A type of Rhodococcus and its uses

CN122542453APending Publication Date: 2026-08-11BEIJING EVOLYZER CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611039423.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-14
Publication Date
2026-08-11

AI Technical Summary

Technical Problem

然而,功能菌株的性能短板已成为制约该技术从实验室走向田间规模化应用的核心瓶颈,普遍存在降解效能有限、底物特异性过强、除草剂适用谱较窄、田间稳定性及环境适应性欠佳等技术缺陷,无法支撑推广应用

Benefits of technology

本申请所述的菌株具有良好的降解除草剂的效果,在土壤中残留除草剂的条件下不仅能缓解因除草剂导致的生长抑制,防止除草剂残留对后茬植物的药害,还能进一步缓解除草剂所造成的药害,从而恢复或者促进植物的生长。而且所述赤红球菌采自自然环境,安全环保无污染,具有广泛的应用前景。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122542453A_ABST
    Figure CN122542453A_ABST
Patent Text Reader

Abstract

This application provides a Rhodococcus bacterium. Rhodococcus red This invention relates to the field of bio-agricultural technology, specifically the strain described herein, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36743. This strain exhibits excellent herbicide degradation effects. Even under conditions where herbicide residues remain in the soil, it can not only alleviate growth inhibition caused by herbicides and prevent herbicide residue damage to subsequent crops, but also further mitigate herbicide-induced damage, thereby restoring or promoting plant growth. Furthermore, the Rhodococcus rubrum strain is collected from the natural environment, making it safe, environmentally friendly, and pollution-free, with broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of bio-agricultural technology, specifically to a type of Rhodococcus and its uses. Background Technology

[0002] Herbicides are an indispensable plant protection tool in modern agricultural production, playing a crucial role in ensuring crop yield and quality. However, residues caused by unscientific application have become a significant threat to arable land safety. Surveys show that herbicide residues are widespread in arable land soils in northern my country, with over 90% of soil samples testing positive for at least one herbicide, among which atrazine (a triazine herbicide) accounted for as high as 54.6%. The widespread, routine, and even overlapping use of triazine, phenoxycarboxylic acid, and organophosphate herbicides on major crops in my country has led to their frequent detection in farmland soils, resulting in increasingly prominent ecological risks and health hazards caused by residues. Herbicide residues in the soil can directly affect crop growth and cause significant yield reductions through mechanisms such as inhibiting seed germination, damaging root development, and interfering with physiological metabolism; simultaneously, their bioaccumulation through the food chain can easily lead to excessive pesticide residues in agricultural products.

[0003] Currently, technologies for reducing herbicide residues mainly fall into the following categories: physical methods such as leaching and adsorption, and chemical methods such as oxidation, can achieve efficient degradation of herbicides, but these methods suffer from high costs, complex operations, and secondary pollution. Agricultural practices such as crop rotation, deep plowing, and rational irrigation, while simple to implement and cost-free, lack flexibility and are only moderately effective against long-residual herbicides. In contrast, microbial-mediated biodegradation, with its core advantages of being environmentally friendly, capable of in-situ remediation, and scalable, has become the most promising pathway for reducing soil herbicide residues and a research hotspot in agriculture in recent years.

[0004] The large-scale application of biodegradation methods heavily relies on strains with highly efficient degradation capabilities. The degradation efficiency, substrate applicability, and field adaptability of these strains directly determine the stability of herbicide residue remediation. However, the limitations of functional strains have become a core bottleneck restricting the technology's transition from laboratory to large-scale field application. Common technical defects include limited degradation efficiency, excessively high substrate specificity, narrow herbicide applicability, and poor field stability and environmental adaptability, hindering widespread application. For example, some strains only exhibit excellent degradation effects against phenoxycarboxylic acid herbicides, while their degradation activity against other types of herbicides remains unclear; other strains only degrade herbicides applied to specific crops, limiting their applicability; and some strains are susceptible to factors such as temperature, pH, and competition from indigenous microorganisms in complex field environments, making it difficult to maintain stable degradation activity.

[0005] Therefore, screening out biocontrol strains with excellent degradation performance, wide applicability to herbicides, and high stability in field planting is of great significance for promoting the industrialization and large-scale application of microbial herbicide degradation technology. Summary of the Invention

[0006] To address the technical problems existing in the prior art, this application provides a strain that efficiently degrades herbicides and its application. The strain exhibits excellent degradation performance against a variety of herbicides and can alleviate crop growth inhibition caused by herbicides, thus having significant agricultural application value.

[0007] The specific technical solution of this application is as follows: This application provides a Rhodococcus bacterium. Rhodococcus ruber It is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 36743.

[0008] This application provides a microbial agent comprising the aforementioned Rhodococcus, its fermentation products, or metabolites.

[0009] Preferably, the above-described microbial agent is a solid microbial agent or a liquid microbial agent.

[0010] Preferably, for the above-described microbial agent, when the microbial agent is a liquid microbial agent, the concentration of Rhodococcus is 2.0 × 10⁻⁶. 7 -2.0×10 10 cfu / mL.

[0011] Preferably, for any of the above-mentioned microbial agents, the microbial agent further comprises agriculturally acceptable adjuvants.

