Application of SNP molecular marker related to pig shear force trait

Abstract

The application belongs to the technical field of molecular biology, and particularly relates to application of a SNP molecular marker related to a pig shear force trait. The application provides a significant SNP site affecting pig shear force, wherein the SNP molecular marker is located at base position 15915706 of chromosome 18 of a pig genome, and a polymorphic site thereof is A / G. The SNP site can be applied to molecular marker assisted selection and genome selection, and by selecting a site and a genotype favorable to the shear force meat quality trait for breeding, the genetic improvement process of the pork quality performance of pigs can be accelerated.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to the application of a SNP molecular marker related to porcine shear force traits. Background Technology

[0002] Pork quality is a crucial target trait in pig breeding, directly impacting consumer experience and product value. Meat quality traits typically include multiple indicators such as meat color, pH value, marbling, shear strength, and water-holding capacity. Among these, shear strength is the core parameter reflecting muscle tenderness; the lower the shear strength, the more tender the meat and the higher its market acceptance.

[0003] Black pigs, as an excellent local pig breed in my country, are characterized by their tender meat and rich flavor. However, the genetic improvement of their meat quality traits still mainly relies on traditional phenotypic selection, which is time-consuming and inefficient. With the development of molecular biology, marker-assisted selection has become an effective means to accelerate the breeding process.

[0004] Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by a single nucleotide variation at the genomic level. They have advantages such as wide distribution, genetic stability, and ease of high-throughput detection, making them the most widely used type of molecular marker. By screening for SNP sites that are significantly associated with target traits, accurate genotype selection can be achieved at an early stage in an individual's development, significantly shortening the breeding cycle.

[0005] However, existing technologies still lack a sufficient number of SNP markers that are significantly associated with the shear force trait in black pigs and can be used for marker-assisted selection, making it difficult to effectively support the needs of tenderness-oriented precision breeding. Therefore, there is an urgent need in this field to develop SNP molecular markers that are closely related to the shear force trait in pigs. Summary of the Invention

[0006] The purpose of this invention is to provide an application of SNP molecular markers related to porcine shear force traits. The SNP molecular markers provided by this invention can be used for marker-assisted molecular analysis.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] This invention provides an application of SNP molecular markers in detecting porcine shear force traits or in marker-assisted breeding of pigs. The SNP molecular marker is located at base position 15915706 on chromosome 18 of the porcine genome, and its polymorphism site is A / G. The reference genome is Sscrofa11.1; the Ensembl genome sequence file is available at: https: / / ftp.ensembl.org / pub / release-110 / fasta / sus_scrofa / dna / Sus_scrofa.Sscrofa11.1.dna.toplevel.fa.gz.

[0009] Preferably, the nucleotide sequence containing the polymorphic site is as shown in SEQ ID NO:3, wherein the polymorphic site is located at the 501st base of the sequence.

[0010] Preferably, the dominant allele of the SNP molecular marker is A, the dominant genotype is AA, and individuals carrying the dominant allele and / or dominant genotype have significantly lower shear force values.

[0011] Preferably, the pig is a black pig.

[0012] The present invention also provides a primer pair for detecting the above-mentioned SNP molecular markers, the primer pair comprising a forward primer as shown in SEQ ID NO:1 and a reverse primer as shown in SEQ ID NO:2.

[0013] The present invention also provides a kit for detecting porcine shear force traits, comprising the primer pairs described above.

[0014] Preferably, it also contains DNA polymerase, dNTPs, and buffer required for PCR amplification.

[0015] The present invention also provides a method for detecting shear force traits in pigs, comprising the following steps:

[0016] (1) Extract genomic DNA from the pigs to be tested;

[0017] (2) Perform PCR amplification of the genomic DNA using the primer pairs or kits described above;

[0018] (3) Genotyping the amplification products to determine the genotype of the SNP molecular marker;

[0019] (4) Determine the shear force trait of the pig to be tested based on the genotype.

[0020] Preferably, the genotyping in step (3) is performed using any one of sequencing, TaqMan probe method, KASP technology, or mass spectrometry.

[0021] The present invention also provides a method for pig molecular marker-assisted selection breeding, comprising: using the above-mentioned SNP molecular marker to detect the genotype of the pig to be tested, and selecting individuals carrying the dominant allele and / or dominant allele type for breeding; wherein the dominant allele of the SNP molecular marker is A, and the dominant allele type is AA.

[0022] Beneficial effects:

[0023] This invention provides a significant SNP site that affects shear force in pigs, which can be used in marker-assisted selection and genomic selection to select sites and genotypes that are favorable to shear force and meat quality traits for breeding, thus helping to accelerate the genetic improvement of pork quality performance. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 The shear force is represented by the GWAS Manhattan plot - QQ plot.

