Method for efficient production of human selenoprotein p by microalgae

Abstract

The application discloses a method for efficiently synthesizing human selenium protein P by using microalgae, and belongs to the field of bioengineering. The method is aimed at the problem that the low translation read-through efficiency of heterologous expression is caused by the multiple UGA stop codons in human selenium protein P containing 10 selenocysteine. The method comprises the following steps: performing codon optimization on a nucleotide sequence coding human selenium protein P according to the codon preference of Chlamydomonas reinhardtii; constructing a multi-copy expression vector containing two tandem expression frames, each of which is composed of a HSP70A-RBCS2 strong promoter, an optimized target gene and a terminator; transforming Chlamydomonas reinhardtii, screening a recombinant algal strain; culturing and adding a selenium source to induce expression, collecting the algal strain and purifying the same. The application realizes the expression of the full sequence of human selenium protein P containing 10 selenocysteine in Chlamydomonas reinhardtii for the first time, the obtained protein has correct Sec incorporation and glycosylation modification, and Chlamydomonas reinhardtii has low culture cost and no endotoxin, and is suitable for food-grade or medical-grade recombinant protein production.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology. More specifically, this invention relates to a method for the efficient synthesis of human selenoprotein P by microalgae. Background Technology

[0002] Selenium (Se) is an essential trace element for the human body. Selenium primarily exerts its biological functions in the human body in the form of selenoproteins, of which 25 have been identified to date. Selenoproteins are a class of special proteins containing selenocysteine ​​(Sec), serving as the core carriers for the biological functions of selenium in the human body. During selenoprotein synthesis, selenocysteine ​​is encoded by the UGA codon (usually a stop codon), and a specific Sec insertion sequence (SECIS) on the mRNA works in conjunction with the SECIS-binding protein SBP2 to insert the selenocysteine ​​into the polypeptide chain. Selenoproteins can safely and efficiently perform specific biological functions in vivo, making them an excellent source of selenium for human supplementation. Unfortunately, selenoproteins are not found in higher plants and fungi, limiting their natural food sources. Currently, selenoproteins are mainly found in microalgae, humans, and animals. Microalgae naturally possess a diverse selenoprotein genome, making them ideal carriers for heterologous expression of selenoproteins. *Chlamydomonas reinhardtii* (…) Chlamydomonas reinhardtii Chlamydomonas reinhardtii is a single-celled edible microalga containing 10 selenoproteins, and its selenoprotein synthesis mechanism is highly similar to that of animals. Furthermore, Chlamydomonas reinhardtii possesses glycosylation modifications similar to those found in mammals, making it a potential platform for the production of certain human-compatible bioproducts.

[0003] Human selenoprotein P (SelP) is an important selenoprotein found in blood plasma, primarily synthesized in the liver and secreted into the bloodstream. It is a crucial indicator for detecting selenium levels in the human body. Its unique structure involves each polypeptide chain containing 10 selenocysteine ​​(Sec) residues, one located in the redox motif at the N-terminus and the remaining nine concentrated in the C-terminus. Sec is encoded by the UGA codon and typically serves as a termination signal; therefore, SelP translation requires the synergistic regulation of specific SECIS elements and various trans-acting factors. Selenoprotein P functions in transporting and storing selenium, antioxidation, and participation in sperm maturation and development. Functionally, SelP has a dual physiological role: on one hand, it exerts glutathione peroxidase-like activity through its N-terminal domain, reducing phospholipid hydroperoxides and providing antioxidant defense; on the other hand, as a selenotransferase, it delivers selenium from the liver to target tissues such as the brain and testes, maintaining selenium homeostasis. SelP deficiency leads to selenoprotein dysfunction and oxidative stress-related impairments.

