Method for directional change of low oxygen tolerance potential of fish based on dhrs11
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-02
- Publication Date
- 2026-08-11
AI Technical Summary
然而,Dhrs11基因在鱼类耐低氧调控中的功能此前尚未见报道
(1)本发明首次鉴定了Dhrs11基因为调控鱼类耐低氧性状的关键功能基因。通过在团头鲂中过表达LOC125249622以及在斑马鱼中敲除其同源基因dhrs11b.1,分别从功能获得和功能缺失两个维度证实了该基因对耐低氧能力的正向调控作用,为鱼类耐低氧分子育种提供了全新且可靠的靶点。
Smart Images

Figure CN122542571A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of fish genetic engineering and genetic breeding technology, specifically relating to a method for directionally altering the hypoxia tolerance potential of fish by regulating the expression level of the dehydrogenase / reductase family member 11 (Dhrs11) gene. Background Technology
[0002] Oxygen (O2) is a fundamental substance for cell metabolism and life activities. Its dissolved oxygen (DO) level in water has significant fluctuation characteristics. This typical feature of the aquatic environment makes the growth, metabolism and reproduction of aquatic species extremely susceptible to the negative effects of hypoxia stress.
[0003] The blunt snout bream (Megalobrama amblycephala) is an important herbivorous economic fish in my country with delicious flesh, but it is extremely sensitive to dissolved oxygen. When the dissolved oxygen in the water is below 0.5 mg / L, it is very easy to die, which causes huge losses to high-density aquaculture and transportation.
[0004] Zebrafish (Danio rerio), as a classic model vertebrate, possesses advantages such as high reproductive capacity, transparent embryos, and a mature genetic manipulation system, making it an ideal model for studying the molecular mechanisms of hypoxia tolerance in fish. Unlike blunt snout bream, zebrafish have a strong ability to tolerate hypoxia, making them more suitable for using loss-of-function strategies such as gene knockout to verify the causal relationship between candidate genes and hypoxia tolerance traits.
[0005] The dehydrogenase / reductase family member 11 (Dhrs11) gene encodes a short-chain dehydrogenase / reductase belonging to the SDR superfamily, which is widely involved in intracellular redox metabolism. However, the function of the Dhrs11 gene in the regulation of hypoxia tolerance in fish has not been previously reported. This invention is the first to discover a direct positive regulatory relationship between the expression level of this gene and the hypoxia tolerance potential of fish, providing a novel functional target for molecular breeding of fish with hypoxia tolerance.
[0006] Therefore, elucidating the molecular mechanisms of hypoxia tolerance in fish and developing methods to enhance their hypoxia tolerance potential has significant economic and scientific value. Summary of the Invention
[0007] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above and to provide a method for directionally changing the hypoxia tolerance potential of fish based on Dhrs11.
[0008] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:
[0009] This invention provides a method for directionally altering the hypoxia tolerance potential of fish based on Dhrs11. The method includes altering the hypoxia tolerance potential of fish by regulating the expression level of the Dhrs11 gene or the activity of the Dhrs11 protein. The regulation refers to: overexpressing the Dhrs11 gene in the fish through genetic engineering, thereby increasing the fish's hypoxia tolerance potential; or knocking out or knocking down the Dhrs11 gene in the fish through genetic engineering, thereby reducing the fish's hypoxia tolerance potential.
[0010] In the above method, preferably, the fish is blunt snout bream or zebrafish.
[0011] Preferably, the fish is a blunt snout bream, and the Dhrs11 gene is the LOC125249622 gene, the nucleotide sequence of which is shown in SEQ ID NO:13.
[0012] Preferably, the method includes: constructing an overexpression vector containing the LOC125249622 gene coding sequence, introducing it into blunt snout bream embryos, and screening for positive individuals to obtain blunt snout bream with improved hypoxia tolerance potential.
[0013] Preferably, the fish is a zebrafish, and the Dhrs11 gene refers to the dhrs11b.1 gene, whose nucleotide sequence is shown in SEQ ID NO:14.
[0014] Preferably, the method includes: gene editing of zebrafish embryos using sgRNA and Cas9 protein targeting the dhrs11b.1 gene to obtain zebrafish with the dhrs11b.1 gene knocked out, wherein the target sequence of the sgRNA is as follows (as shown in SEQ ID No:9~SEQ ID No:10 in sequence): sg1:5'-ACTGGAGCTTCAGTAGGAAT-3'; sg2: 5'-GGTCGGATGTGCCAGAAATG-3'.
