stress without causing excessive waste;

[0047] (3) On this basis, the UDP-glucose pyrophosphorylase UGP1 gene was further overexpressed to expand the total UDP-glucose synthesis pool, and the glycogen synthase GSY2 gene was knocked out to completely cut off another unprofitable competitive branch that consumes UDP-glucose.

[0048] This combined reconstructive strategy of open source, cost-saving, and precise regulation ensures an extremely abundant supply of intracellular UDP-glucose, perfectly achieving a metabolic balance between cell stress-resistant growth and efficient rhodioloside synthesis, further increasing the rhodioloside yield to 12.61 g / L. In a 5 L automated fermenter, under a low-cost corn steep liquor-based fed-batch fermentation mode, the final yield of rhodioloside reached 36.7 g / L.

[0049] Beneficial effects:

[0050] This invention, through optimization of the fermentation process and precise balance of the strain's chassis-based stress-resistant metabolism, constructed an engineered strain that exhibited exceptional robustness and production capacity in a 5 L automated fermenter. Under a low-cost, fed-batch fermentation mode using corn steep liquor and a combined nitrogen source, the final yield of rhodioloside reached 36.7 g / L. This yield and economic efficiency far exceed those reported in existing literature and patents, completely opening up the possibility of industrial-scale production of rhodioloside through efficient and low-cost microbial fermentation, demonstrating extremely high conversion value. Attached Figure Description

[0051] Figure 1 The effects of adding various inexpensive nitrogen sources to the fermentation medium on the biomass of Saccharomyces cerevisiae and the yield of rhodioloside.

[0052] Figure 2 The effects of different addition ratios of yeast extract and corn steep liquor powder on the biomass of Saccharomyces cerevisiae and the yield of rhodioloside.

[0053] Figure 3 The effects of adding corn steep liquor powder at different fermentation stages on the biomass of brewer's yeast and the yield of rhodioloside.

[0054] Figure 4 This is a diagram showing the relative transcriptional levels of key metabolic nodes in Saccharomyces cerevisiae Sc-08 under different nitrogen source systems.

[0055] Figure 5 A comparison of biomass and rhodioloside production of different genetically engineered Saccharomyces cerevisiae.

[0056] Figure 6 Fermentation process curve of recombinant brewer's yeast Sc-66 with corn steep liquor powder (CSLP) added in a 5 L fermenter after 24 h.

[0057] Figure 7 Fermentation process curve of initial brewing yeast Sc-08 in a 5 L fermenter, starting with the addition of corn steep liquor powder (CSLP) after 24 h.

[0058] Figure 8Fermentation process curve of recombinant brewer's yeast Sc-66 after 24 h of supplementation with yeast extract (YE) in a 5 L fermenter.

[0059] Figure 9 The diagram shows the structure of plasmid pRS305-TEF1p-UGP1-CYC1t-TDH3p-GCN4-CYC1t, which carries the LEU2 gene as a selection marker for Saccharomyces cerevisiae.

[0060] Figure 10 The structure diagram of pRS306-GPM1p-TPS1-CYC1t-KanMX is shown. The KanMX gene carried by this plasmid serves as a selection marker for Saccharomyces cerevisiae.

[0061] Figure 11 The diagram shows the structure of pUG6-ΔGSY2, and the hphMX gene carried by this plasmid serves as a selection marker for Saccharomyces cerevisiae. Detailed Implementation

[0062] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0063] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0064] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. The corn steep liquor powder used in the examples was purchased from Beijing Solarbio Technology Co., Ltd.

[0065] The *Saccharomyces cerevisiae* strain Sc-08 used in this example was constructed by our laboratory team. For details on the construction of *Saccharomyces cerevisiae* Sc-08, please refer to patent publication number CN121343793A. It was obtained by expressing endogenous ribulose-5-phosphate isomerase RKI1, transketolase TKL1, reverse methyltransferase ARO2, phenylalanine decarboxylase ARO10, and UDP-glycosyltransferase AtUGT85A1 in the host strain.

[0066] In the examples, the quantitative analysis method for rhodioloside is as follows:

[0067] The liquid chromatography system used in this study was an HPLC 1260 series, equipped with a Zorbax SB-C18 column (Agilent, 5 µm, 4.6 mm × 250 mm), and the column temperature was 30 °C. Mobile phase A was an aqueous solution containing 0.1% trifluoroacetic acid, and mobile phase B was acetonitrile; the flow rate was 1 mL / min. 85% phase A and 15% phase B were incubated isocratically for 30 min. The absorbance of rhodioloside was detected at 275 nm.

[0068] Example 1: Screening experiment of adding various inexpensive nitrogen sources to fermentation culture medium

[0069] The seed culture of Saccharomyces cerevisiae Sc-08 was inoculated at a rate of 10% (v / v) with a total nitrogen concentration of 35 g / L. The culture was then inoculated into fermentation media with different inexpensive nitrogen sources and equivalent nitrogen concentrations. Group 1 was yeast extract (control), Group 2 was corn steep liquor powder, Group 3 was soybean meal powder, Group 4 was peanut cake powder, Group 5 was brewer's grains, Group 6 was wine lees, Group 7 was urea, and Group 8 was ammonium sulfate.

[0070] Fermentation medium formulation: 20 g / L glucose, 3.5 mM Ca 2+ (CaCl2·2H2O), 1.5 mM Fe 2+ (FeSO4·7H2O).