[0012] This application provides the use of the aforementioned Rhodococcus faecalis or any of the aforementioned microbial agents in the degradation of herbicide residues in soil; Preferably, the herbicide is selected from one of sulfonylurea herbicides, organophosphate herbicides, triazine herbicides, phenoxycarboxylic acid herbicides, and imidazolinone herbicides.

[0013] Preferably, for the purposes described above, the Rhodococcus rubrum or the fungal agent alleviates the phytotoxicity caused by herbicides to plants.

[0014] This application provides a method for degrading herbicide residues in soil, comprising applying the aforementioned Rhodococcus rubrum or any of the aforementioned microbial agents to plants; Preferably, the plant is a crop, and more preferably selected from one or more of the following: corn, cucumber, wheat, rice, soybean, zucchini, melon, and tomato.

[0015] Preferably, in the method described above, the Rhodococcus rubrum or the inoculant is applied to the planting area of ​​the plant before the plant is sown.

[0016] Preferably, in the method described above, the Rhodococcus rubrum or the inoculant is applied to the roots of the plant after the plant has sprouted.

[0017] Beneficial effects The strain described in this application has a good effect on degrading herbicides. Under conditions where herbicides remain in the soil, it can not only alleviate the growth inhibition caused by herbicides and prevent herbicide residues from damaging subsequent plants, but also further alleviate the damage caused by herbicides, thereby restoring or promoting plant growth. Moreover, the Rhodococcus rubrum strain is collected from the natural environment, is safe, environmentally friendly, and pollution-free, and has broad application prospects. Attached Figure Description

[0018] Figure 1 This is a diagram of the colony morphology of Rhodococcus.

[0019] Figure 2 This is a schematic diagram comparing the growth of maize seedlings (4-leaf, 1-heart stage) after 7 days of culture using the aforementioned Rhodococcus (treatment group D3) and water treatment (treatment group D2) under 2,4-D sodium stress conditions.

[0020] Figure 3 This is a schematic diagram comparing the growth of maize seedlings (early jointing stage) after 14 days of culture using the aforementioned Rhodococcus (treatment group D3) and water treatment (treatment group D2) under 2,4-D sodium stress conditions.

[0021] Figure 4 This is a schematic diagram comparing the growth of cucumber seedlings treated with the aforementioned Rhodococcus (treatment group E3) and treated with water (treatment group E2) under atrazine stress conditions.

[0022] Strain Preservation Information The strain *Rhodococcus* described in this application Rhodococcus ruber It was deposited on November 24, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 36743. Detailed Implementation

[0023] The present application will now be described in detail with reference to the described embodiments. Although specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this application will be thorough and complete, and will fully convey the scope of the present application to those skilled in the art.

[0024] It should be noted that certain terms are used in the specification and claims to refer to specific components. Those skilled in the art will understand that different terms may be used to refer to the same component. This specification and claims do not distinguish components based on differences in terminology, but rather on differences in function. The terms "comprising" or "including" used throughout the specification and claims are open-ended and should be interpreted as "comprising but not limited to." The following descriptions in the specification are preferred embodiments for carrying out this application; however, these descriptions are for the purpose of understanding the general principles of the specification and are not intended to limit the scope of this application. The scope of protection of this application shall be determined by the appended claims.

[0025] This application provides a Rhodococcus bacterium. Rhodococcus ruber The Rhodococcus rubrum is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36743.

[0026] The strain was isolated from seabed silt in the South China Sea and has a strong degradation effect on sulfonylurea herbicides, organophosphate herbicides, triazine herbicides, phenoxycarboxylic acid herbicides, and imidazolinone herbicides, meaning that the strain has a broader degradation spectrum.

[0027] In some embodiments, the 16S rRNA sequence of this strain is shown in SEQ ID NO:3: The Rhodococcus faecalis was deposited on November 24, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 36743.

[0028] This application provides a microbial agent comprising the aforementioned Rhodococcus, its fermentation products, or metabolites.

[0029] In this application, no restrictions are placed on the fermentation products or metabolites of Rhodococcus. Those skilled in the art can use conventional methods in the art to prepare the fermentation products or metabolites of Rhodococcus, as long as they meet the requirements of this application.

[0030] In this application, no restrictions are placed on the dosage form of the bacterial agent. The dosage form of the bacterial agent can be prepared according to actual needs, for example, the bacterial agent can be a solid bacterial agent or a liquid bacterial agent.

[0031] In some embodiments, when the bacterial agent is a liquid bacterial agent, the concentration of the Rhodococcus is 2.0 × 10⁻⁶. 7 -2.0×10 10 cfu / mL.

