A tetA gene double-mode detection method, a detection kit and application thereof

Abstract

This invention relates to a dual-mode detection method and kit for the tetA gene, and their applications. The dual-mode detection method for the tetA gene includes the following steps: water sample pretreatment, preparation of PNA-1 modified magnetic material, dual PNA invasion recognition reaction, magnetic enrichment, fluorescence detection, and electrochemical detection. The tetA gene detection kit is used to implement the above-mentioned dual-mode detection method for the tetA gene. The application of the tetA gene detection kit in water body detection is also discussed. This invention features simple operation, strong anti-interference ability, high specificity, and enables rapid on-site screening and laboratory testing.

Description

Technical Field

[0001] This invention relates to the technical field of antibiotic resistance gene detection, and in particular to a dual-mode detection method for the tetA gene, a detection kit, and its applications. Background Technology

[0002] Antibiotic resistance genes (ARGs) serve as key genetic markers for the risk of antibiotic resistance transmission in aquatic environments. Multiple resistance genes can be detected in various water bodies, including aquaculture wastewater, hospital wastewater, sewage treatment plant influent and effluent, as well as rivers and lakes. Among them, the tetA gene, a common gene associated with tetracycline resistance, is closely linked to antibiotic selection pressures generated during agricultural and aquaculture activities, medical discharges, and urban wastewater treatment. Therefore, developing a rapid and accurate detection method for the tetA gene suitable for complex water body samples is of significant value for screening, risk assessment, and monitoring the transmission of antibiotic resistance pollution in aquatic environments.

[0003] Currently, detection methods for aquatic ARGs mainly cover quantitative PCR (qPCR), digital PCR (dPCR), isothermal amplification, CRISPR / Cas nucleic acid detection, and DNA probe-based fluorescence or electrochemical sensing technologies. While PCR methods offer high sensitivity and reliable results, they typically require specialized nucleic acid extraction equipment, sophisticated amplification instruments, and strictly temperature-controlled environments, resulting in complex procedures and long detection cycles, making them unsuitable for rapid on-site screening. CRISPR / Cas detection methods, although highly specific, still rely on pre-amplification treatment or specific enzymatic reaction conditions, and are sensitive to common interfering substances in water samples such as humic acid, metal ions, and suspended particles. Furthermore, conventional DNA probe sensors, due to the negative charge of DNA molecules, easily exhibit non-specific adsorption at negatively charged electrode interfaces or non-target nucleic acids. Additionally, detecting double-stranded DNA targets usually requires thermal or chemical denaturation, increasing operational steps and uncertainty in results.

[0004] Peptide Nucleic Acid (PNA) is an artificial nucleic acid analogue in which an electrically neutral polypeptide backbone replaces the sugar-phosphate backbone of DNA, enabling it to recognize DNA or RNA sequences with high specificity through complementary base pairing. Compared to DNA probes, PNA probes exhibit higher hybridization stability, stronger single-base mismatch recognition capability, and excellent resistance to nuclease degradation. In particular, due to its electrically neutral backbone, there is no electrostatic repulsion between it and negatively charged nucleic acid targets, making it ideal for short sequence recognition in complex matrices and for constructing electrochemical interfaces. However, most existing PNA-based detection methods target clinical biomarkers or rely on PCR amplification. Currently, there is a lack of a method specifically designed for on-site detection of the tetA gene in environmental water bodies that can directly recognize double-stranded DNA, integrate magnetic enrichment for interference resistance, and provide dual-mode signal output. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the first objective of this invention is to provide a dual-mode detection method for the tetA gene, which has the dual advantages of being easy to operate, having strong anti-interference ability, high specificity, and being able to achieve both rapid on-site screening and accurate laboratory quantification.

[0006] A second objective of this invention is to provide a tetA gene detection kit for implementing the above-described method.

[0007] The third objective of this invention is to provide an application of a tetA gene detection kit in water body detection.

[0008] To achieve the first objective mentioned above, the present invention provides the following technical solution:

[0009] A dual-mode detection method for the tetA gene includes the following steps:

[0010] S1 Water Sample Pretreatment: The water sample to be tested is filtered to enrich microorganisms and nucleic acids, and after lysis treatment, the nucleic acid solution to be tested is obtained;

[0011] S2 Preparation of PNA-1 Modified Magnetic Material: The biotinylated first peptide nucleic acid probe PNA-1 was immobilized on the surface of magnetic microspheres. After incubation, post-processing was performed to obtain PNA-1 modified magnetic material.