[0004] In heterologous synthesis, the large number of UGA stop codons in SelP mRNA leads to extremely low translation readout efficiency, posing a long-standing challenge to recombinant protein expression. Several patents have attempted to address this issue. One existing technology is Chinese patent application CN1314469A, "Method for Expression and Purification of Recombinant Human Selenoprotein P Gene and Specific Primers and Culture Medium." This technology amplifies the human selenoprotein P gene using PCR, clones it into an E. coli expression vector, induces expression in a culture medium containing sodium selenite and selenium-enriched yeast extract, and purifies it using nickel affinity chromatography, laying the foundation for large-scale production of human selenoprotein P. Furthermore, studies have also prepared selenoprotein P mutants by constructing mutant engineered strains. These mutants can induce apoptosis in liver cancer cells and increase the opening level of liver mitochondrial membrane permeability transport pores, showing potential application value in cancer treatment.

[0005] However, the aforementioned background technologies still have several problems and shortcomings: First, the *E. coli* prokaryotic expression system lacks the post-translational modifications specific to eukaryotes, making it impossible to correctly achieve SelP glycosylation, which may affect the protein's folding state and biological activity. Second, due to the lack of a mammal-specific SECIS recognition system in the prokaryotic system, Sec incorporation efficiency is low, making it difficult to obtain full-length, correctly selenium-containing active proteins. Third, although nickel affinity purification can obtain preliminary purified products, the problems of host protein residue and endotoxin contamination are difficult to effectively solve, limiting its application in clinical treatment. Therefore, developing a eukaryotic expression system suitable for efficient expression of human SelP with correct post-translational modifications remains an urgent problem to be solved. Summary of the Invention

[0006] The purpose of this invention is to provide a method for the efficient synthesis of human selenoprotein P from microalgae, addressing the shortcomings of existing technologies for expressing human selenoprotein P, such as low synthesis yield and post-translational modification mismatches. This invention utilizes the eukaryotic host *Chlamydomonas reinhardtii* to produce human selenoprotein P with correct post-translational modifications, providing a superior technical solution for related research and applications.

[0007] To achieve these objectives and other advantages of the present invention, a method for efficient synthesis of human selenoprotein P from microalgae is provided, wherein the human selenoprotein P contains 10 selenocysteine ​​residues, and the method comprises the following steps: S1. Based on the codon preference of Chlamydomonas reinhardtii, the nucleotide sequence encoding the human selenoprotein P is codon optimized to obtain the optimized HsSelP gene sequence, wherein the HsSelP gene sequence contains a 3′-UTR region, and the 3′-UTR region contains a selenocysteine ​​insertion sequence element. S2. Construct a multi-copy expression vector containing two tandem expression frames. Each expression frame consists of an HSP70A-RBCS2 strong promoter, the optimized HsSelP gene sequence, and a terminator. The gene sequence of the expression frame is shown in SEQ ID NO: 3. S3. The multi-copy expression vector was transformed into Chlamydomonas reinhardtii, and recombinant Chlamydomonas reinhardtii strains capable of expressing human selenoprotein P were screened to obtain them. S4. The recombinant Chlamydomonas reinhardtii strain was cultured, and a selenium source was added to the culture medium to induce the expression of human selenoprotein P. S5. Collect the cultured recombinant Chlamydomonas reinhardtii strain and isolate and purify human selenoprotein P from it.

[0008] Preferably, the codon optimization parameters of the gene encoding the human selenoprotein P are: GC content greater than 65% and codon fitness index greater than 0.9; The optimized HsSelP gene sequence is shown in SEQ ID NO: 2.

[0009] Preferably, the transformation in step S3 is performed using the glass bead method; the screening includes screening using hygromycin resistance markers.

[0010] Preferably, in step S4, the selenium source is sodium selenite, and the amount added to the culture medium is 0.5~10 mg / L.

[0011] Preferably, in step S4, the culture medium used for the culture is T10 basal medium, which contains: NH4CH3CO2 2~4 g / L, KH2PO4 4~6 g / L, MgSO4•7H2O 0.5~2 g / L, Ca(NO3)2 0.05~0.1 g / L, FeSO4•7H2O 80~150 mg / L, yeast extract 3~8 g / L, and trace elements. The trace elements are added to the T10 basal medium in the form of a 1000× concentrate, and the amount of the 1000× concentrate added to the T10 basal medium is 0.5~2 mL / L. The 1000× concentrate contains: disodium ethylenediaminetetraacetate 100 g / L, zinc sulfate heptahydrate 44 g / L, boric acid 22 g / L, manganese chloride tetrahydrate 10 g / L, and cobalt chloride hexahydrate 3.2 g / L. g / L, copper sulfate pentahydrate 3.2 g / L and sodium molybdate tetrahydrate 2.2 g / L; The cultivation conditions are: temperature 25~30℃, light intensity 50~100 µmol / (m²). 2 •s), rotation speed 100-500 rpm, culture for 5-10 days.