[0015] This invention is the first to discover and confirm a direct positive regulatory relationship between the expression level of the Dhrs11 gene and the hypoxia tolerance potential of fish. Based on this discovery, a method for directionally altering the hypoxia tolerance potential of fish using Dhrs11 is provided, which has the following beneficial effects: (1) This invention identifies the Dhrs11 gene as a key functional gene regulating the hypoxia tolerance trait in fish for the first time. By overexpressing LOC125249622 in blunt snout bream and knocking out its homolog dhrs11b.1 in zebrafish, the positive regulatory role of this gene on hypoxia tolerance was confirmed from two dimensions: gain-of-function and loss-of-function, providing a novel and reliable target for molecular breeding of fish with hypoxia tolerance.
[0016] (2) The method of the present invention is highly operable and effective. Overexpression of LOC125249622 in blunt snout bream can significantly reduce the dissolved oxygen concentration at the first surface of the surface of the fish compared to the wild type, effectively improving the hypoxia tolerance potential of this oxygen-sensitive economic fish, which has direct application value for reducing hypoxia losses during high-density aquaculture and transportation.
[0017] (3) The method of the present invention has cross-species applicability. Based on homology analysis, the present invention has verified the functional conservation of the Dhrs11 gene in both blunt snout bream and zebrafish, which have different taxonomic positions, indicating that the gene can be used as a universal target for improving the hypoxia tolerance trait in a variety of fish and has broad application prospects.
[0018] (4) The dhrs11b.1 knockout homozygous zebrafish constructed in this invention can serve as an ideal animal model for hypoxia tolerance research, and can be used to deeply analyze the molecular mechanism of Dhrs11 gene participation in hypoxia response, as well as to screen and evaluate drugs or breeding programs related to hypoxia tolerance. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 This is a graph showing the transcriptome analysis and screening results of an embodiment of the present invention.
[0021] Figure 2 This is a graph showing the qPCR verification results of an embodiment of the present invention.
[0022] Figure 3 This is a fluorescence screening image of positive blunt snout bream overexpressing LOC125249622 according to an embodiment of the present invention.
[0023] Figure 4 This is a comparison chart of the hypoxia tolerance of wild-type blunt snout bream (BSB-NR) and blunt snout bream overexpressing LOC125249622 (BSB-Tg) in an embodiment of the present invention.
[0024] Figure 5 The image shows the results of detecting the basal expression levels of the zebrafish dhrs11b.1 and dhrs11b.2 genes in different tissues according to an embodiment of the present invention; where A represents the relative expression level of dhrs11b.1; B represents the relative expression level of dhrs11b.2; and C represents the relative expression levels of the dhrs11b.1 and dhrs11b.2 genes.
[0025] Figure 6 Electrophoresis diagram of genotyping of homozygous dhrs11b.1 gene knockout zebrafish according to an embodiment of the present invention.
[0026] Figure 7 This is a gene comparison diagram of the dhrs11b.1 gene before and after homozygous knockout in an embodiment of the present invention.
[0027] Figure 8 This is a comparison chart of the hypoxia tolerance of wild-type zebrafish (WT) and dhrs11b.1 knockout homozygous zebrafish (KO) in an embodiment of the present invention. Detailed Implementation
[0028] According to existing technology reports, in the field of fish genetic engineering and breeding technology, gynogenetic blunt snout bream (GBSB) eggs can be cultivated by activating them with sperm irradiated with ultraviolet light from red crucian carp and performing chromosome doubling treatment. This GBSB population consists entirely of female individuals and exhibits tolerance to hypoxia. Furthermore, using GBSB as the female parent and crossing it with wild-type male BSBs can yield a large number of F1 offspring (GBSBF1). Compared to wild-type BSBs, GBSBF1 still maintains good tolerance to hypoxia.