[0012] S3 Dual PNA Intrusion Recognition Reaction: The nucleic acid solution to be tested obtained in S1, the PNA-1 modified magnetic material obtained in S2, and the PNA-2 signal probe carrying fluorescent groups and electrochemical labels are mixed in a hybridization buffer and hybridized so that PNA-1 and PNA-2 recognize and bind to the two complementary strands of the tetA gene double-stranded DNA target fragment, respectively, to obtain a magnetic PNA-1 / tetA DNA / PNA-2 complex;

[0013] S4 Magnetic enrichment: The complex obtained in S3 is enriched by an external magnetic field in the magnetic enrichment region, and the supernatant is discarded. The complex is then washed with a washing solution to remove unbound substances and matrix interferences.

[0014] S5 fluorescence detection: The complex washed with S4 is resuspended, placed in the fluorescence detection window, and the signal intensity of the fluorescent group on PNA-2 is excited and detected to achieve qualitative or semi-quantitative analysis of the tetA gene.

[0015] S6 Electrochemical Detection: The complex washed in S4 is immobilized on the surface of the working electrode, and the response signal of the electrochemical marker on PNA-2 is detected through the electrochemical detection area. The quantitative analysis of the tetA gene is achieved according to the standard curve.

[0016] By adopting the above technical solution, this invention utilizes two PNA probes to synergistically identify the invasion of double-stranded DNA of the tetA gene, avoiding the thermal denaturation step of traditional methods; it uses magnetic microspheres to achieve efficient enrichment of the target analyte and effective removal of interfering substances in complex water matrix; at the same time, it constructs a dual-mode signal readout system of fluorescence and electrochemical signals, with fluorescence signals suitable for rapid on-site screening and electrochemical signals suitable for precise quantification, and the two can be mutually verified, significantly reducing the risk of misjudgment.

[0017] Furthermore, in S1, the filtration process includes using a 0.22 μm or 0.45 μm filter membrane to retain microorganisms, particulate-bound DNA, and intracellular resistance gene samples in the water sample to be tested.

[0018] Furthermore, in S1, the lysis process includes placing the filter membrane of the retained sample in a lysis buffer, which includes 10 mM Tris-HCl, 1 mM EDTA, 0.1% Triton X-100, pH=8.0, heating at 60~70°C for 5~15 min, selectively supplemented with sonication for 1~5 min, and centrifuging to collect the supernatant.

[0019] Furthermore, the specific implementation of S1 is as follows: take 10-100 mL of the water sample to be tested, filter it through a 0.22 μm or 0.45 μm filter membrane to retain microorganisms, particle-bound DNA, and intracellular resistance gene samples in the water sample; then place the filter membrane containing the retained sample in a lysis buffer, which includes 10 mM Tris-HCl, 1 mM EDTA, 0.1% Triton X-100, pH=8.0, and lyse at 60-70℃ for 5-15 min, and if necessary, sonicate for 1-5 min; centrifuge and collect the supernatant to obtain the nucleic acid solution to be tested.

[0020] Further, in S2, the biotinylated first peptide nucleic acid probe PNA-1 is 0.05~5.00 μM Biotin-PEG6-PNA-1, preferably 0.05~1.00 μM.

[0021] Furthermore, in S2, the incubation process includes incubation at 25-37°C for 15-60 minutes.

[0022] Furthermore, the specific implementation of S2 is as follows: take streptavidin magnetic beads, wash them with PBS, add 0.05~5.00μM Biotin-PEG6-PNA-1, and incubate at 25~37℃ for 15~60min to fix PNA-1 on the surface of streptavidin-modified magnetic microspheres. After incubation, magnetically separate and discard the supernatant, wash 2~3 times with PBS-Tween, and block with PBS containing 0.1% BSA or PVP for 10~30min to obtain PNA-1 modified magnetic material (i.e., streptavidin magnetic beads loaded with Biotin-PEG6-PNA-1).

[0023] The biotin-streptavidin magnetic beads have a particle size of 0.1–5 μm, preferably 0.5–2.8 μm. The streptavidin magnetic beads can be replaced with carboxyl magnetic beads, amino magnetic beads, sulfide magnetic nanoparticles, polyionic liquid-modified magnetic beads, or PEG / PVP / zwitterionic polymer antifouling magnetic beads. Regarding the PNA-1 immobilization method, the traditional biotin-streptavidin action can be flexibly changed to EDC / NHS coupling, thiol-gold nanoparticles, click chemistry, electrostatic adsorption, or hydrophobic adsorption.

[0024] Furthermore, in S3, the PNA-2 signal probe is a 10~500nM FAM-PNA-MB, preferably 100nM.