[0026] Figure 2 Association analysis of different genotypes and shearing force at the 18:15915706A>G site.

[0027] Figure 3 The Sanger sequencing result for the 18:15915706A>G site is positive. Detailed Implementation

[0028] This invention provides an application of SNP molecular markers related to the shear force trait in pigs, including applications in detecting the shear force trait in pigs or in marker-assisted breeding of pigs.

[0029] This invention also provides primer pairs for detecting the aforementioned SNP molecular markers, and a detection kit containing such primer pairs. The kit contains commonly used reagents for PCR amplification, including DNA polymerase, dNTPs, and buffer.

[0030] This invention uses 395 local black pigs from Wutang Breeding Pig Farm in Zhanjiang City, Guangdong Province as the research subjects. Adipose tissue and muscle tissue samples were collected for whole-genome resequencing. Meat quality traits, including meat color, pH, marbling, shear force, and water-holding capacity, were also measured. After PLINK (v1.90) quality control, a genome-wide association analysis (GWAS) of pork quality traits was performed using a single-trait linear mixture model in GMAT to identify significant loci.

[0031] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0032] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0033] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.

[0034] Example 1: GWAS Analysis

[0035] 1. Data collection on meat quality traits of rural black pigs: 395 rural black pigs from Wutang Breeding Pig Farm in Zhanjiang City, Guangdong Province were selected, and their meat quality trait data were collected, mainly including meat color, pH, marbling, shear force, and water-holding capacity.

[0036] 2. Whole-genome resequencing and SNP detection quality control: Muscle and adipose tissue samples were collected from 395 rural black pigs. DNA samples were extracted and whole-genome libraries were constructed. The sample genome libraries underwent 10× resequencing to obtain high-depth genomic information. Raw sequencing data were quality controlled using FastP (v0.20.0) with the following filtering criteria: N>5, low-quality bases (Q<5) proportion ≥20%, and length <30bp after adapter removal. Quality-controlled cleanreads were aligned to the pig reference genome Sus_scrofa.Sscrofa11.1 using BWA (v0.7.17) with the parameter mem-MY-K10000000. After alignment, the results were sorted using samtools (v1.10), deduplicated using sambamba (v0.7.1), and corrected using BQSR. Variance detection was performed using HaplotypeCaller in GATK (v4.2.0.0), and joint genotyping was performed based on the gVCF strategy. The genotypic data were subjected to strict quality control using PLINK (v1.90) software, under the following conditions: (1) sites with a minor allele frequency ≥0.05 were retained (--maf0.05); (2) sites deviating from Hardy-Weinberg equilibrium were removed (P<1×10⁻⁶). -6 (3) Remove sites with a deletion rate >1% (--geno0.01); (4) Remove samples with an individual deletion rate >1% (--mind0.01); (5) Only retain biallelic SNP sites with bases A / C / G / T (--snps-onlyjust-acgt); (6) Only retain data for autosomes 1-18 (--chr-set18). Finally, 20,713,983 high-quality SNPs were obtained for subsequent analysis.

[0037] 3. GWAS Analysis: A genome-wide association analysis (GWAS) of the shear force trait in rural black pigs was performed using a univariate linear mixed model in GMAT software. To control for the influence of population structure and kinship, the genomic kinship matrix was used as a random effect correction in the model. Batch effects were fitted as fixed effects and included the first three principal components as covariates. The GWAS results were visualized using the R package CMplot (v4.4.3) to generate Manhattan plots and QQ plots. Figure 1 Among them, the Bonferroni correction threshold (P=1.02×10) -9 One significantly associated site was identified; a suggested threshold (P=2.04×10⁻⁶) was proposed. -8 Two potential associated sites were identified; the traditional threshold (P=1×10) was used. -6130 potential associated sites were identified.