[0032] For example, when the biological agent is a liquid agent, the concentration of the Rhodococcus can be 2.0 × 10⁻⁶. 7 cfu / mL, 3.0×10 7 cfu / mL, 4.0×10 7 cfu / mL, 5.0×10 7 cfu / mL, 6.0×10 7 cfu / mL, 7.0×10 7 cfu / mL, 8.0×10 7 cfu / mL, 9.0×10 7 cfu / mL, 1.0×10 8 cfu / mL, 2.0×10 8 cfu / mL, 3.0×10 8 cfu / mL, 4.0×10 8 cfu / mL, 5.0×10 8 cfu / mL, 6.0×10 8 cfu / mL, 7.0×10 8 cfu / mL, 8.0×10 8 cfu / mL, 9.0×10 8 cfu / mL, 1.0×10 9 cfu / mL, 2.0×109 cfu / mL, 3.0×10 9 cfu / mL, 4.0×10 9 cfu / mL, 5.0×10 9 cfu / mL, 6.0×10 9 cfu / mL, 7.0×10 9 cfu / mL, 8.0×10 9 cfu / mL, 9.0×10 9 cfu / mL, 1.0×10 10 cfu / mL, 2.0×10 10 etc. or any range thereof.

[0033] In some embodiments, the microbial agent also includes agriculturally acceptable adjuvants.

[0034] In this application, no restrictions are placed on agriculturally acceptable excipients. Those skilled in the art can make conventional selections based on actual needs, such as selecting conventional excipients for the preparation of specific dosage forms.

[0035] In this application, no restrictions are placed on the content of agriculturally acceptable adjuvants in the microbial agent. Those skilled in the art can choose the amount of agriculturally acceptable adjuvants to be added as needed, as long as it meets the requirements of this application.

[0036] This application provides the use of the aforementioned Rhodococcus faecalis or the aforementioned microbial agents in the degradation of herbicide residues in soil.

[0037] As described above, the Rhodococcus has the ability to degrade herbicides, and therefore can be used to degrade herbicides remaining in the soil.

[0038] In some embodiments, the herbicide is selected from one of sulfonylurea herbicides, organophosphate herbicides, triazine herbicides, phenoxycarboxylic acid herbicides, and imidazolinone herbicides.

[0039] In this application, the sulfonylurea herbicide can be, for example, chlorsulfuron (green sulfuron), metsulfuron, amphetamine sulfuron, bensulfuron (Juxing), bensulfuron (Nongdeshi), nicosulfuron (Yunongle), pyrimisulfuron (Cao Kexing), etc., with metsulfuron being preferred.

[0040] The organophosphorus herbicide may be, for example, glyphosate.

[0041] The triazine herbicide may be, for example, simazine, atrazine, chlorpyrifos, chlorpyrifos, chlorpyrifos, chlorpyrifos, chlorpyrifos, chlorpyrifos, chlorpyrifos, chlorpyrifos, chlorpyrifos, with atrazine being preferred.

[0042] The phenoxycarboxylic acid herbicide can be, for example, 2,4-D, sodium 2,4-D, 2,4-D chloramine, etc., preferably sodium 2,4-D.

[0043] The imidazolinone herbicide may be, for example, imidazoline, methoxyfenozide, metribuzin, metribuzin, methyl imidazoline, etc., preferably imidazoline.

[0044] In some embodiments, the Rhodococcus rubrum or the fungal agent can alleviate the phytotoxicity of herbicides on plants, for example, by alleviating the inhibition of seed germination, restoring seedling growth, or promoting plant growth.

[0045] This application provides a method for degrading herbicide residues in soil, comprising applying the aforementioned Rhodococcus rubrum or any of the aforementioned microbial agents to plants. In some embodiments, the plant is a crop, preferably selected from one or more of corn, cucumber, wheat, rice, soybean, zucchini, melon, and tomato. In some embodiments, the Rhodococcus rubrum or the microbial agent is applied to the planting area of ​​the plant before sowing. In some embodiments, the Rhodococcus rubrum or the microbial agent is applied to the roots of the plant after germination.

[0046] Example This application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., weight percentage. Reagents or instruments used, unless otherwise specified, are all commercially available conventional reagent products.

[0047] The culture medium used in the examples is as follows: LB medium (Luria-Bertani Medium, LB): peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, ultrapure water as solvent, pH=7.0. Solid LB medium is prepared with 1.8% agar powder. Sterilize at 121℃ for 20 min.

[0048] LBG medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, glucose 5 g / L, solvent: ultrapure water, pH=7.0. Sterilize at 121℃ for 20 min.

[0049] Mineral Salt Medium (MSM): NH4Cl 0.2 g / L, K2HPO4 1.5 g / L, KH2PO4 0.5 g / L, MgSO4·7H2O 0.2 g / L, CaCl2 0.1 g / L, solvent: ultrapure water, pH=7.0. Solid MSM medium is prepared with 1.8% agar powder. Sterilize at 121℃ for 20 min.

[0050] Rhodococcus seed culture medium: glucose 10 g / L, yeast extract 0.5 g / L, peptone 5 g / L, K₂HPO₄ 0.5 g / L, KH₂PO₄ 0.5 g / L, MgSO₄·7H₂O 0.5 g / L, monosodium glutamate 1 g / L, solvent: ultrapure water, pH=7.5. Sterilize at 115℃ for 25 min.

[0051] Rhodococcus faecalis fermentation broth culture medium: glucose 40 g / L, urea 5 g / L, yeast extract 5 g / L, KH2PO4 0.5 g / L, K2HPO4 1 g / L, MgSO4·7H2O 0.5 g / L, monosodium glutamate 1 g / L, solvent: ultrapure water, pH=7.5. Sterilize at 115℃ for 25 min.