[0025] Regarding the selection of signal probes, the commonly used FAM-PNA-MB can be replaced with Cy3-PNA-ferrocene, Cy5-PNA-MB, PNA-enzyme-labeled substances, and PNA-nanoparticle tags, etc. In terms of readout methods, the original fluorescence / electrochemical dual-mode can be further expanded to include colorimetric / electrochemical, electrochemiluminescence / electrochemical, fluorescence / impedance, and other signal combinations.

[0026] Furthermore, in S3, the hybridization buffer contains 20 mM Tris-HCl, 20 mM KCl, 0~50 mM (preferably 5~20 mM) MgCl2, 0.01% Tween-20, and has a pH of 7.0~8.5.

[0027] Furthermore, in S3, the hybridization process includes hybridization at 37~55°C for 15~60 min, preferably at 45°C for 30 min.

[0028] Furthermore, S3 is specifically implemented by mixing the nucleic acid solution to be tested, the PNA-1 modified magnetic material, and the PNA-2 signal probe in a hybridization buffer and hybridizing at 37~55℃ for 15~60 min, so that PNA-1 and PNA-2 respectively recognize and bind to the two complementary strands of the tetA gene double-stranded DNA target fragment, thereby obtaining a magnetic PNA-1 / tetA DNA / PNA-2 complex.

[0029] Furthermore, in step S4, a detachable magnet is provided at the bottom or side of the magnetic enrichment zone for magnetic adsorption of the complex and for washing. Magnetic enrichment is a process that utilizes magnetic microspheres or magnetic nanoparticles to capture the target complex and then separates and washes it using an external magnetic field.

[0030] Furthermore, the specific implementation of S4 is as follows: the complex is placed on a magnetic rack for 1-2 minutes to enrich the complex on the tube wall of the magnetic rack or the magnetic enrichment area of ​​the chip. The supernatant is discarded, and the complex is washed 2-3 times with washing solution, such as PBS-Tween, PBS-PVP, or PBS-BSA, to remove unbound nucleic acids, free PNA-2 signal probes, humic acid, salts, suspended particles, and other non-target background substances, thereby reducing non-specific adsorption and matrix interference.

[0031] Furthermore, in S5, fluorescence detection uses an excitation light source of 470~488nm to detect the intensity of emitted light near 520nm.

[0032] Furthermore, in S5, the fluorescence detection window is used by a mobile phone or portable fluorescence reader to collect fluorescence signals.

[0033] Furthermore, the specific implementation of S5 is as follows: the washed complex is resuspended and dropped into the fluorescence detection window, the FAM fluorescence signal is collected under excitation light of 470~488nM, the emission light intensity near 520nM is read, and the qualitative or semi-quantitative analysis of the tetA gene is achieved based on the standard curve established by fluorescence intensity and tetA standard concentration.

[0034] Furthermore, in S6, the electrochemical detection employs differential pulse voltammetry or square wave voltammetry, with a scanning range of -0.50 to 0.00 V, or adjusted according to electrochemical labels such as MB / ferrocene.

[0035] Furthermore, in S6, the electrochemical detection area is configured as a screen-printed three-electrode system for detecting the electrochemical response on the PNA-2 signal probe.

[0036] In terms of the choice of electrode material substrate, the standard screen-printed carbon electrode can be replaced with gold electrode, ITO electrode, paper-based electrode, or carbon nanotube modified electrode, graphene modified electrode, and gold nanoparticle modified electrode.

[0037] Furthermore, the specific implementation of S6 is as follows: the washed complex is dropped into the electrochemical detection area, a small magnet is placed below the electrode to fix the complex on the surface of the working electrode, Ag / AgCl is used as the reference electrode and the carbon electrode is used as the counter electrode, and the electrochemical response of MB on the PNA-2 signal probe is detected by differential pulse voltammetry or square wave voltammetry, with a scanning range of -0.50~0.00V, and quantitative analysis of the tetA gene is achieved according to the standard curve.

[0038] To achieve the second objective mentioned above, the present invention provides the following technical solution:

[0039] A tetA gene detection kit, used to implement the above-mentioned tetA gene dual-mode detection method, includes,

[0040] PNA-1 modified magnetic materials are used to capture tetA target double-stranded DNA;

[0041] The PNA-2 signal probe carries both a fluorescent group and an electrochemical label;

[0042] Positive standard: tetA target double-stranded DNA standard;

[0043] Negative controls are non-target ARGs fragments or mismatched tetA fragments;

[0044] In addition, the detection chip includes a dual PNA intrusion recognition reaction region, a magnetic enrichment region, a fluorescence detection window, and an electrochemical detection region.