[0071] Culture conditions: The Saccharomyces cerevisiae Sc-08 seed culture was inoculated into the above-mentioned culture media containing different inexpensive nitrogen sources at an inoculation rate of 10% (v / v) and cultured at 30℃ and 180 rpm for 120 h. 1 mL of 700 g / L glucose solution was added every 12 h.

[0072] The effects of adding different inexpensive nitrogen sources to the fermentation medium at equivalent nitrogen amounts on the growth (OD) of Saccharomyces cerevisiae Sc-08 cells were investigated. 600 The effects of ) and the synthesis of rhodioloside (Sal) were observed in three parallel experimental groups, as shown below. Figure 1 The results showed that different nitrogen sources had significant effects on cell growth and target product synthesis. Among all the single, inexpensive alternative nitrogen sources tested, the corn steep liquor powder group performed relatively well, with a cell biomass of OD0.05. 600 =31.76, Sal yield was 5.28 g / L; in contrast, the cell growth and Sal yield of the groups with cheap organic nitrogen sources from plant sources (soybean meal powder, peanut cake powder), cheap nitrogen sources from distillers' grains (beer lees, wine lees) and cheap nitrogen sources from inorganic sources (urea, ammonium sulfate) were all lower, indicating that Saccharomyces cerevisiae Sc-08 prefers to use corn steep liquor powder compared to other wastes.

[0073] However, compared with the high-purity control yeast extract group (OD) 600Compared to the group with 46.40 g / L corn steep liquor and 7.83 g / L salt yield, the cell biomass and product synthesis capacity of the single corn steep liquor powder group showed a significant and precipitous decline. This experimental result confirms that the complex composition of impurities such as lactic acid, organic acids, and heavy metals in CSLP can cause extremely severe growth inhibition and physicochemical stress to the unmodified engineered yeast chassis (Sc-08). Therefore, it is not feasible to completely replace high-quality nitrogen sources with CSLP alone. Further regulation of the fermentation process and substrate adaptation and stress-resistance reconstruction for chassis cells are necessary to completely overcome this lethal substrate stress, thereby achieving efficient and low-cost production of rhodioloside.

[0074] Example 2: Experiment on the effect of adding yeast extract and corn steep liquor powder in different proportions on the biomass of Saccharomyces cerevisiae and the yield of rhodioloside.

[0075] To screen the optimal concentration of corn steep liquor powder, and to minimize fermentation costs while ensuring optimal levels of cell biomass and target metabolite yield, this experiment fixed the total nitrogen source concentration in the fermentation medium at 35 g / L. The mass ratios of yeast extract to corn steep liquor powder were set as follows: 1:0 (whole yeast extract control group), 4:1 (28 g / L: 7 g / L), 3:1 (26.25 g / L: 8.75 g / L), 2:1 (23.33 g / L: 11.67 g / L), 1:1 (17.5 g / L: 17.5 g / L), 1:2 (11.67 g / L: 23.33 g / L), 1:3 (8.75 g / L: 26.25 g / L), and 1:4 (7 g / L: 28 g / L).

[0076] The Saccharomyces cerevisiae Sc-08 seed culture was inoculated into the above-mentioned fermentation media with different compound ratios at an inoculation rate of 10% (v / v) and cultured at 30℃ and 180 rpm for 120 h. 1 mL of 700 g / L glucose solution was added every 12 h.

[0077] Fermentation medium formulation: 20 g / L glucose, 3.5 mM Ca 2+ (CaCl2·2H2O), 1.5 mM Fe 2+ (FeSO4·7H2O).

[0078] Yeast extract and corn steep liquor powder were added to the fermentation medium at a fixed total nitrogen source concentration in different mass ratios to investigate their effects on the growth of *Saccharomyces cerevisiae* Sc-08 cells and the synthesis of rhodioloside. The results of the three parallel experiments are as follows: Figure 2The results showed that different compounding ratios had significant effects on cell growth and target product synthesis. When the mass ratio of yeast extract to corn steep liquor was 1:1, the cell biomass OD... 600 The OD value was 44.87 compared to the whole yeast extract control group. 600 =46.42, with the best performance in Sal yield reaching 7.95 g / L. When the proportion of corn steep liquor powder was lower, the cell biomass was similar to the control group, and the Sal yield remained at 7.86-8.10 g / L, without showing a significant advantage. When the proportion of corn steep liquor powder was further increased, both cell biomass and Sal yield decreased sharply. This indicates that the tolerance threshold of the initial strain Sc-08 to CSLP impurities, without deep modification, is limited to a 1:1 mixed nitrogen source level and cannot adapt to a higher proportion of inexpensive waste substrate. In order to completely break this "competitive contradiction between tolerance and synthesis" and achieve cost reduction and efficiency improvement under more extreme conditions, it is necessary to carry out deep "customized" genome reconstruction of the strain from the perspective of global regulation and UDP-glucose precursor flow reshaping.

[0079] Example 3: Effects of adding corn steep liquor powder at different fermentation stages on the biomass of brewer's yeast and the yield of rhodioloside.