[0052] Example 1: Isolation, Screening and Identification of Strains (1) Strains Isolation The Rhodococcus faecalis strain was isolated from seabed silt in the South China Sea. The isolation and purification method was as follows: 1 g of silt sample was taken and 30 mL of PBS phosphate buffer was added, along with LBG medium. The mixture was incubated at 28℃ and 200 rpm for 60 min. After incubation, the sample was allowed to settle naturally. 100 μL of the supernatant was collected and spread onto LB agar plates, which were then incubated at 28℃. Once the colonies on the plates had grown to 2 / 3 of the medium volume, single colonies of different morphologies were picked for isolation and purification until the colonies on each plate exhibited a uniform morphology and color, thus representing a single strain. All purified strains (35 strains in total) were then stored on slant agar.

[0053] (2) Strain screening Preparation of screening plates: Five tested herbicides (methoprim-sulfonylureas, glyphosate-organophosphates, atrazine-triazines, MCPA-phenoxycarboxylic acids, and imidazolinone-imidazolinones) were dissolved in methanol to prepare 1 g / L herbicide stock solutions. These stock solutions were sterilized by filtration through a 0.22 μm organic filter membrane and stored at 4°C in the dark. The sterilized MSM solid medium (without herbicides) was cooled to approximately 50°C. In a clean bench, the stock solutions of the five herbicides were added to each herbicide, up to a final concentration of 50 mg / L. After rapid mixing, approximately 15 mL was poured into sterile petri dishes and allowed to cool and solidify. This successfully prepared MSM screening plates containing the five herbicides. Blank control plates (MSM solid medium without herbicides) were also prepared.

[0054] Preparation of bacterial suspension: The 35 strains isolated and purified in (1) were inoculated into LB medium and cultured until the final OD=2.

[0055] The inoculation method was used, with 5 μL of the above bacterial suspension spotted onto plates containing five different herbicides (triple replicates). The plates were incubated at 28°C and observed periodically. The diameter of the clear zone (H) and the colony diameter (C) were measured using the cross-crossing method, and the HC ratio (H / C) was calculated. A higher HC ratio indicates a stronger herbicide degradation ability of the strain. The results are shown in Table 1. The results showed that most tested strains did not have the ability to degrade herbicides; seven strains could degrade some herbicides, while only one strain could simultaneously degrade all five herbicides.

[0056] Table 1. Initial screening results of herbicide-degrading strains

[0057] Note: "-" indicates that no transparent ring is formed.

[0058] (3) Strain identification Colony morphology characteristics of the strain, such as Figure 1 As shown, the colonies are relatively small, round with regular edges, orange-red in color, and have a smooth, moist, and opaque surface.

[0059] Using the purified total DNA of the strain as a template, polymerase chain reaction (PCR) was performed using universal primers 27F (5'-3') AGAGTTTGATCCTGGCTCAG (SEQ ID NO:1) and 1492R (5'-3'): TACGGCTACCTTGTTACGACTT (SEQ ID NO:2) to amplify the 16S rRNA sequence of the strain. The reaction system and conditions are shown in Table 2 and Table 3, respectively.

[0060] Table 2 PCR amplification system

[0061] Table 3 PCR reaction conditions

[0062] The PCR amplification products were detected by 1% agarose gel electrophoresis. After confirming that the band size met expectations, the PCR products were purified and then sequenced. The sequencing results are shown in SEQ ID NO:3. Homology comparison was performed in the NCBI database (National Center for Biotechnology Information, ncbi.nlm.nih.gov), and the screened strain was identified as Rhodococcus rubescens. Rhodococcus ruber .

[0063] The Rhodococcus Rhodococcus ruber The sequence of the 16S rRNA is shown in SEQ ID NO:3: This strain was deposited on November 24, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 36743.

[0064] Example 2 Preparation of fermentation broth The preparation was carried out using conventional methods in the art. Specifically, the plate containing Rhodococcus rubrum from Example 1, which had been activated by conventional methods in the art, was inoculated with an inoculation loop into Rhodococcus rubrum seed culture medium and cultured with shaking at 28°C and 200 rpm for 60 h. Then, it was transferred to Rhodococcus rubrum fermentation broth culture medium and cultured for fermentation at 28°C and 200 rpm for 48 h. After fermentation, the fermentation broth was collected and concentrated or diluted according to experimental requirements.

[0065] Experimental Example 1: Simulated Degradation Experiment of Fermentation Broth on Soil Residues of Multiple Herbicides The experiment used an artificial climate chamber with constant temperature soil simulation culture system.

[0066] Herbicide stress: 10 kg of substrate soil was divided into 5 groups. Each group was uniformly sprayed with 0.4 L of herbicide solution (metsulfuron-methyl, glyphosate, atrazine, MCPA, and imidacloprid, all at a concentration of 0.5 g / L), stirring thoroughly while spraying until homogeneous. This process ensured that the final herbicide residue in the substrate soil of each treatment group simulated the residue level after conventional field application (100 μg / kg soil). Simultaneously, a control group was prepared by treating the substrate soil with an equal volume of water instead of the herbicide solution. All treatment groups, including the control group, had 3 replicates (pots).