[0045] To achieve the third objective mentioned above, the present invention provides the following technical solution:

[0046] Application of a tetA gene detection kit in water body detection.

[0047] While this method primarily uses tetA as the main implementation example for the detection of target genes, its technical system can be fully extended to resistance genes or transmission risk indicator genes such as tetM, sul1, blaTEM, blaCTX-M, mcr-1, qnrS, ermB, and intI1. Furthermore, this invention has extremely high tolerance for different sample types, and the actual samples to be tested can be widely applied to various complex water quality environments, including river water, lake water, aquaculture wastewater, hospital wastewater, sewage treatment plant influent, sewage treatment plant effluent, reclaimed water, agricultural drainage, and aquaculture tailwater.

[0048] In summary, the beneficial technical effects of the present invention are as follows:

[0049] 1. This invention innovatively employs a pair of meticulously designed peptide nucleic acid (PNA) probes to specifically and invasively recognize and bind to the target tetA double-stranded DNA sequence. This strategy cleverly utilizes the high affinity and strong stability of PNA molecules for the DNA double helix structure, enabling direct hybridization with intact double-stranded DNA at room temperature. This completely avoids the necessary heat denaturation treatment or polymerase chain reaction (PCR) amplification steps required in traditional detection methods. This technical approach not only significantly simplifies the overall operation process and reduces the time and equipment dependence required for experiments, but also effectively improves the overall efficiency and convenience of detection, laying a solid foundation for subsequent rapid diagnosis and field applications.

[0050] 2. This invention further integrates the highly specific PNA recognition mechanism with efficient magnetic enrichment technology to construct an integrated pretreatment-detection platform that combines selectivity and purification capabilities. In actual water sample detection, the target DNA-PNA complex can be rapidly captured and separated using magnetic beads. Subsequently, through an optimized multi-step washing procedure, common humic acids, suspended particles, metal ions, and other potential interfering components in water can be efficiently removed. This dual-protection mechanism significantly reduces the interference of complex environmental matrices on the detection signal, and significantly enhances the applicability, stability, and anti-interference ability of the method in real water samples (such as rivers, lakes, and sewage), thereby ensuring the high reliability and repeatability of the detection results.

[0051] 3. This invention creatively constructs a dual-modal synergistic detection system combining fluorescence and electrochemical methods. The two detection modes in this system can operate independently to meet the needs of different scenarios, and can also cross-validate each other to improve the reliability of the results. Specifically, the fluorescence mode, with its advantages of ease of operation, rapid response, and high visualization, is particularly suitable for rapid on-site screening in the field or under conditions of limited resources. The electrochemical mode, with its high sensitivity, good linear range, and excellent quantitative capabilities, is more suitable for precise analysis and confirmation in a laboratory environment. Through consistency comparison of the dual-modal data, false positive or false negative results caused by the limitations of a single detection principle can be effectively identified and eliminated, thereby significantly improving the accuracy and comprehensive application value of the entire detection system. Detailed Implementation

[0052] To make the technical means, creative features, objectives and effects of this invention clearer and easier to understand, the invention will be further described below in conjunction with specific embodiments.

[0053] Example 1: A dual-mode detection method for the tetA gene disclosed in this invention includes the following steps:

[0054] S1 Water Sample Pretreatment: The water sample to be tested is filtered to enrich microorganisms and nucleic acids, and after lysis treatment, the nucleic acid solution to be tested is obtained;

[0055] S2 Preparation of PNA-1 Modified Magnetic Material: The biotinylated first peptide nucleic acid probe PNA-1 was immobilized on the surface of magnetic microspheres. After incubation, post-processing was performed to obtain PNA-1 modified magnetic material.

[0056] S3 Dual PNA Intrusion Recognition Reaction: The nucleic acid solution to be tested obtained in S1, the PNA-1 modified magnetic material obtained in S2, and the PNA-2 signal probe carrying fluorescent groups and electrochemical labels are mixed in hybridization buffer and hybridized so that PNA-1 and PNA-2 recognize and bind to the two complementary strands of the tetA gene double-stranded DNA target fragment, respectively, to obtain a magnetic PNA-1 / tetADNA / PNA-2 complex.

[0057] S4 magnetic enrichment: The complex obtained from S3 is enriched by an external magnetic field in the magnetic enrichment zone, and the supernatant is discarded. The complex is then washed with a washing solution to remove unbound substances and matrix interferences.

[0058] S5 fluorescence detection: The complex washed with S4 is resuspended, placed in the fluorescence detection window, and the signal intensity of the fluorescent group on PNA-2 is excited and detected to achieve qualitative or semi-quantitative analysis of the tetA gene.