[0012] Preferably, in step S4, the culture includes a fed culture step, wherein the fed culture uses a fed-batch culture medium and is automatically fed through pH feedback control.

[0013] Preferably, the fed-batch culture medium comprises: KH2PO4 10~20 g / L, MgSO4•7H2O 5~15 g / L, Ca(NO3)2 0.1~0.3 g / L, NH4CH3CO2 50~100 g / L, and acetic acid with a volume fraction of 50%.

[0014] The present invention also provides human selenoprotein P prepared by the above method.

[0015] The present invention also provides a recombinant Chlamydomonas reinhardtii strain for producing human selenoprotein P, wherein the recombinant Chlamydomonas reinhardtii strain is prepared by the method described above.

[0016] The present invention also provides the application of a recombinant Chlamydomonas reinhardtii strain in the production of human selenoprotein P or in the preparation of products containing human selenoprotein P, wherein the recombinant Chlamydomonas reinhardtii strain is prepared by the above-described method or is the above-described recombinant Chlamydomonas reinhardtii strain.

[0017] The present invention has at least the following beneficial effects: 1. For the first time, human selenoprotein P containing 10 sec was expressed in Chlamydomonas reinhardtii; 2. Multiple copies of the human selenoprotein P gene were integrated into Chlamydomonas reinhardtii strains, significantly increasing its expression level; 3. The human selenoprotein P expressed by Chlamydomonas reinhardtii has Sec incorporation and glycosylation modification, and its biological activity is close to that of the natural protein; 4. Chlamydomonas reinhardtii has been approved as a new food ingredient. It has low cultivation costs, no endotoxins, and is easy to scale up, making it suitable for food-grade or pharmaceutical-grade protein production.

[0018] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0019] Figure 1 Map of the human selenoprotein P expression vector constructed in this invention; Figure 2 This is a chromatogram of PCR identification results for different transgenic Chlamydomonas reinhardtii strains in this invention; Figure 3 A comparison table of Ct values ​​for quantitative PCR of different transgenic Chlamydomonas reinhardtii strains in this invention; Figure 4 This is a comparison diagram of the relative expression levels of the HsSelP gene in different transgenic Chlamydomonas reinhardtii strains in this invention; Figure 5 The results of Western blot analysis of the transgenic Chlamydomonas reinhardtii strains HsSelP-6 and HsSelP-7 in this invention; Figure 6 The results of HsSelP protein proteomic analysis of transgenic Chlamydomonas reinhardtii expressed in this invention; Figure 7 This is a biomass curve of transgenic Chlamydomonas reinhardtii fermented in a 50 L fermenter for 7 days in this invention; Figure 8 This is a graph showing the expression level of HsSelP protein in transgenic Chlamydomonas reinhardtii fermented in a 50 L fermenter for 7 days. Detailed Implementation

[0020] The present invention will now be described in further detail with reference to the accompanying drawings, so that those skilled in the art can implement it based on the description.

[0021] It should be noted that, unless otherwise specified, the experimental methods described in the following implementation plan are all conventional methods, and the reagents and materials described are all commercially available unless otherwise specified.

[0022] Example 1: Construction of a human selenoprotein P expression vector 1) Optimization of P codon for human selenoprotein The CDS sequence (1146 bp) and its 3'-UTR sequence of the human selenoprotein P gene (GenBank: NM_001085486.3) were downloaded from NCBI, as shown in SEQ ID NO: 1. The 3'-UTR sequence contains two SECIS elements, located at positions 1398 to 1477 and 1839 to 1904 in SEQ ID NO: 1, respectively. Based on the codon usage preferences of *Chlamydomonas reinhardtii* (refer to the codon usage frequency table for *Chlamydomonas reinhardtii* in the Codon Usage Database), the CDS sequence was codon optimized with the following parameters: GC > 65%, CAI > 0.9. The optimized human selenoprotein P gene (HsSelP) is shown in SEQ ID NO: 2 (containing the CDS and 3'-UTR).