[0038] 4. Association Analysis of Different Genotypes and Splicing Force of Significant SNPs: For significant SNP sites identified by GWAS, genotype information of the A>G mutation site at position 15915706 on chromosome 18 of the Xiangxia Black Pig was extracted from whole-genome resequencing data. Individuals with the same genotype were grouped together, and the mean and standard deviation of the splicing force phenotype within each group were calculated. One-way ANOVA was performed using the aov() function in R (v4.4.3) to test the significance of differences in splicing force phenotypes among different genotype groups. Subsequently, a two-tailed t-test was used to perform pairwise comparisons (AA vs AG, AG vs GG, GG vs AA) to assess the specific impact of different allele combinations on the phenotype. Significance levels * indicate P < 0.05, ** indicate P < 0.01, *** indicate P < 0.001, and **** indicate p ≤ 0.0001. Statistical results are presented in the form of "mean ± standard deviation". Box plots were generated using the ggplot2 package in R to show the distribution characteristics of shear force phenotypes among different genotype groups. The results are shown in Table 1. Figure 2 The G allele mutation at site 18:15915706A>G significantly increases the muscle shear force in rural black pigs. The average muscle shear forces for wild-type AA, heterozygous mutant AG, and homozygous mutant GG were 16.29±3.50N, 18.97±3.90N, and 28.03±0.24N, respectively. The heterozygous AG genotype was significantly higher than the wild-type AA genotype (P<0.001), and the homozygous GG genotype was significantly higher than both the wild-type AA and the heterozygous AG genotype (P<0.0001). Therefore, the G allele mutation causes an increase in muscle shear force. In the breeding of rural black pigs, breeding should prioritize the retention of wild-type AA individuals and strictly eliminate individuals carrying the G allele mutation in the AG and GG genotypes.

[0039] Table 1. Association analysis between different genotypes and shearing force at the 18:15915706A>G site

[0040] AA 357 16.29±3.50 AA vs AG 0.0006*** AG 35 18.97±3.90 AG vs GG 1.2e-07**** GG 3 28.03±0.24 GG vs AA 6.2e-14****

[0041] Example 2: Verification of Polymorphic Sites

[0042] To verify the authenticity and reliability of the SNP sites obtained from high-throughput sequencing, rather than being caused by sequencing errors, six samples with two AA genotypes, three AG genotypes, and one GG genotype were selected for Sanger sequencing.

[0043] 1. Sequence information extraction: Extract 500bp of sequence information upstream and downstream of the 18:15915706 site.

[0044] 2. Primer design: Primers were designed using the NCBI Primer Blast software based on the extracted 1001 bp DNA sequence.

[0045] Primer design results (5'→3' direction):

[0046] 15915706-F:CATGGTCTACTCCAGGTGGTA (SEQ ID NO:1)

[0047] 15915706-R:TACCAGCCTCTCAGGTGTCAT (SEQ ID NO: 2)

[0048]

[0049] 3. PCR amplification: Add 0.5 μL of DNA template, 10 μL of double-distilled water, 12.5 μL of 2×PCR Mix, and 1 μL of each primer to a 25 μL system. The PCR reaction conditions are as follows: 94℃ pre-denaturation for 3 min, followed by 94℃ denaturation for 30 s, 60℃ annealing for 30 s, and 72℃ extension for 20 s, for 35 cycles, with a final extension at 72℃ for 10 min.

[0050] 4. Sanger Sequencing: DNA sequencing was performed at Beijing Qingke Biotechnology Co., Ltd., with two sequencing reactions (forward and reverse) of gene fragments. The obtained sequences were compared with the Ensembl genome sequence to determine the mutation status of corresponding SNP sites. The sequencing results are as follows: Figure 3 As shown.

[0051] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of a reagent for detecting SNP molecular markers in the detection of shear force traits in black pig muscle, characterized in that, The SNP molecular marker is located at base 15915706 on chromosome 18 of the pig reference genome Sscrofa11.1, with a polymorphic site of A / G. Individuals carrying the AA genotype have low muscle shear force.

2. The application according to claim 1, characterized in that, The nucleotide sequence containing the polymorphic site is shown in SEQ ID NO:3, and the polymorphic site is located at the 501st base of the sequence.

3. The application according to claim 1, characterized in that, The reagent is a primer pair, which includes a forward primer as shown in SEQ ID NO:1 and a reverse primer as shown in SEQ ID NO:

2.

4. A method for detecting the shear force property of black pig muscle, characterized in that, Includes the following steps: (1) Extract genomic DNA from the black pigs to be tested; (2) PCR amplification of the genomic DNA using the primer pair described in claim 3; (3) Genotyping the amplification products to determine the genotype of the SNP molecular marker described in claim 1; (4) The muscle shear force trait of the black pig to be tested was determined based on the genotype. Individuals carrying the AA genotype have low muscle shear force.

5. The method according to claim 4, characterized in that, The genotyping in step (3) is performed using sequencing.

6. A molecular marker-assisted selection breeding method for black pigs, characterized in that, include: Using the primer pair described in claim 3, the genotype of the SNP molecular marker described in claim 1 of the black pig to be tested is detected. Individuals carrying the dominant allele AA are selected for breeding. Individuals carrying the AA genotype have low muscle shear force.

Images