[0080] Based on the optimal ratio (1:1) determined in Example 2, the optimal timing for adding corn steep liquor powder was further investigated. The initial fermentation substrate contained only yeast extract as the basic nitrogen source. A predetermined amount of corn steep liquor powder solution was added at fermentation times of 0 h (initial culture medium), 12 h, 24 h, 36 h, and 48 h. The fermentation conditions were the same as in Example 1.

[0081] The results of the three parallel experiments are as follows Figure 3 The results showed that different addition times had significant effects on cell growth and target product synthesis. When corn steep liquor powder was added at 24 h of fermentation, cell biomass remained at a high level, and Sal production reached the highest value of 8.42 g / L among all addition times. At 0 h, both cell biomass and Sal production were at a moderate level. At 12 h, Sal production decreased slightly. At 36 h and 48 h, although cell biomass increased slightly, Sal production decreased significantly, indicating that adding corn steep liquor powder too late could not effectively promote the synthesis of the target product. Based on the experimental data, 24 h of fermentation is the optimal time to add corn steep liquor powder. At this time, the brewer's yeast has accumulated sufficient biomass using high-quality yeast extract. The added corn steep liquor powder can maintain stable cell growth while significantly stimulating secondary metabolism, further increasing rhodioloside production, and providing a better nitrogen source supplementation strategy for industrial production.

[0082] Example 4

[0083] To deeply understand the profound impact of the complex matrix of corn steep liquor powder on the cellular metabolic network of rhodioloside synthesis and to provide a solid molecular basis for customized gene modification, this study analyzed the transcriptional levels of key metabolic nodes in *Saccharomyces cerevisiae* Sc-08 fermented under different nitrogen source systems. In this experiment, the total nitrogen source concentration in the fermentation medium was fixed at 35 g / L. The initial seed culture of engineered *Saccharomyces cerevisiae* Sc-08 was inoculated into a whole yeast extract fermentation medium (as a control) and a fermentation medium containing a 1:1 mixture of yeast extract and corn steep liquor powder (added at 24 h of fermentation) (as an experimental group). After 48 h of fermentation, the cells were collected by centrifugation, and total RNA was extracted and reverse transcribed into cDNA. The experiment comprehensively selected 16 key metabolic genes as detection targets, including nodes in the basic sugar metabolism and glycogen synthesis pathway (GSY2, HXK2, GLG1), nodes in UDP-glucose precursor synthesis (PGM1, UGP1), genes related to stress resistance and ROS clearance (TPS1, HSP104, SOD1, CTT1), global amino acid regulators (GCN2, GCN4), and nodes in the shikimic acid pathway and rhodioloside aglycone synthesis (ARO1, ARO4, ARO7, ARO10, TYR1). RT-qPCR quantitative analysis was performed using ACT1 as an internal reference gene to calculate the relative expression level of each target gene in the CSLP system.

[0084] RT-qPCR quantitative analysis results (e.g.) Figure 4 As shown in the figure, compared with the control group that only added yeast extract, the transcriptional levels of several key metabolic genes in *Saccharomyces cerevisiae* Sc-08 were significantly remodeled after the addition of CSLP, precisely exposing the metabolic bottleneck of ordinary chassis strains in complex waste. Firstly, regarding basal carbon metabolism and environmental stress, the expression of the cellular glucose uptake gene HXK2 remained stable, proving that the basal metabolic backbone had not collapsed; however, in response to heavy metal and organic acid stress in CSLP, the expression levels of intracellular ROS scavenging and molecular chaperone genes SOD1, CTT1, and HSP104 were all significantly upregulated, and the expression level of the TPS1 gene, responsible for synthesizing the stress-resistant protectant trehalose, surged by 3.64 times. While this strong stress response protected the cells, it greatly intensified the competition for precursor substances.

[0085] Secondly, a severe "metabolic gap" was observed in the glycosyl donor synthesis flow. The upstream gene PGM1, which converts glucose-6-phosphate into a precursor, showed a significant 1.81-fold upregulation, and GLG1, which assists in glycogen synthesis initiation, also responded. However, the terminal gene GSY2, responsible for ultimately consuming UDP-glucose to synthesize glycogen, experienced an extreme 4.27-fold increase. Yet, the UGP1 gene, which plays a crucial role in rhodioloside synthesis, barely responded to the substrate changes. This highly asymmetrical transcriptional shift directly resulted in severe blockage of substrate carbon flow at UGP1, and the extremely limited intermediate products were almost entirely consumed by the overexpressed GSY2.

[0086] Furthermore, the data definitively confirmed the "physiological silencing" of the aglycone precursor synthesis pathway under complex waste nitrogen sources. Despite a 2.67-fold compensatory upregulation of the global amino acid regulator GCN4 in the face of the complex amino acid system of CSLP, this was far from sufficient to activate downstream pathways: not only were there no significant changes in the shikimic acid pathway backbone and branch node genes ARO1, ARO4, ARO7, and the tyrosine synthesis branch gene TYR1, but the rate-limiting enzyme ARO10, responsible for converting aromatic amino acids into tyrosol, a key aglycone of rhodioloside, was also completely unactivated spontaneously. This clearly demonstrates that simply relying on the supply of inexpensive substrates cannot spontaneously open up secondary metabolic pathways; a very strong global metabolic pull must be introduced.