[0029] To identify the key gene in GBSBF1 that confers its superior hypoxia tolerance, this invention selected four groups of liver samples for transcriptome sequencing based on differences in hypoxia tolerance: normal BSB control group (BSBC), the least hypoxia-tolerant BSB group (BSBN), normal GBSBF1 control group (F1C), and the most hypoxia-tolerant GBSBF1 group (F1H). Differential expression analysis identified the candidate gene LOC125249622, which is significantly associated with GBSBF1 hypoxia tolerance. This gene is not annotated in the *Brucea bream* reference genome and was identified as homologous to the human Dhrs11 gene through sequence alignment. It should be noted that the blunt snout bream genome contains an annotated dhrs11a gene, as well as several unannotated sequences that, after analysis, were identified as different transcripts of the Dhrs11 homologous protein (LOC125249621, LOC125249622, LOC125249623, LOC125249624, LOC125249625, and LOC125249628), of which LOC125249622 is one.
[0030] qPCR experiments further validated the reliability of the transcriptome data. The results showed that LOC125249622 was most highly expressed in the GBSBF1 group (F1H), which had the strongest hypoxia tolerance, and least expressed in the BSB group (BSBN), which had the weakest hypoxia tolerance. The overall expression trend was F1H>F1C>BSBC>BSBN, and there were significant differences among the groups, which is consistent with the transcriptome analysis results.
[0031] To confirm whether LOC125249622 directly contributes to enhancing the hypoxia tolerance of blunt snout bream, this invention employs a microinjection method to introduce a transposon overexpression plasmid (ubi-LOC125249622-mcherry) containing the complete CDS sequence of LOC125249622 (e.g., SEQ ID NO:13) into wild-type BSB embryos. Positive individuals (BSB-Tg) are obtained through fluorescence screening. Hypoxia tolerance tests were performed on wild-type BSB (BSB-control) and overexpressing BSB (BSB-Tg). The results showed that the hypoxia tolerance of the BSB-Tg group was significantly enhanced compared to the control group, thus demonstrating that upregulation of LOC125249622 expression can effectively improve the hypoxia tolerance potential of blunt snout bream.
[0032] To further verify whether this gene is also related to hypoxia tolerance in other fish species, this invention conducted a loss-of-function experiment in the zebrafish model organism. Since zebrafish possess strong hypoxia tolerance, a knockout strategy is more suitable for verification. The gene homologous to LOC125249622 in zebrafish is dhrs11, which contains two paralogous genes, dhrs11a and dhrs11b. dhrs11b contains two homologous sequences, dhrs11b.1 and dhrs11b.2 (e.g., SEQ ID NO:15). Tissue basal expression analysis showed that dhrs11b.1 was expressed at a higher level than dhrs11b.2 in the liver; therefore, dhrs11b.1 (e.g., SEQ ID NO:14) was preferentially selected as the knockout target. Two sgRNAs (sg1: ACTGGAGCTTCAGTAGGAAT; sg2: GGTCGGATGTGCCAGAAATG) were designed based on the zebrafish dhrs11b.1 genome sequence, as shown in SEQ ID No:9~SEQ ID No:10, and gene editing was performed using the RNP injection method. After positive selection of the F0 generation and backcrossing with wild-type (WT) individuals to obtain F1, individuals carrying the -56 bp deletion fragment were selected for self-crossing to obtain homozygous F2 individuals. This was further propagated to obtain a homozygous population F3, which is the dhrs11b.1 knockout homozygous population (KO, dhrs11b.1). - / - ).
[0033] For wild-type zebrafish (WT, dhrs11b.1) + / + ) and dhrs11b.1 knockout homozygotes (KO, dhrs11b.1) - / - Hypoxia tolerance experiments were conducted, and the results showed that knocking out dhrs11b.1 significantly reduced the hypoxia tolerance of zebrafish, thus proving that normal expression of dhrs11 is necessary for zebrafish to maintain hypoxia tolerance. These results collectively indicate that the expression level of the Dhrs11 gene has a positive regulatory effect on the hypoxia tolerance potential of fish.
[0034] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.
[0035] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.
[0036] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.
[0037] The wild-type blunt snout bream (BSB), gynogenetic blunt snout bream (GBSB), and the F1 generation of the cross between the GBSB maternal parent and the BSB paternal parent (GBSBF1) used in this invention were all provided by the State Key Laboratory of Freshwater Fish Developmental Biology, College of Life Sciences, Hunan Normal University.