[0023] 2) Construction of human selenoprotein P expression vector The SEQ ID NO: 2 sequence was synthesized by Nanjing GenScript Biotech Co., Ltd. Since the HsSelP gene sequence lacks NdeI, EcoRI, SpeI, and MluI restriction sites, the synthesized sequence was constructed into the Chlamydomonas reinhardtii expression vector pOpt2_Clover_Hyg (purchased from Newp Biotech Co., Ltd., catalog number: V004221) using the NdeI and EcoRI restriction sites. The constructed vector was named HsSelP-pOpt2.

[0024] The HsSelP-pOpt2 vector was double-digested with SpeI and MluI restriction enzymes, and the linearized vector backbone was recovered. Using the HsSelP-pOpt2 vector as a template, PCR amplification was performed using primers with homologous arm sequences, and the expression cassette was recovered. PHSP70A-RBCS2 : HsSelP The -3′UTR sequence (2910 bp in total, as shown in SEQ ID NO: 3) was amplified with homologous arms at the 5′ and 3′ ends of the primers, respectively, identical to the sequences upstream of the SpeI site and downstream of the MluI site in the vector. The 5′ homologous arm was: gctgggcgtatttgaagcgactagt; the 3′ homologous arm was: acgcgtgctgaggcttgacatgatt. The linearized vector backbone and expression cassette DNA fragment were mixed at a molar ratio of 1:3, and homologous recombinase (homological recombination cloning kit provided by Nanjing GenScript) was added. The mixture was incubated at 50°C for 30 min. The reaction product was transformed into E. coli DH5α competent cells, plated on LB agar plates containing the appropriate antibiotics, and cultured overnight at 37°C. Single clones were picked for PCR identification and sequencing verification to obtain the correctly sequenced 2× HsSelP-pOpt2 vector ( Figure 1 The construction and sequencing validation of the above vectors were completed by Nanjing GenScript Biotech Co., Ltd.

[0025] Example 2: Screening and identification of Chlamydomonas reinhardtii strains with high expression of selenoprotein P 1) Glass bead method for the transformation of Chlamydomonas reinhardtii Genetic transformation of Chlamydomonas reinhardtii CC849 (cell wall defect type) was carried out using the "bead milling method". The specific steps are as follows: ① Soak an appropriate amount of 0.2~0.3 mm glass beads in anhydrous ethanol overnight, then dry them in an oven at 100℃ for 5 h. Dispense 0.3 mg per EP tube, seal the tube caps with tin foil, sterilize under high temperature and high pressure, and then dry for later use.

[0026] ② Chlamydomonas reinhardtii was cultured in TAP medium under continuous light until the cells reached the logarithmic growth phase (cell number was (1~2)×10⁻⁶). 6(cells / mL), take 50 mL of logarithmic phase algal solution, centrifuge at 3000~4000 rpm at room temperature for 5 min, discard the supernatant, and collect algal cells.

[0027] ③ Resuspend the algal cells in 1 mL of sterile TAP culture medium and adjust the algal cell concentration to 2 × 10⁻⁶. 8 cells / mL.

[0028] ④ Add 500 μL of algal cell suspension to a 1.5 mL EP tube containing the glass beads prepared in step ①. Then add 1 μg of 2× HsSelP-pOpt2 linearized plasmid digested with PciI (NEB, R0655S) (Table 1).

[0029] Table 1. Linearization and restriction enzyme digestion of 2× HsSelP-pOpt2 plasmid reagents volume PciI 2 μL 2× HsSelP-pOpt2 plasmid 1 μg 10× NEBuffer™ r3.1 2 μL <![CDATA[ddH2O]]> Add to 20 μL The linearized enzyme digestion reaction system of 2× HsSelP-pOpt2 plasmid was incubated at 37°C for 1 h, and then incubated at 80°C for 20 min to inactivate the enzyme. The linearized plasmid was stored at -20°C for later use.