[0087] Transcriptomic diagnostics in this embodiment thoroughly confirmed that unreconstructed common Saccharomyces cerevisiae exhibits three core metabolic defects when utilizing the CSLP matrix: heavy stress burden and excessive carbon consumption, collective silencing of precursor pathways, and ineffective carbon diversion to polysaccharides. Based on this conclusive molecular-level evidence, this invention establishes a customized combined reconstruction strategy of "open source, cost-saving, and global activation." Specifically, it is necessary to thoroughly repair the glycosyl precursor breakdown by strongly overexpressing exogenous UGP1, while strictly knocking out GSY2 to cut off the unproductive carbon diversion to glycogen. Given the cell's strong need for self-resistance, a moderate-strength promoter is used to finely regulate the expression of exogenous TPS1 to achieve a delicate balance between physiological resilience and high-yield transformation capacity. Most importantly, a strong promoter is used to introduce and overexpress the global amino acid regulator GCN4, forcibly activating the overall amino acid metabolic flow silenced by CSLP, thereby providing a powerful precursor driving force for downstream enzymes such as ARO10. Through this set of specific targeted modifications, a perfect metabolic fit between the engineered strain and the complex, low-cost matrix is ​​ultimately achieved.

[0088] Example 5: Amplification of Gene Elements and Preparation of Target Plasmids

[0089] (a) Obtaining the target gene

[0090] Based on the coding sequences of the global amino acid response regulator gene GCN4, the UDP-glucose pyrophosphorylase gene UGP1, and the trehalose synthase gene TPS1 from Saccharomyces cerevisiae provided on NCBI, PCR amplification was performed using the Saccharomyces cerevisiae genome as a template. The gene sequences are shown in SEQ ID No. 1-3.

[0091] According to SEQ ID No. 4 of the coding gene for glycogen synthase GSY2 from Saccharomyces cerevisiae provided on NCBI, the upstream and downstream 600 bp sequences of the gene are shown in SEQ ID No. 6 and SEQ ID No. 7; it also includes the introduction of a moderate expression intensity promoter GPM1p, the sequence of which is shown in SEQ ID No. 5.

[0092] (II) Construction of recombinant plasmids

[0093] 1. Recombinant plasmid pRS305-TEF1p-UGP1-CYC1t-TDH3p-GCN4-CYC1t was amplified by PCR using *Saccharomyces cerevisiae* genome as a template to obtain the gene sequences of TEF1p, UGP1, CYC1t, TDH3p, and GCN4. Linearized pRS305 was obtained by reverse PCR. The gene fragments were then ligated using the ClonExpress MultiS OneStep Cloning Kit from Nanjing Novizan Biotechnology Co., Ltd., with a vector-to-fragment ratio of 1:1. The resulting recombinant plasmid pRS305-TEF1p-UGP1-CYC1t-TDH3p-GCN4-CYC1t was obtained. Figure 9 As shown.

[0094] 2. Recombinant plasmid pRS306-GPM1p-TPS1-CYC1t-KanMX was amplified by PCR using the *Saccharomyces cerevisiae* genome as a template to obtain the GPM1p, TPS1, and CYC1t gene sequences. Linearized pRS306-KanMX was obtained by reverse PCR. The gene fragments were then ligated using the ClonExpress MultiS One Step Cloning Kit from Nanjing Novizan Biotechnology Co., Ltd., with a vector-to-fragment ratio of 1:1. The resulting recombinant plasmid pRS306-GPM1p-TPS1-CYC1t-KanMX was then obtained. Figure 10 As shown.

[0095] 3. Recombinant plasmid pUG6-ΔGSY2 was amplified by PCR using the *Saccharomyces cerevisiae* genome as a template, yielding 600 bp gene sequences each of GSY2-U and GSY2-D upstream and downstream of the GSY2 gene. Linearized pUG6 was obtained by reverse PCR. The gene fragments were then ligated using the ClonExpress MultiS One Step Cloning Kit from Nanjing Novizan Biotechnology Co., Ltd., with a vector-to-fragment ratio of 1:1. This resulted in the recombinant plasmid pUG6-ΔGSY2. Figure 11 As shown.

[0096] The circular recombinant vector was transformed into *E. coli* DH5α competent cells. Positive recombinant plasmids pRS305-TEF1p-UGP1-CYC1t-TDH3p-GCN4-CYC1t, pRS306-GPM1p-TPS1-CYC1t-KanMX, and pUG6-ΔGSY2 were obtained through ampicillin resistance plate screening and colony PCR and sequencing verification. Positive recombinant plasmid pRS306-GPM1p-TPS1-CYC1t-KanMX was also obtained through kanamycin sulfate resistance plate screening and colony PCR and sequencing verification.

[0097] All primer sequences are shown in Table 1.

