A SNP molecular marker related to body length of sauries and application thereof

Abstract

This invention discloses a SNP molecular marker related to body length in the angelfish, characterized by being located at base 14,244,957 on chromosome 23 of the angelfish. The sequence of the SNP molecular marker is shown in SEQ ID NO.1, with base C or T at position 301 starting from the 5' end; individuals with genotype CC have significantly longer body lengths than those with genotypes CT or TT. This invention also discloses primers and kits for detecting the SNP molecular marker, and the application of these primers and kits in selecting superior angelfish strains for body length. This invention allows for early screening of angelfish fry, shortening the breeding cycle, improving selection accuracy, and overcoming the limitations of traditional breeding methods that rely on phenotypic dependence.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology for aquatic animals, specifically involving an SNP molecular marker related to the body length of the finned angelfish and its application. Background Technology

[0002] Sharp-finned angelfish ( Platax teira The long-winged angelfish (Siniperca spp.), also known as the long-winged angelfish, is a tropical marine fish belonging to the genus Siniperca in the family Sinipercalidae, order Perciformes, suborder Sinipercae. This fish is characterized by its rapid growth and delicious flesh, making it a marine fish species with significant potential for aquaculture development. In Guangdong, a land-sea relay aquaculture model has been explored for the long-winged angelfish, achieving a weight of 1.2 jin (approximately 0.6 catties) per fish in 6 months, with the entire aquaculture process allowing for the feeding of formulated feed. Given its rapid growth, delicious flesh, and ability to consume formulated feed throughout its lifespan, the long-winged angelfish is one of the potential species suitable for deep-water, wave-resistant cage aquaculture.

[0003] Currently, the breeding of juvenile angelfish relies heavily on wild broodstock or unselected aquaculture populations. The lack of scientific guidance in broodstock mating leads to unstable growth performance and significant individual differences. Traditional phenotypic selection breeding is time-consuming, inefficient, and hinders early precision selection. In recent years, marker-assisted selection (MAG) technology has gradually become the mainstream direction in aquaculture breeding. This method, by associating target phenotypic traits with molecular markers, enables precise screening of superior genotypes and has been widely applied in the genetic improvement of multiple species. As a third-generation molecular marker, SNP markers possess numerous advantages such as high polymorphism, high genetic stability, and convenient detection, and have been applied to the selection of superior growth traits in economically important fish such as oval pomfret and yellowfin seabream. However, current technology lacks research reports on SNP markers for the body length trait of angelfish and their applications. Discovering SNP molecular markers significantly associated with the body length of angelfish and establishing early selection techniques to breed new varieties with superior traits such as rapid growth and high yield is of significant strategic importance for promoting the sustainable and healthy development of the aquaculture industry. Summary of the Invention

[0004] The first objective of this invention is to provide an SNP molecular marker related to the body length of the angelfish.

[0005] The present invention also aims to provide primers or kits for detecting the above-mentioned SNP molecular markers, and a method for breeding superior strains of angelfish with excellent body length.

[0006] The final objective of this invention is to provide the application of the above-mentioned SNP molecular marker primers, kits, and methods in the selection of superior body length strains of the angelfish.

[0007] The first objective of the present invention can be achieved by the following technical solution: a SNP molecular marker related to the body length of the angelfish, located at the 14244957th base of chromosome 23 of the angelfish, with a mutation type of C / T, named SNP_14244957.

[0008] Furthermore, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the 301st base starting from the 5' end of the sequence shown in SEQ ID NO.1 is C or T.