[0030] ⑤ Place the 1.5 mL EP tube containing the algal cell / linearized plasmid / glass bead mixture on a shaker and shake thoroughly at the highest speed for 20-25 s.

[0031] ⑥ Take 10 mL of fresh TAP medium into a 50 mL centrifuge tube, transfer the mixture from the EP tube to the centrifuge tube, mix gently, place on a shaker at 100 rpm under low light, and incubate overnight at 22°C to allow the algal cells to recover.

[0032] ⑦ The next day, centrifuge at 3000 rpm for 5 min at room temperature, collect the algal cells, and discard the supernatant.

[0033] ⑧ Gently resuspend the cells in 500 μL of fresh TAP culture medium, mix gently, and then spread them onto a TAP solid plate containing 20 mg / L hygromycin. Incubate upside down in a 22 ℃ light incubator for about 3 weeks, until green single colonies appear.

[0034] ⑨ Remove the monoclonal algal cells that have grown on the plate with an inoculation loop, expand the culture on a solid TAP plate containing 20 mg / L hygromycin using the streak method, and select stable monoclonal transformants for liquid culture.

[0035] 2) DNA level identification of transgenic algal strains Single algal colonies were picked and inoculated into sterile TAP liquid medium containing hygromycin, with a photocycle of 16 h light / 8 h dark (light intensity 100 µmol / (m²)). 2•s), cultured at 150 rpm for 5 days. Genomic DNA was extracted from each positive clone using the Plant DNA Extraction Kit (Solarbio; DM1500) according to the manufacturer's instructions. 1 μL of genomic DNA was used as a template, and PCR verification was performed using HsSelP-F and HsSelP-R primers. The amplified band size was approximately 400 bp. HsSelP-F: 5'-GCGTATTTGAAGCGACTAGTGC-3'; HsSelP-R: 5'-CATGCGAACTGCTTGCATTG-3'. The PCR reaction system is shown in Table 2.

[0036] Table 2. PCR reaction system (20 μL) Components Volume (μL) 2× SuperTaq PCR StarMix 10 HsSelP-F 1 HsSelP-R 1 DNA template 2 <![CDATA[ddH2O]]> 6 PCR reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 55℃ annealing for 30 s; 72℃ extension for 30 s; 40 cycles; 72℃ extension for 5 min. After the PCR reaction, electrophoresis was performed using a 1% agarose gel. PCR identification results are as follows: Figure 2 As shown, M represents the marker band, CC849 is the wild-type Chlamydomonas reinhardtii, and numbers 1 to 7 are the identified transgenic Chlamydomonas reinhardtii strains. Among them, strains 1, 2, 4, 5, 6, and 7 can amplify bands of about 400 bp. These results indicate that the HsSelP gene exists in the above 6 transgenic Chlamydomonas reinhardtii strains.

[0037] 3) Identification of RNA and protein levels in transgenic algal strains ① Identification of RNA levels in transgenic algal strains Total RNA was extracted from the six transgenic Chlamydomonas reinhardtii strains and the wild-type CC849 using the Plant Tissue Total RNA Extraction Kit (TIANGEN; DP454) according to the manufacturer's instructions. RNA concentration was determined using NanoDrop and then stored at -80°C for later use. The extracted RNA was reverse transcribed into cDNA using the FastKing cDNA First-Strand Synthesis Kit (TIANGEN; KR116) according to the manufacturer's instructions. The synthesized cDNA was stored at -20°C for later use.

[0038] The expression level of the target gene was detected using SuperReal PCR premixed reagent enhanced version (SYBR Green) (TIANGEN; FP205) fluorescent dye, with Actin as an internal control (RT-Actin-F: ACCCGTGCTGCTGACTG; RT-Actin-R: ACGTTGAAGGTCTCGAACA). The primers for HsSelP gene quantitative PCR were RT-HsSelP-F: GAAGGAGGGCTACAGCAACA; RT-HsSelP-R: TGCTCGCTCACCTTGTTCTT. The quantitative PCR reaction system is shown in Table 3.