[0067] Fermentation broth irrigation treatment: The herbicide-containing substrate soil prepared above was divided into seedling pots (top diameter 18.5cm, bottom diameter 13cm, height 15cm, 600g per pot), and the divided seedling pots were divided into two large groups. Damaged group: No treatment was given, only an equal amount of water was applied. Repair group: The Rhodococcus faecalis fermentation broth prepared in Example 2 was applied (concentration 2×10⁻⁶). 7 CFU / mL) 10 mL / pot. All treatment groups, including the blank control group, had 3 replicates (pots) per group. The group design is shown in Table 4.

[0068] Table 4. Grouping information for simulated degradation experiments of soil residues from various herbicides by fermentation broth

[0069] Quantitative detection: Samples were taken on days 7 and 15 of cultivation, and the residues of five herbicides in the soil were detected by high performance liquid chromatography. The natural degradation rate and the herbicide-assisted degradation rate under different treatments were calculated, and the degradation and remediation effects of the herbicides were compared and analyzed. The degradation rate was calculated using the formula: Degradation rate = (Initial herbicide content - Residual amount at sampling time) / Initial herbicide content × 100%. The results are shown in Table 5.

[0070] Table 5. Results of simulated degradation experiments of soil residues from various herbicides by fermentation broth.

[0071] As shown in the table above, no herbicide residues were detected in the soil of the blank control group during the cultivation period, indicating no external pollution interference. The degradation rates of each herbicide in the natural degradation groups, especially atrazine, metsulfuron-methyl, and imidazoline, were slow, and the degradation rates were all at a low level, consistent with the long-term soil residue characteristics of this type of herbicide.

[0072] Compared to the naturally degraded group, the treatment groups 6-10 with added Rhodococcus faecalis fermentation broth showed a significant accelerated degradation effect on five different types of herbicides: this strain can effectively promote the decomposition and metabolism of metsulfuron-methyl, glyphosate, atrazine, MCPA, and imidazoline in the soil, significantly improve the soil degradation rate of various herbicides, and greatly reduce the residual amount of herbicides in the soil.

[0073] The results show that the Rhodococcus erythrococcus described in this application is not limited by the chemical structure and mechanism of action of herbicides, and has good broad-spectrum degradation ability for five major classes of mainstream herbicides, including sulfonylureas, organophosphates, triazines, phenoxycarboxylic acids, and imidazolinones, which can accelerate the remediation process of soils contaminated by various types of herbicides.

[0074] Experiment Example 2: Effects of Fermentation Broth Irrigation Treatment on Maize Seed Germination in Herbicide Residue Soil Herbicide stress was treated as in Experiment 1: 18 kg of substrate soil was taken and divided into 3 groups. Each group was sprayed with 1.2 L of herbicide solution (glyphosate, atrazine, and MCPA sodium, all at a concentration of 0.5 g / L), stirring thoroughly while spraying until homogeneous. Simultaneously, a control group was prepared by treating the substrate soil with an equal volume of water instead of the herbicide solution.

[0075] The fermentation broth was applied to the planting soil before sowing, similar to the treatment in Example 1. All treatment groups, including the control group, had six replicates (pots). The group design is shown in Table 6.

[0076] Table 6. Grouping information of maize seed germination test in soil with residues of multiple herbicides from fermentation broth.

[0077] Sowing and Management: After treatment with fermentation broth and standing for 3 days, 5 plump and uniform corn seeds were evenly sown at a depth of 2 cm in each seedling pot. The seeds were covered with soil and placed in an artificial climate chamber at 25℃, 70% relative humidity, and natural light. Daily observation and timely watering were conducted to ensure consistent management conditions across all groups. On the 7th day after sowing, the number of seedlings emerging from each group was counted. Germination was defined as the coleoptile emerging more than 1 cm from the soil surface, and the germination rate was calculated. The germination rate calculation formula is: Germination rate (%) = (Number of all germinated seeds / 30) × 100%. The results are shown in Table 7.

[0078] Table 7 Results of maize seed germination test in soil with residues of various herbicides using fermentation broth

[0079] Table 7 shows that the germination rate of maize seeds in the blank control group was normal, reaching over 96%, indicating good seed viability under no herbicide stress. The germination rates of all herbicide-damaged groups were significantly lower than the blank control group (<15%), indicating that residual herbicides in the soil had a significant toxic and inhibitory effect on maize seed germination. The germination rates of all remediation groups treated with Rhodococcus faecalis fermentation broth were significantly improved compared to the corresponding damaged groups, with the remediation effect against atrazine stress being particularly excellent. Furthermore, this remediation effect showed a clear concentration dependence: the recovery of germination rate was more significant with increasing fermentation broth concentration. The experiment confirms that irrigating with the Rhodococcus faecalis fermentation broth prepared in Example 2 can relieve the inhibitory effect of various residual herbicides in the soil on maize seed germination, restoring the germination rate to near-normal levels.