[0038] Example 1 This embodiment provides a method for directionally altering the hypoxia tolerance potential of fish by regulating the expression level of the Dhrs11 gene, specifically including the following steps: 1. Screening and identification of candidate gene LOC125249622 (dhrs11) 1.1 Transcriptome Sample Collection Fifteen 12-month-old wild-type blunt snout bream (BSB) and fifteen hypoxia-tolerant hybrid F1 fish (GBSBF1) were transferred to two separate 60 L aquariums for the experiment. Before the experiment, the fish were acclimatized to the same conditions for one week and fasted for three days. Dissolved oxygen (DO) concentration was maintained at 6.0 ± 0.5 mg / L using aeration equipment. Hypoxia stress was simulated by gradually reducing the dissolved oxygen concentration by introducing nitrogen into the water. The first appearance of the fish surfacing for air was used as an indicator of hypoxia tolerance, and the dissolved oxygen level at this point was measured using a dissolved oxygen meter (German AM39 model). After the hypoxic stress ended, three individuals each of the least hypoxic BSB (BSBN, nothypoxia of BSB, who surfaced first) and the most hypoxic-tolerant GBSBF1 (F1H, high hypoxia of GBSBF1, who surfaced last) were selected. After one week of recovery feeding, liver samples were collected from a total of 12 fish, including three normal BSB (BSBC, control of BSB) and three normal GBSBF1 (F1C, control of GBSBF1) that had not undergone hypoxia treatment, for transcriptome sequencing.
[0039] 1.2 Transcriptome Sequencing and Data Analysis Transcriptome sequencing was performed by Wuhan 1MORE Technology Co., Ltd. on the DNBSEQ-T7RS platform. The genome of *Brucea bream* (ASM1881202v1) in the NCBI database was used for alignment. Differentially expressed genes (DEGs) between different groups were identified using a threshold of |log2FC|≥1 and a corrected P-value <0.05. Data analysis was performed using R Studio software. The screening strategy was set to simultaneously meet four conditions: F1C expression was significantly higher than BSBC, BSBC expression was significantly higher than BSBN, F1H expression was significantly higher than BSBN, and F1H expression was significantly higher than F1C. Figure 1 As shown, only one candidate gene meets the stringent screening criteria: LOC125249622. This gene is not annotated in the *Brucea shinskii* reference genome but was identified as a human Dhrs11 homolog after alignment. It should be noted that the *Brucea shinskii* genome also contains an annotated dhrs11a and several unannotated sequences that, after analysis, were determined to be different transcripts of the Dhrs11 homologous protein (LOC125249621, LOC125249622, LOC125249623, LOC125249624, LOC125249625, LOC125249628), with LOC125249622 being one of them.
[0040] 1.3 qPCR experiment To verify the accuracy of the transcriptome data, the expression level of LOC125249622 was detected using real-time quantitative PCR (qPCR). Liver tissue from the same batch as that used for transcriptome sequencing was collected. Total RNA was extracted using Trizol reagent (Tiangen, DF424), and then the first strand of cDNA was synthesized using a reverse transcription kit (Thermo Fisher Scientific). Real-time quantitative polymerase chain reaction (qPCR) was then performed using PerfectStartGreen qPCR SuperMix (TransGold, AQ601). The reaction system was 10 μL, containing 5 μL SYBR-Green Master Mix, 0.2 μL each of forward and reverse primers (LOC125249622-F1 and LOC125249622-R1), 0.2 μL template cDNA, and 4.4 μL double-distilled water. A total of 40 thermal cycles were performed. The experiment was independently repeated three times, using actin as an internal control gene. -ΔΔCt The relative expression level was calculated using a method, and the primer sequences used are shown in Table 1.
[0041] Table 1: Primer sequences
[0042] The results are as follows Figure 2As shown, the expression level of LOC125249622 in the four groups of samples exhibited a gradient trend of F1H>F1C>BSBC>BSBN, meaning that the expression level was highest in the GBSBF1 individual (F1H), which had the strongest hypoxia tolerance, and lowest in the common blunt snout bream individual (BSBN), which had the weakest hypoxia tolerance, and the differences between the groups were statistically significant. This result is completely consistent with the transcriptome data, confirming the reliability of the transcriptome analysis.