[0039] Table 3. Quantitative PCR reaction system (20 μL) reagents volume 2×SuperReal PreMix Plus 10 μL Primer F 1 μL Primer R 1 μL cDNA 2 μL <![CDATA[RNase-free ddH2O]]> 6 μL Quantitative PCR reaction conditions: 95℃ pre-denaturation for 15 min; 95℃ denaturation for 10 s; 60℃ annealing and amplification for 30 s; 40 cycles. Melting curve settings: 95℃ for 15 s; 60℃ for 60 s; 95℃ for 15 s. The mRNA expression of the human selenoprotein P gene in different transgenic algae was detected by quantitative PCR. The average Ct values ​​of each transgenic algal strain are shown below. Figure 3 As shown. Using the algal strain with the lowest HsSelP mRNA expression level as a control, the relative expression levels of the HsSelP gene in each transgenic algal strain are shown in the figure. Figure 4 As shown, the HsSelP expression level was highest in the HsSelP-7 algal strain.

[0040] ② Identification of protein levels in transgenic algal strains In a clean bench, 5 mL of seed culture was inoculated into 100 mL of fresh TAP liquid medium containing hygromycin, with a photocycle of 16 h light / 8 h dark (light intensity 100 µmol / (m²)). 2 •s), cultured at 150 rpm for 5 days. Then, centrifuged at 6000 rpm for 5 min to collect algal cells. Added 1 mL of protein lysis buffer (containing 10 μL PMSF), incubated at 4℃ for 30 min, inverting the centrifuge tube several times every 10 min during incubation to fully lyse the algal cells. Centrifuged at 12000 rpm for 10 min at 4℃, and collected the supernatant as the total protein sample. Added an appropriate amount of SDS Sample Buffer (4×) to the supernatant protein sample to make the working concentration 1×, mixed well, incubated in a metal bath at 100℃ for 5 min, and stored at -80℃ for later use.

[0041] Protein gels were prepared using the One-Step PAGE Gel Fast Preparation Kit (Vazyme; E303-01), and then used for Western blot experiments. The protein gel was fixed on an electrophoresis rack and placed in the electrophoresis tank. An appropriate amount of electrophoresis buffer was poured in, and the comb was gently pulled vertically out of the gel. Samples were added to the comb wells in the pre-set loading order. After loading, the cap was closed, and the power was turned on. The stacking gel was run at 80 V for 30 min, and the separating gel at 120 V for 60 min. After electrophoresis, a wet transfer was performed. After the transfer, the membrane was removed from the sandwich and washed in PBS for 5 min. It was then transferred to an automated Western blot hybridization instrument. Appropriate primary antibody, secondary antibody, and washing buffer were added to the corresponding sample wells of the hybridization instrument. The appropriate program was selected, and the process was started. Exposure was performed after the run was complete. Equal volumes of ECL chemiluminescence solution A and solution B were mixed and stored in the dark for later use. Remove the membrane from the PBS, blot off excess water with filter paper, place it on the exposure stage with the protein side facing up, and cover the entire membrane with the mixed chemiluminescence solution. Expose the membrane using a fully automated chemiluminescence imaging system (Tanon; Tanon 5200). The antibodies used for Western blotting were His-Tag Monoclonal antibody (Proteintech; 66005-1-Ig) and Anti-Actin (Abclonal; AC009), and the secondary antibody was HRP Goat Anti-Mouse IgG (Abclonal; AS003).

[0042] Western blot analysis results of transgenic algal strains are as follows: Figure 5 As shown, His-specific bands were detected in the total protein samples of transgenic algae strains HsSelP-6 and HsSelP-7, and their size (~50 kDa) was consistent with expectations. No specific bands were observed in the negative control CC849.