[0059] S6 Electrochemical Detection: The complex washed in S4 is immobilized on the surface of the working electrode. The response signal of the electrochemical marker on PNA-2 is detected through the electrochemical detection area, and the tetA gene is quantitatively analyzed according to the standard curve.

[0060] Example 2: This invention discloses a dual-mode detection method for the tetA gene. The difference from Example 1 is that S1 is implemented as follows: 10-100 mL of water sample to be tested is taken and filtered through a 0.22 μm or 0.45 μm filter membrane to retain microorganisms, particle-bound DNA, and intracellular resistance gene samples in the water sample; then the filter membrane containing the retained sample is placed in a lysis buffer, which includes 10 mM Tris-HCl, 1 mM EDTA, 0.1% Triton X-100, pH=8.0, and lysed at 60-70℃ for 5-15 min, with sonication for 1-5 min if necessary; the supernatant is then collected by centrifugation to obtain the nucleic acid solution to be tested.

[0061] Example 3: This is a dual-mode detection method for the tetA gene disclosed in this invention. The difference from Example 1 is that the specific implementation of S2 is as follows:

[0062] This invention uses a conserved fragment of the tetA gene as the detection target. The tetA target fragment is 150 bp in length and is designated as SEQ ID NO.1. Its sequence is as follows: 5'-ATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCG-3';

[0063] Based on the sequence TTGGTTATGCCGGTAC from positions 67 to 82 of SEQ ID NO.1, a dual PNA invasion recognition probe was designed. The two PNA probes respectively recognize the two complementary strands of the double-stranded DNA in this region, as detailed below:

[0064] The N-terminus of probe PNA-1 is modified with biotin and linked to the PNA host via a PEG6 spacer arm; the N-terminus of PNA-2 is modified with FAM, and the C-terminus with MB. The above PNA probes preferably employ a non-self-pairing acpcPNA backbone to reduce self-complementary pairing between the two PNA probes and improve their efficiency in recognizing and penetrating target double-stranded DNA.

[0065] Take 50 μL of streptavidin magnetic beads and place them in a 1.5 mL centrifuge tube. Wash the tube three times with PBS buffer, add 100 μL of 1.00 μM Biotin-PEG6-PNA-1 solution, and incubate at 37 °C for 30 min to immobilize PNA-1 on the surface of the streptavidin-modified magnetic microspheres. After incubation, magnetically separate and discard the supernatant. Wash the tube three times with PBS containing 0.05% Tween-20, and then block it with PBS containing 0.1% BSA for 15 min to obtain PNA-1 modified magnetic material (i.e., streptavidin magnetic beads loaded with Biotin-PEG6-PNA-1). The obtained PNA-1 modified magnetic material can be stored at 4 °C for later use in the capture, enrichment, and washing of the tetA target fragment in water.

[0066] Example 4: This is a dual-mode detection method for the tetA gene disclosed in this invention. The difference from Example 1 is that the specific implementation of S3 is as follows, and the specific implementation of S3 to S6 is as follows. In this example, the synthesized double-stranded DNA of SEQ ID NO.1 is used as the tetA standard to verify the quantitative detection capability of the method of this invention for the tetA target fragment.

[0067] S3 was prepared with concentrations of 0, 10, and 10, respectively. 2 10 3 10 4 105 10 6 and 10 7 A standard solution of tetA double-stranded DNA (copies / mL) was used as the nucleic acid solution to be tested. 100 μL of each concentration of standard solution was taken and 20 μL of PNA-1 modified magnetic material prepared in Example 3 and 100 nM PNA-2 signal probe (FAM-PNA-MB) were added respectively. The mixture was then placed in a hybridization buffer containing 20 mM Tris-HCl, 20 mM KCl, 10 mM MgCl2 and 0.01% Tween-20, with a pH of 7.5. The reaction system was incubated at 45 °C for 30 min so that PNA-1 and PNA-2 could recognize and bind to the two complementary strands of the tetA gene double-stranded DNA target fragment, respectively, to obtain a magnetic PNA-1 / tetA DNA / PNA-2 complex.

[0068] S4 Place the test tube containing the complex on a magnetic rack for 2 minutes to allow the complex to accumulate on the tube wall of the magnetic rack or the magnetic enrichment area of ​​the chip. Discard the supernatant and wash three times with PBS-Tween to remove unbound nucleic acids, free PNA-2 signal probes, humic acid, salts, suspended particles and other non-target background substances, in order to reduce non-specific adsorption and matrix interference.