[0009] The nucleotide sequence shown in SEQ ID NO.1 is as follows:

[0010] GCTACACACTCTCTCCTTTTGCACCTGCTGCCCTACTGCTCTCACCCACTGTGCCTTCACTCTTTCACTCTTTCCTCCTTCTCATTCCCTGCCCCCACTACCCATCCCTCTCCCCCTCCACTTCTGCTTTTGTTTCACTTTCCTCATTT CCCCCACTTTGTTTGCTTGTCTCCTCCTTTCTTCAGCTCTGTCACTGTTTTATATACCCCCCACCAGTCCAGTGCTCCTACTGCTTCCTACAGCTTTTTTTTTTTTTCCATTTGTTACTGCTCCATTGCAGCTTCCTGTGTTTGCCATGT N(C / T) CACACTGCATTGCACTTTTTTTCTACCTTCCATTTGCCTCTCCCCCCTCCATGCCTGCACTCTTTAGCTCTTATTTAGCTGTGTTTGCATGCACCCTCCTATTCCTCTTATCCTCAGCCCCCCTCCTCTGTCTATCTGTTGTTGCCATGT TTCACCCCCTATTTGTTCCTATATCTCTTGCTGTACCTTTTGCCCCACTTCTCCCCTTTTGCCATTTCATTCTCCCCATTGTTGCCTTGCCTTTACTAGCCCTTTGTGCTCTATCTATTTCCATCATGTTTCCAGCACTTTACTCTCTTTA

[0011] Furthermore, the SNP molecular marker genotype CC is the preferred genotype, and individuals with this genotype have significantly better body length than individuals with genotypes CT or TT.

[0012] The second objective of the present invention can be achieved by the following technical solution: a primer for detecting the above-mentioned SNP molecular marker, the nucleotide sequence of which is shown in SEQ ID NO.2~4.

[0013] Based on the SNP molecular markers, this invention designs specific primers SNP_14244957RG, SNP_14244957RA, and SNP_14244957F for PCR-specific amplification. The amplification products are read using an enzyme-linked immunosorbent assay (ELISA) reader, and then the fluorescence signals are analyzed and converted to obtain the genotypes of the above-mentioned SNP molecular marker sites in the target angelfish.

[0014] Specifically, the nucleotide sequence of the primer is as follows:

[0015] SNP_14244957RG (SEQ ID NO.2):

[0016] GAAGGTGACCAAGTTCATGCTCAAAGTGCAATGCAGTGTGG;

[0017] SNP_14244957RA (SEQ ID NO.3):

[0018] GAAGGTCGGAGTCAACGGATTCCAAAGTGCAATGCAGTGTGA;

[0019] SNP_14244957F (SEQ ID NO.4):

[0020] CTGCTAAATTGCAGCTTCCTGT.

[0021] The present invention also provides a kit for detecting the above-mentioned SNP molecular markers, which includes the above-mentioned primers.

[0022] Furthermore, the present invention also provides a method for breeding superior strains of the finned angelfish, comprising the following steps:

[0023] (1) Extract DNA from the tail fin of the individual angelfish to be tested;

[0024] (2) The extracted DNA was amplified by PCR using the primers shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 above to obtain PCR amplification products;

[0025] (3) Analyze the fluorescence signal of the PCR amplification product to determine the genotype of the above SNP molecular marker. The body length of individuals with the SNP molecular marker genotype CC is significantly better than that of individuals with the genotype CT or TT.

[0026] The last objective of the present invention can be achieved by the following technical solution: the application of the above primers, reagent kits and methods in the selective breeding of superior strains of finned angelfish.

[0027] The present invention has the following advantages:

[0028] (1) This invention analyzes the body length trait of the angelfish population through genome-wide association analysis, screens out the SNP molecular marker SNP_14244957, and further verifies that this SNP molecular marker is associated with body length. Based on the genotypic differences of this SNP molecular marker, it can be used as a molecular marker for the selection and breeding of superior angelfish strains with excellent body length.

[0029] (2) The present invention can rapidly amplify target sites and determine genotypes using specific primers. The operation is simple and convenient and the results are accurate and reliable.

[0030] (3) The SNP molecular markers, primers and kits provided by the present invention have application prospects in molecular marker-assisted breeding of angelfish. They are not affected by individual age, sex and other factors, and can be used for early screening of angelfish breeding materials. They can shorten the breeding cycle, improve selection accuracy and overcome the limitations of traditional breeding that depend on phenotype. Attached Figure Description

[0031] The present invention will now be further described with reference to the accompanying drawings and embodiments.