[0043] To further determine the accuracy of the amino acid sequence of HsSelP protein expressed in *Chlamydomonas reinhardtii*, LC-MS / MS was used for amino acid sequence identification. The extracted total protein was run on an SDS-PAGE gel, stained with Coomassie Brilliant Blue, and the target band of approximately 50 kDa was completely excised from the gel using a clean blade. The excised strip was then sent at low temperature to Wuhan Boyuan Biotechnology Co., Ltd. for subsequent mass spectrometry identification. The mass spectrometry results are as follows: Figure 6As shown, the yellow highlighted portion represents the amino acid sequence identified by mass spectrometry, and the red letter U represents selenocysteine. Glycosylation modification detection revealed that the HsSelP protein expressed by Chlamydomonas reinhardtii mainly forms Man4–5GlcNAc2 type N-glycan chains at the N-glycosylation sites of N83, N119, and N174, which is basically consistent with the N-glycosylation modifications of N83 and N174 of the human-expressed HsSelP protein.

[0044] Example 3: Fermentation of transgenic Chlamydomonas reinhardtii strain 1) Optimization of fermentation medium and culture conditions The T10 basal medium formulation was used for initial culture, and its formulation was as follows: NH4CH3CO2 3 g / L, KH2PO4 5 g / L, MgSO4•7H2O 1 g / L, Ca(NO3)2 0.08 g / L, FeSO4•7H2O 110 mg / L, yeast extract 5 g / L, and trace elements 1×. The trace elements were added to the T10 basal medium in the form of a 1000× concentrate, and the amount of the 1000× concentrate added to the T10 basal medium was 1 mL / L. The 1000× concentrate contained: disodium ethylenediaminetetraacetate 100 g / L, zinc sulfate heptahydrate 44 g / L, boric acid 22 g / L, manganese chloride tetrahydrate 10 g / L, cobalt chloride hexahydrate 3.2 g / L, copper sulfate pentahydrate 3.2 g / L, and sodium molybdate tetrahydrate 2.2 g / L. The pH was adjusted to 6.5 using NaOH aqueous solution, and then autoclaved at 121°C for 60 min. T10 fed-batch medium was used for fed culture; this medium was automatically added based on pH feedback (automatically fed when pH > 6.5) to replenish consumed nutrients and maintain pH. The T10 fed-batch medium formulation was: KH₂PO₄ 15 g / L, MgSO₄•7H₂O 10 g / L, Ca(NO₃)₂ 0.24 g / L, NH₄CH₃CO₂ 77 g / L. ddH₂O was added to 500 mL, and then autoclaved at 121°C for 30 min. In a clean bench, 500 mL of anhydrous acetic acid was added to bring the final volume to 1 L. The culture conditions were: temperature 28°C, light intensity 50 µmol / (m²). 2 •s), rotation speed 150 rpm, culture for 7 days.

[0045] 2) Fermentation of transgenic Chlamydomonas reinhardtii strain The engineered Chlamydomonas reinhardtii strain expressing high levels of HsSelP was inoculated into 500 mL of sterile TAP liquid medium, with a photocycle of 16 h light / 8 h dark (light intensity 100 µmol / (m²)). 2•s), cultured at 150 rpm for 5 days. 30 L of T10 basal medium was autoclaved at 121°C for 60 min in a 50 L fermenter and cooled to room temperature. The 5-day-old transgenic *Chlamydomonas reinhardtii* culture was inoculated into the 50 L fermenter using flame inoculation, simultaneously adding filtered and sterilized Na₂SeO₃ solution to achieve a final Na₂SeO₃ concentration of 2 mg / L. Fermentation was then carried out under the following conditions: temperature 28°C, light intensity 50 µmol / (m²). 2 •s), 150 rpm, cultured for 7 days. During culture, T10 fed-batch medium was used, with automatic feeding via pH feedback (automatic feeding when pH > 6.5) to replenish consumed nutrients and maintain pH. Samples were taken every one day, centrifuged, and weighed to determine Chlamydomonas reinhardtii biomass. HsSelP protein expression was detected using an ELISA kit (Abcam; ab303751). Results are as follows: Figures 7-8 As shown, the biomass of Chlamydomonas reinhardtii after 7 days of fermentation in a 50 L fermenter can reach 72.34 g / L (fresh weight), with a corresponding HsSelP protein content of 643.93 μg / L.