[0098] Table 1. Primer sequences required for construction

[0099] TEF1p-F aagaaatatcttgaccgcagttccacacaccatagcttcaaaat TEF1-R cttagattagattgctatgctttctttc UGP1-F gaaagaaagcatagcaatctaatctaagttttaattacaaaatgtccactaagaagca UGP1-R tatcgacaaaggaaaaggggc CYC1t-FF gccccttttcctttgtcgatatcatgtaattagttatgtcacgct CYC1t-RR ttgaaatggcagtattgataatgagcaaattaaagccttcgagcg TDH3p-F gctcgaaggctttaatttgctcattatcaatactgccatttcaa TDH3p-R gaataaacacacataaacaaacaaaatgtccgaatatcagccaagttt GCN4-F gaataaacacacataaacaaacaaaatgtccgaatatcagccaagttt GCN4-R cgtgacataactaattacatgatcagcgttcgccaactaatt CYC1t-F tcatgtaattagttatgtcacgct CYC1t-R acctgagtattcccacagttgcaaattaaagccttcgagcg GPM1p-F gggcagacattacgaatgccacatgcagtgatgcacg GPM1p-R tattgtaatatgtgtgtttgtttgg TPS1-F ccaaacaaacacacatattacaataatgactacggataacgctaag TPS1-R tcagtttttggtggcagag CYC1T-F ctctgccaccaaaaactgaacaggccccttttcctt CYC1T-R gggtattctgggcctccatgtctgttacatgcgtacacgcg G418-F gacatggaggcccagaa G418-R acctgggcccaccacaccgtgtcagtatagcgaccagcat GSY2-U-F cctcgtccccgccgggtcacccggccagcgtggttagatccggtttagttg GSY2-U-R AGGGTATTCTGGGCCTCCATGTCatcctatgaggatataaacag hph-F ttaatactgtttatatcctcataggatGACATGGAGGCCCAGAATA hph-R ttttgactacctcagagaaaaattttgaCAGTATAGCGACCAGCATTC GSY2-D-F tcaaaatttttctctgaggtagtcaaa GSY2-D-R ggcgttagtatcgaatcgacagagcagcaaaccttaaatccatt pRS305-F aactgtgggaatactcaggt pRS305-R aactgcggtcaagatatttctt pRS306-F acacggtgtggtggg pRS306-R gcattcgtaatgtctgccc pUG6-F ctgtcgattcgatactaacgc pUG6-R gctggccgggtgac

[0100] The PCR enzyme used for amplification was Phanta Max Super-Fidelity DNA Polymerase from Nanjing Novizan Biotechnology Co., Ltd. The system is shown in Table 2, and the amplification program is shown in Table 3.

[0101] Table 4 shows the corresponding fragment lengths, primers, reaction temperatures, and times for different plasmid templates. (Table 4: Plasmid Template Fragment Length Upstream Primer Downstream Primer Temperature A Time B)

[0102] Table 2 PCR System Configuration Table

[0103] Phanta Max Super-Fidelity DNA Polymerase 1 µL buffer 25 µL Distilled water 20 µL dNTP 1 µL Forward primer 1 µL Reverse primer 1 µL Template 1 µL

[0104] Table 3 PCR amplification program

[0105]

[0106] Table 4

[0107] Example 6: Construction of a recombinant engineered Saccharomyces cerevisiae strain fortified with corn steep liquor powder

[0108] To address the competition between trehalose synthesis (which consumes UDP-glucose precursors) and rhodioloside synthesis induced by corn steep liquor drying stress, the following targeted gene modifications were performed:

[0109] 1. Construct the Sc-2 strain.

[0110] The plasmid pRS305-TEF1p-UGP1-CYC1t-TDH3p-GCN4-CYC1t containing the UGP1 and GCN4 gene expression cassettes was introduced into Saccharomyces cerevisiae Sc-08 and integrated into the LEU2 site. After screening with leucine-deficient medium, the recombinant strain Sc-2 was obtained.

[0111] The specific method is as follows:

[0112] ① Competent cells were prepared by culturing the initial Saccharomyces cerevisiae overnight in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose).

[0113] ② The linearized plasmid pRS305-TEF1p-UGP1-CYC1t-TDH3p-GCN4-CYC1t was introduced into competent Saccharomyces cerevisiae cells using the Zymogen Frozen EZYeast Transformation Kit II from Zymo Research Corporation for homologous recombination.

[0114] ③ Screening was performed using SD-Leu screening medium. Single colonies grew in 3-4 days. Positive clones that were correctly identified by PCR were named recombinant bacteria Sc-2. The SD-Leu screening medium contained: glucose 20 g / L, Tris ethanesulfonic acid 2.26 g / L, ammonium sulfate 3 g / L, trace elements 1 ml / L, 100× salt solution 10 ml / L, and agar powder 25 g / L.

[0115] 2. Construct the Sc-3 strain.

[0116] The plasmid pRS306-GPM1p-TPS1-CYC1t-KanMX, containing the GPM1p and TPS1 gene expression cassettes, was introduced into recombinant bacteria Sc-2 and integrated into the URA3 site. After screening with genimycin-selected plates, recombinant bacteria Sc-3 was obtained.

[0117] The specific method is as follows:

[0118] ① Competent cells were prepared by overnight culture of recombinant strain Sc-2 in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose).

[0119] ② The linearized plasmid pRS306-GPM1p-TPS1-CYC1t-KanMX was introduced into recombinant Sc-2 competent cells using the Zymogen Frozen EZYeast Transformation Kit II from Zymo Research Corporation for homologous recombination.

[0120] ③ Using genimycin agar plates for screening, single colonies grew in 3-4 days. Positive clones identified correctly by PCR were named recombinant bacteria Sc-3. The genimycin screening medium contained: glucose 20 g / L, peptone 20 g / L, yeast extract 5 g / L, and 1 / 1000 of G418 (100 g / L).

[0121] 3. Construct the Sc-66 strain.