[0043] 2. Overexpression of LOC125249622 is beneficial to improving the hypoxia tolerance of blunt snout bream. 2.1 Preparation of Tol2 transgenic plasmid (LOC125249622 overexpression) Based on the pBLK vector containing the 200LA-150RA core region of the Tol2 transposon, an overexpression plasmid for LOC125249622 was constructed. First, total RNA was extracted from the liver tissue of blunt snout bream and reverse transcribed into cDNA (method reference 1.3). Using this cDNA as a template, an 817 bp LOC125249622 CDS fragment was amplified using primers LOC-F and LOC-R. Then, a linearized vector fragment of approximately 7.7 kb, PBLK-ubi-P2A-mcherry, was amplified using primers PBLK-F and PBLK-R. After purification and gel recovery of both fragments, they were ligated via homologous recombination. Following transformation, plating, and single-clone selection and sequencing verification, clones with correct sequences were selected for plasmid extraction, ultimately yielding the LOC125249622 overexpression vector, named PBLK-ubi-LOC125249622-P2A-mcherry. The homologous recombination reaction system is shown in Table 2. Fluorescence screening of LOC125249622-overexpressing positive blunt snout bream is shown in [Table 2]. Figure 3 .
[0044] The primer sequences used are as follows (as shown in SEQ ID No:5 to SEQ ID No:8 in sequence): LOC-F:CTTACTTTGAATTTGTTTACAGGCCACCATGGATCGCTGGAAAGGCAG; LOC-R:ggagaaattagtagcTCCGCTTCCCATCGTCTGCTCAACGGGCGTTAT; PBLK-F:ATAACGCCCGTTGAGCAGACGATGGGAAGCGGAgctactaatttctcc; PBLK-R: CTGCCTTCCAGCGATCCATGGTGGCCTGTAAACAAATTCAAAGTAAG; Table 2: Homologous recombination reaction system
[0045] 2.2 Preparation of transposases The transposase (pCS2-TP plasmid) mRNA was prepared using the MEGAscript™ SP6 transcription kit (AM1330, Invitrogen). The specific steps are as follows: The pCS2-TP plasmid was digested with NotI-HF (R3189, New England Biolabs), and the linearized plasmid was obtained by gel extraction (Omega). Using 200 ng of linearized DNA as a template, 2 μL each of SP6 enzyme, ATP, CTP, GTP, and UTP were added, and the volume was brought up to 20 μL with nuclease-free water. In vitro transcription was performed at 37°C for 4 h. Subsequently, 30 μL of DEPC-treated water and 30 μL of LiCl solution were added, mixed, and incubated at -80°C for 10 min to precipitate RNA. The RNA was centrifuged at 4°C for 15 min, the supernatant was discarded, and the RNA was washed once with 1 mL of 70% ethanol. After centrifugation again, the ethanol was gently removed. Finally, the RNA was dissolved in 50 μL of DEPC-treated water, and the RNA concentration was measured before freezing and storing at -20°C or -80°C.
[0046] The microinjection method is as follows: A glass injection needle was prepared using a P-1000 needle puller (CA 94949, Sutter Instrument, USA); fish eggs were collected with a pipette and placed in the groove of a 2% agar plate pre-cooled at 4°C, keeping the embryos moist and removing excess water; 300 ng Tol2 transposon plasmid DNA (PBLK-ubi-LOC125249622-P2A-mcherry) and 200 ng transposase mRNA (from pCS2-TP plasmid) were premixed at room temperature for 5 min; after checking the airtightness of the micromanipulator, 10 μL of the mixture was transferred into the glass needle, and manually injected into 1-cell stage embryos one by one using a FemtoJet (Eppendorf) microinjection system connected to an inverted OLYMPUS SZX12 microscope, with an injection volume of approximately 1 nL per embryo.
[0047] After injection, the fluorescence expression of the embryos or fish was observed under the corresponding excitation light using a fluorescence microscope. Individuals with positive red fluorescence (mCherry) were selected, which were the fish with positive LOC125249622 overexpression (Tg).