[0046] SEQ ID NO: 1 SEQID NO: 2 SEQID NO: 3 Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. A method for synthesizing human selenoprotein P from microalgae, characterized in that, The human selenoprotein P contains 10 selenocysteine ​​residues, and the method includes the following steps: S1. Based on the codon preference of *Chlamydomonas reinhardtii*, the nucleotide sequence encoding the human selenoprotein P is codon-optimized to obtain the optimized sequence. HsSelP Gene sequence, the HsSelP The gene sequence contains a 3′-UTR region containing a selenocysteine ​​insertion sequence element; S2. Construct a multi-copy expression vector, wherein the multi-copy expression vector contains two tandem expression frames, each of which is composed of the HSP70A-RBCS2 strong promoter and the optimized [expression frame name missing]. HsSelP The expression cassette consists of a gene sequence and a terminator, and the gene sequence of the expression cassette is shown in SEQ ID NO: 3; S3. The multi-copy expression vector was transformed into Chlamydomonas reinhardtii, and recombinant Chlamydomonas reinhardtii strains that could express human selenoprotein P were screened to obtain them. S4. The recombinant Chlamydomonas reinhardtii strain was cultured, and a selenium source was added to the culture medium to induce the expression of human selenoprotein P. S5. Collect the cultured recombinant Chlamydomonas reinhardtii strain and isolate and purify human selenoprotein P from it.

2. The method for synthesizing human selenoprotein P from microalgae as described in claim 1, characterized in that, The transformation in step S3 is performed using the glass bead method; the screening includes screening using hygromycin resistance markers.

3. The method for synthesizing human selenoprotein P from microalgae as described in claim 1, characterized in that, In step S4, the selenium source is sodium selenite, and its addition amount in the culture medium is 0.5~10 mg / L.

4. The method for synthesizing human selenoprotein P from microalgae as described in claim 1, characterized in that, In step S4, the culture medium used is T10 basal medium, which contains: NH4CH3CO2 2~4 g / L, KH2PO4 4~6 g / L, MgSO4•7H2O 0.5~2 g / L, Ca(NO3)2 0.05~0.1 g / L, FeSO4•7H2O 80~150 mg / L, yeast extract 3~8 g / L, and trace elements. The trace elements are added to the T10 basal medium in the form of a 1000× concentrate, with the concentration of the 1000× concentrate in the T10 basal medium being 0.5~2 mL / L. The 1000× concentrate contains: disodium ethylenediaminetetraacetate 100 g / L, zinc sulfate heptahydrate 44 g / L, boric acid 22 g / L, manganese chloride tetrahydrate 10 g / L, cobalt chloride hexahydrate 3.2 g / L, and copper sulfate pentahydrate 3.2 g / L. g / L and sodium molybdate tetrahydrate 2.2 g / L; The cultivation conditions are: temperature 25~30℃, light intensity 50~100 µmol / (m²). 2 •s), rotation speed 100~500 rpm, culture for 5~10 days.

5. The method for synthesizing human selenoprotein P from microalgae as described in claim 1, characterized in that, In step S4, the culture includes a fed culture step, wherein the fed culture uses a fed culture medium and is automatically fed through pH feedback control.

6. The method for synthesizing human selenoprotein P from microalgae as described in claim 5, characterized in that, The fed-batch culture medium contains: KH2PO4 10~20 g / L, MgSO4•7H2O 5~15 g / L, Ca(NO3)2 0.1~0.3 g / L, NH4CH3CO2 50~100 g / L, and acetic acid with a volume fraction of 50%.

7. A recombinant Chlamydomonas reinhardtii strain for producing human selenoprotein P, characterized in that, The recombinant Chlamydomonas reinhardtii strain is prepared by steps S1 to S3 of the method according to any one of claims 1 to 6.

8. The application of a recombinant Chlamydomonas reinhardtii strain in the production of human selenoprotein P or the preparation of products containing human selenoprotein P, characterized in that, The recombinant Chlamydomonas reinhardtii strain is the recombinant Chlamydomonas reinhardtii strain as described in claim 7.

Images