[0122] The plasmid pUG6-ΔGSY2, containing the GSY2-U, GSY2-D, and php gene expression cassettes, was introduced into recombinant bacteria Sc-3. Homologous recombination was performed upstream and downstream of the GSY2 site. After screening with hygromycin selection plates, recombinant bacteria Sc-66 was obtained.

[0123] The specific method is as follows:

[0124] ① Competent cells were prepared by overnight culture of recombinant strain Sc-3 in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose).

[0125] ② The linearized plasmid pUG6-ΔGSY2 was introduced into recombinant bacterial Sc-3 competent cells using the Zymogen Frozen EZYeast Transformation Kit II from Zymo Research Corporation for homologous recombination.

[0126] ③ Hygromycin plates were used for screening. Single colonies grew in 3-4 days. Positive clones identified by PCR were named recombinant bacteria Sc-66. The hygromycin screening medium contained: glucose 20 g / L, peptone 20 g / L, yeast extract 5 g / L, and 1 / 1000 of hph (50 g / L).

[0127] Example 7 Application of recombinant bacteria in the production of rhodioloside

[0128] Rhodioloside was produced using the starting strain Sc-08, recombinant strains Sc-2, Sc-3, and Sc-66 from Example 5, respectively. After seed culture, the cultures were inoculated into the optimal fermentation system determined in Example 3, and the biomass and product concentration were measured after 120 h of fermentation.

[0129] The optimal fermentation system consisted of adding corn steep liquor powder at a 1:1 ratio to the fermentation medium for 24 hours. The fermentation medium formulation was: 20 g / L glucose, 17.5 g / L yeast extract, and 3.5 mM Ca. 2+ (CaCl2·2H2O), 1.5 mM Fe 2+ (FeSO4·7H2O).

[0130] The specific method is as follows: The bacterial strain was taken from the preservation tube and inoculated into a YPD test tube at a 1% (v / v) inoculum. The culture was then incubated at 30℃ for 24 hours to obtain the seed culture. The seed culture was then inoculated into 50 mL of fermentation medium at a 6% (v / v) inoculum. The medium was cultured at 30℃ with shaking at 180 rpm for 5 days, with 1 mL of 700 g / L glucose added every 12 hours. Fermentation continued for 120 hours. At 24 hours of fermentation, 17.5 g / L of corn steep liquor powder was added exogenously.

[0131] The results of the three parallel experiments are as follows Figure 5 The results showed that Sc-08 produced 8.4 g / L, Sc-2 increased to 9.0 g / L, GCN4 enhanced tolerance, and UGP1 expanded the supply of glycosylated precursors; Sc-3 increased to 10.02 g / L, and moderate expression of the TPS1 gene further enhanced resistance to CSLP impurities; the optimal strain Sc-66 achieved a significant increase in yield, reaching 12.61 g / L. Its GSY2 knockout further reduced the wasteful consumption of UDP-glucose, achieving a perfect metabolic balance between cellular stress-resistant growth and efficient product synthesis.

[0132] Example 8: High-density fermentation production of rhodioloside by recombinant strain Sc-66

[0133] To verify the high efficiency of the customized recombinant strain Sc-66 of this invention in converting corn steep liquor (CSLP) to industrial-scale system, and its absolute advantage over the initial strain and traditional high-cost fermentation processes, three parallel fed-batch fermentation experiments were conducted in a 5 L automated fermenter. The experiment consisted of three groups: the experimental group used the optimal recombinant strain Sc-66 of this invention, supplemented with inexpensive CSLP solution in the later stages of fermentation; control group 1 used the initial unmodified strain Sc-08, and performed the same CSLP feeding process as the experimental group; control group 2 also used the optimal recombinant strain Sc-66, but its feed was replaced with an expensive yeast extract (YE) solution with the same nitrogen content.

[0134] ① Seed culture:

[0135] a. Primary seed culture: Take 1% (v / v) of the recombinant strain Sc-66 bacterial culture from the cryopreservation tube and inoculate it into YPD test tubes. Incubate at 30°C and 180 rpm for 24 h to obtain the primary seed culture. The YPD medium contains 2% peptone, 1% yeast extract and 2% glucose.

[0136] b. Secondary seed culture: Take the primary seed culture and inoculate it into a new seed culture medium at an inoculation rate of 6% (v / v). Culture it at a constant temperature under the same conditions as a to obtain the seed culture for fermentation culture.

[0137] ② Batch feeding fermentation

[0138] The secondary seed culture was inoculated at a rate of 6% (v / v) into a 5 L fermenter containing 2 L of initial fermentation medium. The fermentation medium consisted of 20 g / L glucose, 17.5 g / L yeast extract, 3.5 mM Ca²⁺, and 1.5 mM Fe²⁺.

[0139] The fermentation temperature was maintained at 30℃, and the stirring speed was controlled between 300 and 500 rpm to maintain the relative dissolved oxygen (DO) at 30%~40%. The pH was kept constant at 5.8 by automatically adding 4M NaOH solution.

[0140] The initial glucose concentration in the fermenter was 20 g / L. When the glucose was about to be depleted, glucose was added to maintain the glucose concentration in the fermenter below 4 g / L.