[0048] Five wild-type blunt snout bream (BSB-NR) and five overexpression blunt snout bream (BSB-Tg) of similar size, aged 6 months, were transferred to two separate 30 L aquariums for the experiment. Before the experiment, the fish were acclimatized under the same conditions for one week and fasted for three days. The dissolved oxygen concentration (DO) was maintained at 6.0 ± 0.5 mg / L using aeration equipment. The DO concentration was gradually reduced by introducing nitrogen to simulate a natural hypoxic environment. The first appearance of the fish surfacing at the surface was used as an indicator of hypoxia, and the DO level at this point was measured using a dissolved oxygen meter (German AM39 model). The results are as follows: Figure 4 As shown, the dissolved oxygen concentration of the overexpressing blunt snout bream (BSB-Tg) individuals at their first surface was significantly lower than that of the wild-type blunt snout bream (BSB-NR), indicating that LOC125249622 overexpression is beneficial for blunt snout bream to acquire stronger hypoxia tolerance.
[0049] 3. Knockout of the dhrs11 gene reduces the zebrafish's tolerance to low oxygen levels. 3.1 Comparative analysis of the LOC125249622 gene in blunt snout bream and the dhrs11 gene in zebrafish. Homology analysis revealed that the gene corresponding to LOC125249622 in *Brucea bream* is dhrs11, which contains two paralogous genes, dhrs11a and dhrs11b. dhrs11b further comprises two sequences, dhrs11b.1 and dhrs11b.2. To identify the knockout target, basal expression levels of dhrs11b.1 and dhrs11b.2 in different tissues were measured, such as... Figure 5 The results showed that both genes were expressed at the highest levels in the liver, and the expression level of dhrs11b.1 in the liver was higher than that of dhrs11b.2. Therefore, dhrs11b.1 was the preferred target gene for knockout.
[0050] 3.2 Constructing homozygous zebrafish with dhrs11b.1 knockout When constructing zebrafish with dhrs11b.1 knockout homozygous, the zebrafish dhrs11b.1 gene (Gene ID: 791770) was first searched in the NCBI database. Two sgRNA targets (sg1 and sg2) were designed on exon 1, with the sequences as follows (as shown in SEQ ID No: 9~SEQ ID No: 10 in sequence): sg1:5'-ACTGGAGCTTCAGTAGGAAT-3'; sg2: 5'-GGTCGGATGTGCCAGAAATG-3'.
[0051] After sgRNA was prepared by in vitro transcription, it was mixed with Cas9 protein (final sgRNA concentration: 200-300 ng / μL; final Cas9 protein concentration: 20 ng / μL), and incubated at 37°C for 15 min to form an RNP complex. This complex was then microinjected into 1-cell stage wild-type (WT) embryos, with an injection volume of approximately 1 nL per embryo. After injection, a portion of F0 embryos were randomly selected for mutation detection to verify target effectiveness. Once the F0 individuals had grown, tail fin DNA was extracted for genotyping. F0 individuals carrying the knockout band were backcrossed with wild-type zebrafish (WT). Once the F1 individuals had grown, tail fin DNA was extracted for genotyping. F1 individuals containing the same mutation type (-56 bp) were mated to obtain F2 individuals. Once the F2 individuals had grown, tail fin DNA was extracted for genotyping, and heterozygotes (dhrs11b.1) were screened out. + / - ) and homozygotes (dhrs11b.1) - / - Individual (see) Figure 6 , Figure 7 Finally, homozygous males and females were mated and propagated to obtain dhrs11b.1. - / - The homozygous population F3 was used for subsequent functional testing.
[0052] The primers used for genotyping are as follows (as shown in SEQ ID No:11~SEQ ID No:12 in sequence): dhrs11b.1-F:GTGCTTGATCTAGACTTGAG; dhrs11b.1-R: CATCCTCTACTGAAAGATCAC.
[0053] 3.3 Validation of hypoxia tolerance in dhrs11b.1 knockout homozygous zebrafish To reduce individual variability and improve experimental uniformity, juvenile zebrafish with a 5-day feeding period were selected for the hypoxia stress experiment. Wild-type zebrafish (WT, dhrs11b.1) were used. + / + ) and mutant zebrafish (KO, dhrs11b.1) - / - Sixty juvenile fish from each group were placed in separate containers in the same body of water. Nitrogen gas was first introduced to lower the dissolved oxygen level to 2 mg / L. Then, the nitrogen introduction rate was controlled to slowly lower the dissolved oxygen level to 0.1 mg / L after 1 hour and maintain this level. The status and survival rate of the juvenile fish in each group were recorded at 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, and 6 hours after treatment. Results are as follows: Figure 8As shown in Table 3, at the same time point (dissolved oxygen), the number of dead individuals in the KO group was greater than that in the WT group. At 6 h, all individuals in the KO group had died, while over 40% (25 / 60) of the WT group remained alive. This indicates that the deletion of the dhrs11b.1 gene significantly reduces the hypoxia tolerance of zebrafish, thus confirming that normal expression of dhrs11 is essential for zebrafish to maintain hypoxia tolerance.