[0080] Experiment Example 3: Evaluation of the mitigation effect of Rhodococcus rubrum fermentation broth on glyphosate-induced herbicide damage in maize seedlings. This experiment induced herbicide damage stress by irrigating the soil of corn seedlings with a mixture containing glyphosate. A blank control group with water replacing the mixture and a herbicide-only treatment group with water replacing the bacterial solution were set up. After a period of cultivation, the mitigation effect of Rhodococcus rubra on glyphosate damage was comprehensively observed and evaluated.

[0081] Seedling transplanting: Sow corn seeds in seedling boxes filled with nutrient soil (6.85 cm in diameter, 8.5 cm in height, 180 g of nutrient soil per box), water normally until the seedlings grow to the 2-leaf and 1-heart stage, then select corn seedlings with uniform growth to transplant into seedling pots (5 seedlings / pot).

[0082] Irrigation test: Take an appropriate amount of glyphosate solution and mix it with the diluted Rhodococcus ferment broth prepared in Example 2 (2×10⁻⁶). 7Mix thoroughly (cfu / mL), adjusting the glyphosate concentration in the system to the set final concentration (50 μg / kg). Pour 60 mL of the above mixture into seedling trays containing transplanted corn seedlings. Observe the growth of the corn seedlings after 7 days of cultivation. The results are as follows: Figure 2 As shown in the figure, the blank control group C1 was irrigated with an equal amount of water instead of the mixed solution, and the treatment group C2 was irrigated with an equal amount of water instead of the Rhodococcus ferment broth mixed with glyphosate. All groups underwent routine watering and maintenance during the experiment. Each treatment group, including the blank control group, had three replicates (pots). The group design is shown in Table 8.

[0083] Table 8. Grouping information for the mitigation test of glyphosate-induced herbicide damage in maize seedlings by Rhodococcus rubrum fermentation broth

[0084] The corn seedlings in the blank control group C1, after growing under normal conditions for 7 days, successfully progressed from the initial 2-leaf-1-heart stage to the 3-4-leaf stage. The seedlings grew uniformly, and the leaves were dark green (chlorophyll SPAD value 41.26±2.83). However, after applying glyphosate alone, the corn seedlings showed obvious yellowing of both leaves and stems, with stems turning pale and growth slowing down, exhibiting typical herbicide damage symptoms. The leaf chlorophyll SPAD value was only 16.30±1.59. In contrast, the yellowing symptoms of the corn seedlings in the treatment group C3, which was treated with Rhodococcus faecalis fermentation broth, were significantly alleviated, with some leaves regaining their green color. The SPAD value rose to 33.86±1.72, which was closer to the normal level.

[0085] Experiment Example 4: Evaluation of the mitigation effect of Rhodococcus faecalis fermentation broth on 2,4-D sodium-induced herbicide damage in maize seedlings. This experiment induced herbicide damage stress by irrigating the soil of corn seedlings with a mixture containing 2,4-D sodium chloride. A blank control group with water replacing the mixture and a herbicide-only treatment group with water replacing the bacterial solution were set up. After a period of cultivation, the mitigation effect of Rhodococcus rubrum on 2,4-D sodium chloride damage was comprehensively observed and evaluated.

[0086] Seedling transplanting: Sow corn seeds in seedling boxes filled with nutrient soil (6.85 cm in diameter, 8.5 cm in height, 180 g of nutrient soil per box), water normally until the seedlings grow to the 4-leaf and 1-heart stage, then select corn seedlings with uniform growth to transplant into seedling pots (5 seedlings / pot).

[0087] Irrigation test: Take an appropriate amount of 2,4-D sodium chloride solution and mix it separately with the diluted Rhodococcus ferment broth prepared in Example 2 (2×10⁻⁶). 7Mix thoroughly with 2,4-D sodium to the set final concentration (50 μg / kg). Pour 60 mL of the above mixture into seedling trays containing transplanted corn seedlings. Observe the growth of the corn seedlings after 7 and 14 days of cultivation. The results are as follows: Figure 3-4 As shown in the figure, the blank control group D1 was irrigated with an equal amount of water instead of the mixed solution, and the treatment group D2 was irrigated with an equal amount of water instead of the Rhodococcus ferment broth mixed with 2,4-D sodium chloride. All groups underwent routine watering and maintenance during the experiment. Each treatment group, including the blank control group, had three replicates (pots). The grouping design is shown in Table 9.

[0088] Table 9. Grouping information for mitigation experiments of Rhodococcus faecalis fermentation broth against 2,4-D sodium-induced herbicide damage in maize seedlings.

[0089] from Figure 2 It can be seen that the corn seedlings in the blank control group D1, under normal care conditions, successfully progressed from the initial 4-leaf-1-heart stage to the early jointing stage after 7 days of growth. However, after applying sodium 2,4-D alone, the corn plants were prone to lodging and showed signs of phytotoxicity such as malformed stems; after treatment with Rhodococcus faecalis fermentation broth, the symptoms of phytotoxicity, including lodging and stem malformation, were effectively reduced.