[0141] After 24 hours of fermentation, nitrogen source was replenished using a fed-batch method. The experimental group and control group 1 were supplemented with 12.5 mL of 400 g / L CSLP concentrate every 12 hours; control group 2 was supplemented with yeast extract concentrate of the same nitrogen content every 12 hours. This was repeated 7 times, for a total of 87.5 mL. The total amount of corn steep liquor powder or yeast extract supplemented accounted for half of the total nitrogen source. The total fermentation period was 120 hours, during which samples were taken every 12 hours to measure cell biomass (OD). 600 ), tyrosol and rhodioloside production.

[0142] The fermentation experiments revealed drastically different production efficiencies. For example... Figure 6 As shown, the experimental group using Sc-66 and CSLP fed aliquots exhibited extremely strong robustness, not only completely overcoming the toxic inhibition caused by the accumulation of high concentrations of CSLP, but also achieving perfect coupling between cell growth and product synthesis. At the 120-h fermentation endpoint, the cell biomass OD... 600The rhodioloside yield reached an astonishing 36.71 g / L, reaching a high of 135.2. In contrast, the control group 1, fed with Sc-08 and CSLP, demonstrated the absolute necessity of genetic modification. Figure 7 Under the same CSLP supplementation system, the unmodified initial strain Sc-08 showed acceptable growth in the early fermentation stage (0–48 h), but its metabolism was severely inhibited as lactic acid, impurities, and heavy metals accumulated in the CSLP feed solution. After 72 hours of fermentation, Sc-08 cells exhibited significant premature death and autolysis, and the OD value at 120 h of fermentation was finally lowered. 600 The yield of rhodioloside stagnated at 19.5 g / L, reaching only 88.9%. This comparative data strongly demonstrates that ordinary chassis strains without deep targeted remodeling are simply unable to withstand the physicochemical stress of high concentrations of complex industrial waste. The gene modification strategy of this invention is a non-obvious but absolutely necessary prerequisite for realizing the resource utilization of CSLP.

[0143] On the other hand, control group 2, fed with Sc-66 and yeast extract, demonstrated the specific synergistic effect between the modified bacteria and CSLP. Figure 8 When high-purity, high-cost yeast extract was provided as a supplemental nitrogen source for recombinant strain Sc-66, the final cell biomass at 120 h of fermentation was slightly higher, reaching 142.1 g / L, but the final yield of rhodioloside was only 29.85 g / L, lower than that of the CSLP fed group. This "abnormal" and unexpected technical effect further confirms the core mechanism of the present invention, namely, that the maximization of the catalytic activity of the key enzyme overexpressed in the present invention is highly dependent on the specific concentration of trace metal ion cofactors naturally present in CSLP. Although pure yeast extract promotes the beneficial proliferation of cells, it lacks these key growth-promoting cofactors, resulting in the carbon metabolic flux not being as efficiently directed towards the target product as in the CSLP system.

[0144] SEQ ID No. 1: ATGTCCGAATATCAGCCAAGTTTATTTGCTTTAAATCCAATGGGTTTCTCACCATTGGATGGTTCTAAATCAACCAACGAAAATGTATCTGCTTCCACTTCTACTGCCAAACCAATGGTTGGCCAATTGATTTTTGATAAATTCATCAAGACTGAAGAGGATCCAATTATCAAACAGGATACCCCTTCGAACCTTGATTTTGATTTTGCTC TTCCACAAACGGCAACTGCACCTGATGCCAAGACCGTTTTGCCAATTCCGGAGCTAGATGACGCTGTAGTGGAATCTTTCTTTTCGTCAAGCACTGATTCAACTCCAATGTTTGAGTATGAAAACCTAGAAGACAACTCTAAAGAATGGACATCCTTGTTTGACAATGACATTCCAGTTACCACTGACGATGTTTCATTGGCTGATAAGGCA ATTGAATCCACTGAAGAAGTTTCTCTGGTACCATCCAATCTGGAAGTCTCGACAACTTCATTCTTACCCACTCCTGTTCTAGAAGATGCTAAACTGACTCAAACAAGAAAGGTTAAGAAACCAAATTCAGTCGTTAAGAAGTCACATCATGTTGGAAAGGATGACGAATCGAGACTGGATCATCTAGGTGTTGTTGCTTACAACCGCAAACAGCGTTCGATTCCACTTTCTCCAATTGTGCCCGAATCCAGTGATCCTGCTGCTCTAAAACGTGCTAGAAACACTGAAGCCGCCAGGCGTTCTCGTGCGAGAAAGTTGCAAAGAATGAAACAACTTGAAGACAAGGTTGAAGAATTGCTTTCGAAAAATTATCACTTGGAAAATGAGGTTGCCAGATTAAAGAAATTAGTTGGCGAACGCTGA SEQ ID No.2: SEQ ID No.3: SEQ ID No.4: SEQ ID No.5: SEQ ID No.6: GTGGTTAGATCCGGTTTAGTTGATGCTTCTGGTGTTGCCTCACTATTAGCTACTACCGAAGTTGCTATTGTTGATGCCCCAGAACCACCAGCAGCTGCTGGCGCTGGTGGTATGCCAGGTGGTATGCCAGGAATGCCAGGTATGATGTAACGACCGCCTTAATTCAAAATTTATCTTTCGTTTAAATATGGTAATAATTTTATTATCTTGTAAATACAATGTGAAAAAAGTTGAGATTTTTAGGAATCACTTTTTCAAGTATAAAGAACTATATATGACTATGAGCTATTATATCTTTAA GTATGACTATATGTTGATAACTGAACAAAGATAGAGAGAGCTACCGCCATAATGTCACTTTTCATTAATGAAATTGACTTATTTTGTTTACAGCTAACGCAAGAGGACTTCGCTAGAAGGAAGAGAAAAAAAGAAAAGAAAATGTTTGGATCGCTCAAAACTCCTAGTATATTTTCAGAGGGCATTCCACATATATTTCAGTTTGTGCCAACGAAAGTTAAAAGAAAAGCAAAAACGCCTCGAAATGTCGTATGTCTTTATGGTAAGATTTTTTTAATACTGTTTATATCCTCATAGGAT SEQ ID No.7: TCAAAATTTTTCTCTGAGGTAGTCAAAACTTCAATCACAGTTATCAAAAAAACTACCACTTCTCAGTGATGCTTTAGAGATAGCTAACATATTTAAGGAAAGGCAAGGAACCTTAAATTGATTATGCTGTAGAAGCACTATATATACTCATATATTTTTATATATGTACGAGGAGCTTGCATAAGAAAGAAAGGGGTGAATTGCGTTCCTGGAGAAAAACTACGCTTTCGGGGAAAGCTGCTCCCTTTGCTGGCCTAATTCCATGTCCAAAAGGGTTAAACATTGTATGCCCAGGCTGAACTCAGTCACATATATCATCACCAATTACCATTTTCAGGGAGTCTGGTCGCGGGGTCGCGGGGTCGCTAATCCAGGGGCAGTCCAGTGTCAGAATTGGTAAGCTGCAAGAACCCCATAAGGCCTGTCCTGCCTGGCATGATAGTACTAAGTCAGCATCGTGCCGGAAAATCGAAAATGAGCCATGCTCGAGGCCCCATGTGCAGATATCCCTATTCCTCTTGTAGTATCTATTTTTGTCTCTAAAACGATATCCGGGTCCTCAGGAACGAATGATAGAAAATGGATTTAAGGTTTGCTGCT