[0054] Table 3: Status and Mortality of Fish Fry
[0055] The above experiments collectively demonstrate that there is a direct causal regulatory relationship between the expression level of the Dhrs11 gene family and the hypoxia tolerance potential of fish. By regulating the expression of this gene, targeted alterations in hypoxia tolerance potential can be achieved in different fish species.
[0056] LOC125249622 CDS (XM_048161947.1) is as shown in SEQ ID NO:13: ATGGATCGCTGGAAAGGCAGGGTTGCTCTTGTCACTGGTGCTTCAGTGGGAATCGGAGCTGCAATCGCAAAGTCTCTTGTGCAGCATGGCATGAAGGTGGTCGGATGTGCCAGAAATGTGAAGCAAATTGAGAATTTGGCAGCAGAATGTGTCAGTAGTGGATTCAGTGGCACTCTGTTCCCGTATAAATGTGATCTGTCTGTAGAAGAGGAAGTGTTATCCATGTTCTCCTGGATAAAAGTTCAACATCAGGGCATTGACGTGTGCATTAATAATGCTGGTTTGGCTCTTCCAGAGCCTCTGCTGAGTGGTAAAACCAGTGGCTGGAAGACTATGATGGATGTGAATGTCATTGGCCTGTCAGTGTGTACCCGTGAGGCTTACCAGTCCATGAAAGAAAGAAAAGTTGATGATGGCCACATCATTAATATTAACAGTATTTGTGGACACCGGGTCATCAACAACGCCAATGCACACTTCTACACCGCCAGCAAATATGCCGTGACTGCTCTCACTGAAGGTCTGCGACAAGAGTTACGCGAGGCCAAAACTCACATACGTGCCACAGGTATATCTCCTGGTTTAGTGGAGACAGAATTTGCCTACCGGCTCTTTAGTCAAAACCCAGAAATAGCTGTGGCTACGTACAAAAGTATAAAGTGCCTGCAAGCAGCTGACATAACCGACGCAGTGGTGTATGTCCTCAGTGCTCCTCCTCATGTTCAAATTGGTGACATTGAGATAACGCCCGTTGAGCAGACGATGTAA。
[0057] The CDS (NM_001002143.2) of zebrafish dhrs11b.1 is as shown in SEQ ID NO:14: ATGGATCGCTGGAAAGGCAGAGTTGCTCTTGTCACTGGAGCTTCAGTAGGAATAGGAGCTGCAATCGCAAAAGCTCTTGTCCAGCATGGCATGAAGGTGGTCGGATGTGCCAGAAATGTGGAGCAAATAGAGAAACTGGCGGCTGAATGTGTCAGTGGCGGATACAGCGGTGCTCTGTTTCCATATAAATGTGATCTTTCAGTAGAGGATGAAGTTTTGTCCATGTTCTCCTGGATTAAGGCTCAACATAAGGGTGTTGATGTGTGCATTAATAATGCTGGTTTAGCTCTGCCAGAGCCTCTGTTGAACGGCAAAGCCAGCGGCTGGAGGACTATGATGAACGTGAATGTAATTGGCCTGTCATTGTGCACCCGTGAGGCTTTCCAGTCCATGAAAGAAAGAAATATTGATGATGGCCATATCATTAATATTAACAGTATGTCTGGGCATCGGGTTGTAAACAGTGCCTATACACACTTCTACACCGCTACTAAATACGCAGTGACTGCTCTCACCGAAGGTTTGAGGCAAGAGTTACGAGAGGCCAAAACCCACATACGTGCCACAAGTATATCCCCTGGTTTAGTGGAGACAGAATTTGCCTACAGACTCTTTAGTGAAAACCAAGACAAGGCTTCTGCCACCTACAAAAGTATAAAGTGCCTGCAGCCAGATGATCTAGCAAATGCAGTGGTTTATGTCCTAAGTGCTCCTCCTCATGTTCAAATTGGTGACATTCAGATGAGACCTGTGGAACAGCTGACATAA。
[0058] The CDS of zebrafish dhrs11b.2 (NM_001002696.2) is as shown in SEQ ID NO:15: .