[0032] Figure 1 This is a Manhattan plot of genome-wide association analysis in Example 1 of the present invention. The point pointed to by the arrow is the SNP molecular marker SNP_14244957 screened in the present invention.

[0033] Figure 2 The QQ diagram of the genome-wide association analysis in Example 1 of this invention verifies the reliability of the association analysis results. Detailed Implementation

[0034] The technical solution of the present invention will be described in detail below with reference to specific embodiments, so that those skilled in the art can better understand and implement the technical solution of the present invention. The following embodiments and drawings are for illustrative purposes only and should not be construed as limiting the present invention. Unless otherwise specified, the reagents or materials used in the embodiments are all from commercial sources. Unless otherwise specified, the experimental instruments used are all conventional laboratory instruments.

[0035] Example 1: Screening of SNP molecular markers related to body length in the angelfish

[0036] (1) The body length of 350 nine-month-old angelfish in the same breeding environment was randomly measured. The caudal fins of 50 fish with the largest and 50 fish with the smallest body length were cut off. DNA was extracted using a magnetic bead DNA extraction kit. The genomic DNA of the angelfish was extracted by adding reagents in sequence according to the kit instructions using the cut caudal fins.

[0037] (2) The genomic DNA was randomly fragmented into 350bp fragments. After end repair, phosphorylation and A-tailing, adapters were ligated to both ends of the fragments to prepare a DNA library. Then, PE150 sequencing was performed using the BGI T7 sequencing platform.

[0038] (3) After quality control and processing, the raw sequencing data were aligned to the reference genome using BWA v0.7.15 software. SNP molecular markers were detected using the standard procedure of SAMtools v1.3.1 software. The obtained genotype data were filtered for quality control using PLINK v1.9 software. The filtering conditions were: detection rate >95%, minor allele frequency (MAF) <0.05, and Hardy-Weinberg equilibrium test P value <10. -6 Finally, a genome-wide association analysis of the body length trait in the angelfish was conducted using 100 individuals and 638,085 SNP molecular markers.

[0039] (4) Genome-wide association analysis of body length of the finned angelfish was performed using a linear mixture model in GEMMA v0.98.5 software. The model was Y= In the formula, Y is the body length of the finned angelfish, and W is the variance-covariance matrix. X is the population mean, and X is the indicator variable. This is the effect of SNP labeling, where Z is based on the SNP kinship matrix. It is an additive genetic effect. These are random residuals. Principal component analysis was performed on the factors influencing the phenotype, and the first three principal components were added to the model as covariates.

[0040] (5) A genome-wide association analysis revealed a SNP molecular marker associated with the body length of the angelfish. This SNP molecular marker is located at base 14244957 on chromosome 23 of the angelfish and is named SNP_14244957. Figure 1 The point indicated by the arrow is this marker. This SNP molecular marker is the 301st base of the nucleotide sequence shown in SEQ ID NO.1.

[0041] The nucleotide sequence shown in SEQ ID NO.1 is as follows:

[0042] GCTACACACTCTCTCCTTTTGCACCTGCTGCCCTACTGCTCTCACCCACTGTGCCTTCACTCTTTCACTCTTTCCTCCTTCTCATTCCCTGCCCCCACTACCCATCCCTCTCCCCCTCCACTTCTGCTTTTGTTTCACTTTCCTCATTT CCCCCACTTTGTTTGCTTGTCTCCTCCTTTCTTCAGCTCTGTCACTGTTTTATATACCCCCCACCAGTCCAGTGCTCCTACTGCTTCCTACAGCTTTTTTTTTTTTTCCATTTGTTACTGCTCCATTGCAGCTTCCTGTGTTTGCCATGT N(C / T) CACACTGCATTGCACTTTTTTTCTACCTTCCATTTGCCTCTCCCCCCTCCATGCCTGCACTCTTTAGCTCTTATTTAGCTGTGTTTGCATGCACCCTCCTATTCCTCTTATCCTCAGCCCCCCTCCTCTGTCTATCTGTTGTTGCCATGT TTCACCCCCTATTTGTTCCTATATCTCTTGCTGTACCTTTTGCCCCACTTCTCCCCTTTTGCCATTTCATTCTCCCCATTGTTGCCTTGCCTTTACTAGCCCTTTGTGCTCTATCTATTTCCATCATGTTTCCAGCACTTTACTCTCTTTA.