[0069] S5 The washed complex was resuspended in 30 μL PBS. 10 μL of the resuspended solution was added to the paper-based fluorescence detection area of ​​the fluorescence detection window. FAM fluorescence signal was acquired under 488 nM excitation conditions, and the fluorescence intensity near 520 nM was read. The detection results are shown in Table 1.

[0070] S6 The washed complex was resuspended in 30 μL PBS. 20 μL of the resuspended solution was added dropwise to the working area of ​​the screen-printed carbon electrode in the electrochemical detection zone. A small magnet was placed below the electrode to immobilize the magnetic complex. The electrochemical signal of methylene blue on PNA-2 was detected using differential pulse voltammetry. The differential pulse voltammetry parameters were: scan range -0.50~0.00 V, pulse amplitude 50 mV, potential increment 4 mV, electrolyte 0.1 M PBS, pH 7.4. The detection results are shown in Table 1.

[0071] Table 1

[0072] 0 1.00±0.04 0.12±0.02 <![CDATA[10 2 ]]> 1.15±0.05 0.27±0.03 <![CDATA[10 3 ]]> 1.49±0.06 0.61±0.04 <![CDATA[10 4 ]]> 2.28±0.08 1.31±0.06 105 3.39±0.11 2.18±0.08 <![CDATA[10 6 ]]> 4.55±0.17 3.05±0.11 <![CDATA[10 7 ]]> 5.18±0.20 3.73±0.14

[0073] As can be seen from Table 1, the linear range of fluorescence detection is 10. 3 ~10 7 The limit of detection was 6.5 × 10⁻⁶ copies / mL. 2 copies / mL; the linear range of electrochemical detection is 10. 2 -107 The limit of detection was 1.4 × 10⁻⁶ copies / mL. 2 The results showed that the method of the present invention can perform fluorescence and electrochemical dual-mode detection of the tetA double-stranded DNA standard fragment. Among them, the electrochemical detection has higher sensitivity, while the fluorescence detection is suitable for rapid screening.

[0074] Example 5: A tetA gene detection kit disclosed in this invention, used to implement any of the tetA gene dual-mode detection methods in Examples 1-4, including,

[0075] PNA-1 modified magnetic materials are used to capture tetA target double-stranded DNA;

[0076] The PNA-2 signal probe carries both a fluorescent group and an electrochemical label;

[0077] Positive standard: tetA target double-stranded DNA standard;

[0078] Negative controls are non-target ARGs fragments or mismatched tetA fragments;

[0079] In addition, the detection chip includes a dual PNA intrusion recognition reaction region, a magnetic enrichment region, a fluorescence detection window, and an electrochemical detection region.

[0080] The PNA-1 modified magnetic material is streptavidin magnetic beads loaded with Biotin-PEG6-PNA-1; the magnetic beads have a particle size of 0.1~5μm, preferably 0.5~2.8μm; the streptavidin magnetic beads can be replaced with carboxyl magnetic beads, amino magnetic beads, sulfide magnetic nanoparticles, polyionic liquid modified magnetic beads, or PEG / PVP / zwitterionic polymer antifouling magnetic beads. Regarding the PNA-1 immobilization method, the traditional biotin-streptavidin action can be flexibly changed to EDC / NHS coupling, thiol-gold nanoparticles, click chemistry, electrostatic adsorption, or hydrophobic adsorption;

[0081] The PNA-2 signal probe is 10-500 nM FAM-PNA-MB, preferably 100 nM; the PNA probe length is 10-20 bases, preferably 12-18 bases. For the selection of the signal probe, commonly used FAM-PNA-MB can be replaced with Cy3-PNA-ferrocene, Cy5-PNA-MB, PNA-enzyme labels, and PNA-nanoparticle tags, etc. Regarding the readout mode, the original fluorescence / electrochemical dual-mode can be further expanded to various signal combinations such as colorimetric / electrochemical, electrochemiluminescence / electrochemical, and fluorescence / impedance.

[0082] The target fragment length of tetA in the positive standard is 80~300 bp, preferably 120~200 bp; the reference target fragment is 5'-ATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCG-3';

[0083] More specifically, the detection chip includes a substrate, a sample inlet, a reaction zone, a magnetic enrichment zone, a washing zone, a fluorescence detection window, and an electrochemical detection zone.