[0059] Example 2 This embodiment provides a method for specifically improving the hypoxia tolerance potential of blunt snout bream, comprising overexpressing the LOC125249622 gene (its nucleotide sequence is shown in SEQ ID NO:13) in blunt snout bream embryos to obtain blunt snout bream with improved hypoxia tolerance potential. The specific operation steps are as follows: Following the method described in Part 2 of Example 1, the overexpression vector PBLK-ubi-LOC125249622-P2A-mcherry was constructed, and transposase mRNA was prepared. The overexpression plasmid and transposase mRNA were co-injected into 1-cell stage embryos of blunt snout bream via microinjection. mCherry-positive individuals (Tg) were obtained through fluorescence screening, indicating blunt snout bream with enhanced hypoxia tolerance. The hypoxia tolerance test results in Part 2 of Example 1 showed that the dissolved oxygen concentration at the first surface of the surface of the overexpressing blunt snout bream was significantly lower than that of the wild-type blunt snout bream, confirming that its hypoxia tolerance potential was effectively improved.
[0060] Example 3 This embodiment provides a method for constructing a model for studying the hypoxia tolerance potential of fish, including knocking out the dhrs11b.1 gene in zebrafish (its nucleotide sequence is shown in SEQ ID NO:14) to obtain a zebrafish model with reduced hypoxia tolerance potential. The specific steps are as follows: Following the method described in Part 3 of Example 1, two sgRNAs targeting exon 1 of the zebrafish dhrs11b.1 gene (sg1 sequence as shown in SEQ ID NO:9, sg2 sequence as shown in SEQ ID NO:10) were designed. After in vitro transcription, they were incubated with Cas9 protein to form an RNP complex, which was then microinjected into zebrafish 1-cell stage embryos. After F0 selection, backcrossing, F1 self-crossing, and F3 propagation, dhrs11b.1 was obtained. - / - Homozygous zebrafish model. The hypoxia tolerance experiment in Part 3 of Example 1 shows that the hypoxia tolerance of zebrafish in this model is significantly reduced, and it can be used for the study of the molecular mechanism of hypoxia tolerance in fish and for the screening and evaluation of hypoxia-related drugs or breeding programs.
Claims
1. A method for directionally altering the hypoxia tolerance potential of fish based on Dhrs11, characterized in that, The method includes altering the hypoxia tolerance potential of fish by regulating the expression level of the Dhrs11 gene or the activity of the Dhrs11 protein. The regulation refers to: overexpressing the Dhrs11 gene in the fish through genetic engineering, thereby increasing the fish's hypoxia tolerance potential; or knocking out or knocking down the Dhrs11 gene in the fish through genetic engineering, thereby reducing the fish's hypoxia tolerance potential.
2. The method according to claim 1, characterized in that, The fish in question is either blunt snout bream or zebrafish.
3. The method according to claim 2, characterized in that, The fish species is blunt snout bream, and the Dhrs11 gene is the LOC125249622 gene, the nucleotide sequence of which is shown in SEQ ID NO:
13.
4. The method according to claim 3, characterized in that, The method includes: constructing an overexpression vector containing the LOC125249622 gene coding sequence, introducing it into blunt snout bream embryos, and screening for positive individuals to obtain blunt snout bream with improved hypoxia tolerance potential.
5. The method according to claim 2, characterized in that, The fish in question is a zebrafish, and the Dhrs11 gene refers to the dhrs11b.1 gene, whose nucleotide sequence is shown in SEQ ID NO:
14.
6. The method according to claim 5, characterized in that, The method includes: gene editing of zebrafish embryos using sgRNA and Cas9 protein targeting the dhrs11b.1 gene to obtain zebrafish with the dhrs11b.1 gene knocked out, wherein the target sequence of the sgRNA is as follows: sg1:5'-ACTGGAGCTTCAGTAGGAAT-3'; sg2: 5'-GGTCGGATGTGCCAGAAATG-3'.