[0043] The N at the 301st base of the above sequence is C or T, and this mutation makes the above sequence, namely the sequence shown in SEQ ID NO.1, polymorphic.

[0044] Example 2: Validation of body length-related SNP molecular markers in the angelfish.

[0045] (1) Validation group

[0046] Different groups of angelfish were selected, and 310 experimental fish were randomly selected from them. The body length of each fish was measured and recorded, and the tail fin samples of each fish were collected and preserved for DNA extraction. The specific process of DNA extraction was the same as in Example 1.

[0047] (2) PCR amplification

[0048] Primers for the SNP molecular marker were designed using the SNP Primer software, with the genomic sequences 300 bp upstream and downstream of the marker as templates.

[0049] Using the extracted DNA as a template, PCR amplification was performed using SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 as primers. The total volume of the PCR amplification reaction was 10 μL.

[0050] The PCR amplification reaction system is as follows:

[0051]

[0052] The PCR amplification reaction procedure is as follows:

[0053]

[0054] (3) Genotyping

[0055] After PCR amplification, the fluorescence signal of the PCR product is read using an ELISA reader. Then, the fluorescence signal is analyzed and converted using snpdecoder software. Based on the different fluorescence colors, the genotype corresponding to each sample is analyzed and output, thereby obtaining the genotype of the SNP molecular marker described in this invention in different fish.

[0056] (4) Verification results

[0057] One-way ANOVA was performed on the body length data of different genotypes of the SNP_14244957 molecular marker using SPSS 26.0, and multiple comparisons between groups were performed using the Tukey method. The results are shown in Table 1.

[0058] Table 1. Effects of SNP_14244957 polymorphism on body length of the angelfish.

[0059]

[0060] Table 1 shows that P<0.05 indicates a significant difference, and P<0.01 indicates an extremely significant difference.

[0061] Table 1 shows that there were extremely significant differences in body length among individuals with different genotypes of the SNP_14244957 molecular marker in the angelfish (P<0.001). The body length of individuals with genotype CC was significantly greater than that of individuals with genotypes CT and TT (P<0.01), while there was no significant difference in body length between individuals with genotypes CT and TT (P>0.05). The results indicate that when the SNP_14244957 molecular marker genotype is CC, the body length of the angelfish is significantly greater than that of individuals with genotypes CT or TT.

[0062] The above examples demonstrate that the SNP_14244957 molecular marker of the present invention is significantly correlated with the body length of the angelfish, and its genotype can be determined by specific amplification primers. The operation is simple and reliable, and this SNP molecular marker has application prospects in molecular marker-assisted breeding of angelfish.

[0063] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure. Any improvements and modifications made based on the concept of the present invention fall within the scope of protection of the present invention, and the specific scope of protection is determined by the claims.

Claims

1. A SNP molecular marker associated with the body length of the angelfish, characterized in that, The nucleotide sequence is shown in SEQ ID NO.1, with the 301st base starting from the 5' end being either C or T.

2. A primer for detecting the SNP molecular marker of claim 1, characterized in that, The nucleotide sequences are shown in SEQ ID NO. 2~4.

3. A kit for detecting the SNP molecular marker of claim 1, characterized in that, Includes the primers described in claim 2.

4. A method for breeding superior strains of the pointed-winged angelfish, characterized in that, Includes the following steps: (1) Extract DNA from the tail fin of the individual angelfish to be tested; (2) The extracted DNA was amplified by PCR using the primers described in claim 2 to obtain the PCR amplification product; (3) Analyze the fluorescence signal of the PCR amplification product to determine the genotype of the SNP molecular marker described in claim 1, wherein the body length of individuals with the SNP molecular marker genotype CC is significantly better than that of individuals with the genotype CT or TT.

5. The application of the primers of claim 2, the kit of claim 3, and the method of claim 4 in the selection of superior strains of angelfish with excellent body length.

Images