[0090] from Figure 3 It can be seen that after 7 more days of cultivation, the corn plants in the blank control group D1 grew vigorously, with a significant increase in plant height, upright stems, and fully expanded leaves, showing no abnormal phenotypes. In the treatment group D2, the symptoms of pesticide damage further aggravated; the previously lodged plants could not recover their upright position on their own, stem deformities worsened, and plant height was significantly lower than the blank control group. In contrast, the corn plants in group D3, treated with Rhodococcus ferment broth, showed a significant trend of recovery, with the pesticide damage fundamentally alleviated. The plants gradually recovered from mild deformities to upright positions, stem development approached normal, and support capacity significantly increased. The plant height was 52.87±1.58 cm, reaching 69.17% of the control group, an increase of 56.93% compared to group D2, with growth indicators significantly better than group D2.

[0091] In summary, both glyphosate and sodium 2,4-D herbicides cause significant phytotoxicity to corn seedlings at different growth stages. Applying the *Rhodococcus rubrum* fermentation broth prepared in Example 2 significantly alleviated the phytotoxicity symptoms in corn caused by these two different types of herbicides. It effectively reduced the growth inhibition and irreversible physiological damage to corn seedlings caused by the herbicides, prevented the phytotoxicity from worsening, and promoted the recovery of plants to normal growth. This indicates that *Rhodococcus rubrum* possesses excellent herbicide detoxification and phytotoxicity repair capabilities.

[0092] Example 5: Evaluation of the mitigating effect of Rhodococcus rubrum fermentation broth on atrazine-induced herbicide damage in cucumber seedlings. This experiment induced herbicide damage stress by irrigating cucumber seedlings with a mixture containing atrazine. A blank control group with water replacing the mixture and a herbicide-only treatment group with water replacing the bacterial solution were set up. After a period of cultivation, the mitigation effect of Rhodococcus rubra on atrazine damage was comprehensively observed and evaluated.

[0093] Seedling transplanting: Sow cucumber seeds in seedling boxes filled with nutrient soil (6.85 cm in diameter, 8.5 cm in height, 180 g of nutrient soil per box), water normally until the seedlings grow to the stage of 3-4 true leaves, select cucumber seedlings with uniform growth and transplant them into seedling pots (1 seedling / pot).

[0094] Irrigation test: Take an appropriate amount of atrazine solution and mix it with the diluted Rhodococcus ferment broth prepared in Example 2 (2×10⁻⁶). 7 Mix the atrazine solution (cfu / mL) thoroughly and adjust the atrazine concentration to the set final concentration (50 μg / kg). Pour 60 mL of the above mixture into seedling trays containing cucumber seedlings. Observe the growth of the cucumber seedlings after 7 days of cultivation. The results are as follows: Figure 4 As shown in the figure, the blank control group E1 was irrigated with an equal amount of water instead of the mixed solution, and the treatment group E2 was irrigated with an equal amount of water instead of the Rhodococcus ferment broth mixed with atrazine. All groups underwent routine watering and maintenance during the experiment. Each treatment group, including the blank control group, had three replicates (pots). The group design is shown in Table 10.

[0095] Table 10. Group information of the experiment to alleviate the herbicide damage to cucumber seedlings caused by atrazine from Rhodococcus faecalis fermentation broth.

[0096] from Figure 4 It can be seen that, under normal care conditions, cucumber seedlings in the blank control group E1 successfully progressed from the initial 3-4 true leaf stage to the 4-5 true leaf stage after 7 days of growth, with fully expanded leaves and slight elongation of internodes. However, after applying atrazine alone, the cucumber seedlings exhibited typical phytotoxicity symptoms: smaller leaves, with the average maximum leaf area being only 43.71±0.77 cm². 2 Compared to the control group, the herbicide-treated cucumbers in group E3 showed a 38.82% reduction in growth, with paler leaf color and insufficient leaf expansion. Their growth was significantly inhibited and their vitality decreased compared to the blank control group. In contrast, compared to treatment group E2, cucumber seedlings in group E3 showed significantly improved growth, with larger, more expansive, and darker green leaves. New leaves developed normally, and the plant height reached 15.82±0.31 cm, an increase of 31.72% compared to the herbicide-treated group. Overall, their growth was significantly better than the herbicide-treated group and approached the healthy state of the blank control group, effectively alleviating herbicide damage symptoms. In conclusion, the *Rhodococcus rubrum* described in this application has good application potential and practical value in alleviating crop herbicide damage and reducing soil residues.

[0097] Experiment Example 6: The Restorative Effect of Rhodococcus faecalis Fermentation Broth on Maize Plant Growth in Soil with Atrazine Residue The test crop was maize variety "Zhengdan 958".

[0098] The tested herbicide was 38% atrazine suspension concentrate (Shandong Binnong Technology Co., Ltd.).

[0099] Test inoculum: Rhodococcus faecalis fermentation broth prepared in Example 2 (viable count ≥ 1.0 × 10⁻⁶) 10 (cfu / mL).

[0100] Experimental location: Major corn-producing area in Dezhou City, Shandong Province, where the background residue of atrazine in the soil was 0.03 mg / kg.

[0101] Experimental design: The experimental site is 8 m long and 12 m wide, divided into 5 plots with a width of 2 m / plot, each plot being 12 m wide. 2 (Including 3 biological replicates, with 25 plants planted in each region and a total of 75 plants planted in each plot). The application treatment design is shown in Table 11.