Claims

1. An engineered Saccharomyces cerevisiae based on corn steep liquor dry powder fortification, characterized by, The engineered Saccharomyces cerevisiae was obtained by overexpressing the GCN4, UGP1, and TPS1 genes and knocking out the GSY2 gene using Saccharomyces cerevisiae capable of synthesizing rhodioloside as the chassis. The coding gene for GCN4 is shown in SEQ ID No. 1, the coding gene for UGP1 is shown in SEQ ID No. 2, the coding gene for TPS1 is shown in SEQ ID No. 3, the coding gene for GSY2 is shown in SEQ ID No. 4, the upstream homologous arm sequence of the GSY2 gene is shown in SEQ ID No. 6, and the downstream homologous arm sequence is shown in SEQ ID No.

7.

2. The engineered Saccharomyces cerevisiae based on corn syrup dry powder fortification according to claim 1, characterized by, The GCN4 gene is expressed by the strong promoter TDH3p, the UGP1 gene is expressed by the strong promoter TEF1p, and the TPS1 gene is regulated by the moderately strong promoter GPM1p; the GPM1p promoter sequence is shown in SEQ ID No.

5.

3. The method for constructing a corn syrup powder fortified engineered Saccharomyces cerevisiae according to claim 1, characterized in that, The plasmids pRS305-TEF1p-UGP1-CYC1t-TDH3p-GCN4-CYC1t and pRS306-GPM1p-TPS1-CYC1t-KanMX were sequentially introduced, and the GSY2 gene was knocked out using pUG6-ΔGSY2.

4. The method for constructing a corn syrup powder fortified engineered Saccharomyces cerevisiae according to claim 3, characterized in that, The GCN4 and UGP1 expression cassettes are integrated into the LEU2 site, and the TPS1 expression cassette is integrated into the URA3 site.

5. The use of the engineered brewing yeast as described in claim 1 or 2 in the production of rhodioloside.

6. A method for producing rhodioloside using the engineered brewer's yeast of claim 1 or 2, characterized in that, Includes the following steps: (1) Inoculate engineered brewing yeast into fermentation medium and culture it; (2) Add corn steep liquor powder to the culture medium during fermentation; (3) After fermentation, the fermentation broth was collected and the rhodioloside yield was determined.

7. The method for producing salidroside by engineering Saccharomyces cerevisiae according to claim 6, characterized in that, The mass ratio of corn steep liquor powder to yeast extract in the culture medium is (1~4):(1~4).

8. The method for producing salidroside by engineering Saccharomyces cerevisiae according to claim 6, characterized in that, The corn steep liquor powder was added during fermentation 0-48 h.

9. The method for producing salidroside by engineering Saccharomyces cerevisiae according to claim 6, characterized in that, Fermentation temperature: 28-30℃, initial glucose concentration: 10-40 g / L.

10. The method for producing salidroside by engineering Saccharomyces cerevisiae according to claim 6, characterized in that, The fermentation medium formula is: glucose 10~40 g / L, yeast extract 7~35 g / L, corn steep liquor powder 7~28 g / L, Ca 2+ 1.0~4.0 mM, Fe 2+ 0.5~3.0 mM.

Citation Information

Patent Citations

  • Saccharomyces cerevisiae with high yield of salidroside as well as construction method and application of saccharomyces cerevisiae

    CN121343793A