[0084] The sample inlet is used to add the nucleic acid solution to be tested, PNA-1 modified magnetic material, and PNA-2 signal probe;

[0085] The dual PNA intrusion detection reaction zone is used to perform the dual PNA detection reaction;

[0086] A detachable magnet is provided at the bottom or side of the magnetic enrichment area to fix the magnetic compound and complete the washing process;

[0087] The fluorescence detection window is used by mobile phones or portable fluorescence readers to collect fluorescence signals, and its fluorescence excitation module can use a 470~488nm LED light source;

[0088] The electrochemical detection area is equipped with a screen-printed three-electrode system for detecting the electrochemical response on the PNA-2 signal probe. The electrochemical detection area can be equipped with a portable electrochemical reader that is connected to a mobile phone or via Bluetooth. In terms of the selection of electrode material substrate, the standard screen-printed carbon electrode can be replaced with a gold electrode, an ITO electrode, a paper-based electrode, or a carbon nanotube modified electrode, a graphene modified electrode, or a gold nanoparticle modified electrode.

[0089] Example 6: This example illustrates the application of a dual-mode tetA gene detection method disclosed in this invention in water body detection. The difference from Example 5 lies in the fact that, while tetA is used as the primary example for target gene detection, the technical system can be fully extended to resistance genes or transmission risk indicator genes such as tetM, sul1, blaTEM, blaCTX-M, mcr-1, qnrS, ermB, and intI1. Furthermore, this invention has extremely high tolerance for different sample types, and the actual samples to be tested can be widely applied to various complex water quality environments, including river water, lake water, aquaculture wastewater, hospital wastewater, sewage treatment plant influent, sewage treatment plant effluent, reclaimed water, agricultural drainage, and aquaculture tailwater.

[0090] (1) Specific detection of tetA target fragment

[0091] With 10 5 Completely matched tetA double-stranded DNA (copies / mL) was used as a positive sample. The following control samples were also included: a tetA single-base mismatch fragment, a tetA two-base mismatch fragment, a tetM gene fragment, a sul1 gene fragment, a blaTEM gene fragment, and a blank sample. All samples underwent double PNA recognition, magnetic separation washing, fluorescence detection, and electrochemical detection according to the method described in Example 4. The relative response results for each control sample are shown in Table 2.

[0092] Table 2

[0093] Exact match tetA 100.0±4.2 100.0±3.7 tetA single base mismatch 30.8±3.1 27.9±2.8 tetA two-base mismatch 16.9±2.4 14.7±2.1 tetM 12.1±1.8 10.4±1.5 sul1 8.5±1.3 7.2±1.1 blaTEM 9.2±1.5 8.1±1.2 blank 5.0±0.8 4.7±0.7

[0094] As shown in Table 2, the fully matched tetA fragment produced significant fluorescence and electrochemical responses; the responses of single-base mismatch and two-base mismatch fragments were significantly reduced, indicating that the dual PNA invasion recognition system used in this invention can effectively distinguish the tetA target sequence from mismatched sequences and non-target resistance gene sequences, and has good sequence specificity.

[0095] (2) Spiked recovery detection of tetA gene in actual water samples

[0096] River water, hospital wastewater, and sewage treatment plant effluent were collected as actual water samples. 50 mL of each sample was filtered through a 0.22 μm filter membrane, and the membrane was then placed in 1 mL of lysis buffer. The lysis buffer consisted of 10 mM Tris-HCl, 1 mM EDTA, and 0.1% Triton X-100, with a pH of 8.0. The samples were lysed at 65 °C for 10 min, followed by sonication for 2 min. The supernatant was collected by centrifugation to obtain the DNA solution to be tested. 10⁴, 10⁵, and 10⁶ copies / mL of tetA double-stranded DNA standard fragments were added to the above water sample DNA solutions, respectively. Double PNA recognition, magnetic enrichment washing, fluorescence detection, and electrochemical detection were performed according to the method in Example 4. The results are shown in Table 3.

[0097] Table 3

[0098] River water <![CDATA[10 4 ]]> <![CDATA[9.4×10 3 ]]> 94.0 5.0 River water <![CDATA[10 5 ]]> <![CDATA[9.8×10 4 ]]> 98.0 4.2 River water <![CDATA[10 6 ]]> <![CDATA[1.03×10 6 ]]> 103.0 3.7 Hospital wastewater <![CDATA[10 4 ]]> <![CDATA[8.8×10 3 ]]> 88.0 7.8 Hospital wastewater <![CDATA[10 5 ]]> <![CDATA[9.3×10 4 ]]> 93.0 6.4 Hospital wastewater <![CDATA[10 6 ]]> <![CDATA[1.02×10 6 ]]> 102.0 5.3 Wastewater treatment plant effluent <![CDATA[10 4 ]]> <![CDATA[9.0×10 7 ]]> 90.0 6.7 Wastewater treatment plant effluent <![CDATA[10 5 ]]> <![CDATA[9.7×10 4 ]]> 97.0 5.5 Wastewater treatment plant effluent <![CDATA[10 6 ]]> <![CDATA[1.04×10 6 ]]> 104.0 4.8

[0099] As shown in Table 3, the spiked recovery rate of the method of the present invention in river water, aquaculture wastewater and sewage treatment plant effluent is 88.0-104.0%, and the RSD is 3.7-7.8%, indicating that the method can be applied to the detection of tetA gene in water samples with different complexities.