[0102] Table 11. Remediation Effect of Fermentation Broth on Maize Plant Growth in Soil with Atrazine Residue: Experimental Groups

[0103] Application method: Apply the herbicide before emergence after corn sowing using a backpack sprayer for uniform soil spraying. Group F1 was sprayed with an equal volume of water. Group F2 was sprayed with only diluted atrazine solution according to the application requirements. Groups F3-F5 had atrazine suspension (using the same amount as Group F2) mixed with Rhodococcus ferment broth, diluted as required, and then sprayed. During the trial, irrigation and weeding were carried out uniformly; no other herbicides were applied, and management practices during the growth period remained consistent with local routine field management.

[0104] Evaluation Indicator Determination: Herbicide Damage Relief Effect: At the 3-leaf stage of maize, the herbicide damage level of maize plants was investigated according to the national standard GB / T 17980.42-2000 "Field Efficacy Test Guidelines for Pesticides (I) Herbicide Control of Weeds in Maize Fields" (levels 1-5). The incidence rate of herbicide damage was calculated using the formula: Incidence rate of herbicide damage = Number of maize plants showing herbicide damage symptoms / Total number of maize plants × 100%. Level 1: Maize growth is normal, with no damage symptoms; Level 2: Slight herbicide damage to maize, less than 10%; Level 3: Moderate herbicide damage to maize, which can recover later and does not affect yield; Level 4: Severe herbicide damage to maize, difficult to recover, resulting in yield reduction; Level 5: Severe herbicide damage to maize, unable to recover, resulting in significant yield reduction or complete crop failure. Growth Indicators: At the jointing stage, the plant height and stem diameter of maize plants in each plot were recorded. The relative chlorophyll content (SPAD value) of the leaves was measured using a SPAD-502 plus portable chlorophyll meter. The results are shown in Table 12.

[0105] Table 12 Results of the experiment on the remediation effect of fermentation broth on maize plant growth in soil with atrazine residue.

[0106] As shown in the table above, treatment group F2 exhibited obvious pesticide damage symptoms at the 3-leaf stage: leaf yellowing and plant stunting, with a pesticide damage level of 4 and an incidence rate of 68.00%. Some plants showed growth stagnation. After treatment with low-concentration fermentation broth, the pesticide damage level of the plants decreased to level 3, and the incidence rate of pesticide damage decreased to 30.67%, with significant relief of pesticide damage symptoms. The pesticide damage levels of treatment groups F4 (medium concentration) and F5 (high concentration) decreased to level 2, with the pesticide damage rate below 10%. Leaf yellowing and stunting basically disappeared, showing no significant difference from the blank control group (pesticide damage level 1).

[0107] In the F2 group, the plant height and stem diameter of maize plants at the jointing stage were reduced by 15.88% and 22.77% respectively compared to the control group, and the chlorophyll content was reduced by 17.82%, indicating significantly inhibited growth. In contrast, the plant height and stem diameter of the Rhodococcus fermentation broth treatment groups F4 and F5 showed no significant differences compared to the control group. Specifically, the chlorophyll content of the F5 group was increased by 25.99% compared to the F2 group, and the plant height and stem diameter were increased by 18.96% and 23.45% respectively. These growth performances of maize seedlings further confirm that the Rhodococcus described in this application can effectively alleviate the phytotoxic stress caused by atrazine on maize plants and promote the recovery of normal plant growth.

[0108] The above description is merely a preferred embodiment of this application and is not intended to limit the application in any other way. Any person skilled in the art may make changes or modifications to the disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of this application without departing from the scope of the technical solution of this application shall still fall within the protection scope of this application.

Claims

1. A type of Rhodococcus Rhodococcus ruber It is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 36743.

2. A microbial agent comprising the Rhodococcus as described in claim 1 or the fermentation product of said Rhodococcus.

3. The microbial agent according to claim 2, wherein the microbial agent is a solid microbial agent or a liquid microbial agent.

4. The microbial agent according to any one of claims 2-3, wherein the microbial agent further comprises agriculturally acceptable adjuvants.

5. Use of the Rhodococcus rubrum according to claim 1 or the microbial agent according to any one of claims 2-4 in the degradation of herbicide residues in soil; The herbicide is selected from one or more of the following: metsulfuron-methyl, glyphosate, atrazine, MCPA sodium, and imidazoline.

6. The use of the Rhodococcus rubrum of claim 1 or the microbial agent of any one of claims 2-4 in mitigating the phytotoxicity of plants caused by herbicide residues in the soil; The herbicide is selected from one or more of the following: metsulfuron-methyl, glyphosate, atrazine, MCPA sodium, and imidazoline.

7. A method for degrading herbicide residues in soil, comprising applying the Rhodococcus rubrum of claim 1 or the microbial agent of any one of claims 2-4 to plants; The Rhodococcus rubrum or the inoculant is applied to the planting area of ​​the plant before the plant is sown; or After the plant sprouts, the Rhodococcus rubrum or the inoculant is applied to the roots of the plant.