[0100] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A dual-mode detection method for the tetA gene, characterized in that: Includes the following steps, S1 Water Sample Pretreatment: The water sample to be tested is filtered to enrich microorganisms and nucleic acids, and after lysis treatment, the nucleic acid solution to be tested is obtained; S2 Preparation of PNA-1 Modified Magnetic Material: The biotinylated first peptide nucleic acid probe PNA-1 was immobilized on the surface of magnetic microspheres. After incubation, post-processing was performed to obtain PNA-1 modified magnetic material. S3 Dual PNA Intrusion Recognition Reaction: The nucleic acid solution to be tested obtained in S1, the PNA-1 modified magnetic material obtained in S2, and the PNA-2 signal probe carrying fluorescent groups and electrochemical labels are mixed in a hybridization buffer and hybridized so that PNA-1 and PNA-2 recognize and bind to the two complementary strands of the tetA gene double-stranded DNA target fragment, respectively, to obtain a magnetic PNA-1 / tetA DNA / PNA-2 complex; S4 Magnetic enrichment: The complex obtained in S3 is enriched by an external magnetic field in the magnetic enrichment region, and the supernatant is discarded. The complex is then washed with a washing solution to remove unbound substances and matrix interferences. S5 fluorescence detection: The complex washed with S4 is resuspended, placed in the fluorescence detection window, and the signal intensity of the fluorescent group on PNA-2 is excited and detected to achieve qualitative or semi-quantitative analysis of the tetA gene. S6 Electrochemical Detection: The complex washed in S4 is immobilized on the surface of the working electrode, and the response signal of the electrochemical marker on PNA-2 is detected through the electrochemical detection area. The quantitative analysis of the tetA gene is achieved according to the standard curve.

2. The method for dual-mode detection of the tetA gene according to claim 1, characterized in that: In S1, the filtration process includes using a 0.22 μm or 0.45 μm filter membrane to retain microorganisms, particulate-bound DNA, and intracellular resistance gene samples in the water sample to be tested.

3. The method for dual-mode detection of the tetA gene according to claim 1, characterized in that: In S1, the lysis process includes placing the filter membrane of the retained sample in a lysis buffer, which includes 10 mM Tris-HCl, 1 mM EDTA, 0.1% Triton X-100, pH=8.0, heating at 60~70℃ for 5~15 min, selectively supplemented with sonication for 1~5 min, and centrifuging to collect the supernatant.

4. The method for dual-mode detection of the tetA gene according to claim 1, characterized in that: In S2, the biotinylated first peptide nucleic acid probe PNA-1 is 0.05~5.00 μM Biotin-PEG6-PNA-1.

5. The method for dual-mode detection of the tetA gene according to claim 1, characterized in that: In S2, the incubation process includes incubation at 25~37°C for 15~60 minutes.

6. The method for dual-mode detection of the tetA gene according to claim 1, characterized in that: In S3, the PNA-2 signal probe is a 10~500nM FAM-PNA-MB.

7. The method for dual-mode detection of the tetA gene according to claim 1, characterized in that: In S3, the hybridization buffer contains 20 mM Tris-HCl, 20 mM KCl, 0~50 mM MgCl2, 0.01% Tween-20, and has a pH of 7.0~8.

5.

8. The method for dual-mode detection of the tetA gene according to claim 1, characterized in that: In S3, the hybridization process includes hybridization at 37~55℃ for 15~60 min.

9. A tetA gene detection kit, characterized in that: The method for implementing the tetA gene dual-mode detection method according to any one of claims 1 to 8 includes, PNA-1 modified magnetic materials are used to capture tetA target double-stranded DNA; The PNA-2 signal probe carries both a fluorescent group and an electrochemical label; Positive standard: tetA target double-stranded DNA standard; Negative controls are non-target ARGs fragments or mismatched tetA fragments; In addition, the detection chip includes a dual PNA intrusion recognition reaction region, a magnetic enrichment region, a fluorescence detection window, and an electrochemical detection region.

10. The application of the tetA gene detection kit according to claim 9 in water body detection.