Primers for Indel molecular markers used to identify rice grain length and their applications

Abstract

This invention belongs to the field of molecular marker-assisted breeding technology, specifically relating to primers for an Indel molecular marker used to identify rice grain length and their applications. The nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.4, wherein positions 297-333 of SEQ ID NO.4 have insertion / deletion variations. The molecular marker described in this invention is located at the Chr8:26913815 locus on rice chromosome 8. Based on this molecular marker, this invention provides a pair of specific primers. Using these specific primers to detect the molecular marker allows for the screening of long-grain rice varieties in the early stages of breeding. Using these varieties as parents can effectively improve the grain length of offspring, which has significant application value for accelerating the breeding of high-quality long-grain rice varieties.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology, specifically relating to primers for the Indel molecular marker used to identify rice grain length and their applications. Background Technology

[0002] Rice ( Oryza sativa As an important food crop, rice breeding has become a key focus, with the selection of rice varieties exhibiting excellent appearance, balanced cooking taste, and nutritional quality. Polished rice is the primary commercial form of rice, and appearance quality is its most important characteristic, primarily encompassing grain shape, chalkiness, and transparency; grain shape is determined by the length, width, and thickness of the grain. New rice varieties with superior appearance can better meet current demands. With the increasing acceptance of long-grain rice varieties such as Northeast fragrant rice and Thai fragrant rice, long-grain rice has become a typical characteristic of high-quality rice. Therefore, identifying genes that regulate grain length and applying them to rice breeding is crucial.

[0003] Currently, marker-assisted breeding has become an important means to improve the selection efficiency of rice grain length. Among them, InDel markers are widely used in rice genetic analysis and breeding practices due to their advantages such as high distribution density, high accuracy, good stability, and convenient detection. However, existing technologies still have the following shortcomings: 1) The number of reported InDel markers related to grain length is limited, and most are located in regions of a few known grain length genes, making it difficult to cover other important grain length regulatory sites in the rice genome. Different sites have different genetic effects on grain length, and a single marker often cannot fully reflect the complex genetic background of grain length. 2) Some existing markers detect insertion and deletion fragments of small length, requiring polyacrylamide gel electrophoresis or sequencing to accurately distinguish allelic variations, which is cumbersome, costly, and unsuitable for large-scale breeding screening. Therefore, developing a new strategy for markers of rice grain length traits has become a key technical problem that urgently needs to be solved in this field. Summary of the Invention

[0004] The purpose of this invention is to provide primers for Indel molecular markers used to identify the length of rice grains, thereby solving the problems existing in the prior art.

[0005] The technical solution adopted in this invention is: This invention provides primers for an Indel molecular marker used to identify the length of rice grains, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4, wherein positions 297-333 of SEQ ID NO.4 have insertion / deletion variations; when the fragment TAAAATTTCATCTTTTGTTTCTGCCTGTTGACTGTTG is deleted from positions 297-333 of SEQ ID NO.4 in rice, the grain length is longer than that of rice containing this fragment.

[0006] A second aspect of the present invention provides an application of the primer, wherein the application refers to at least one of the following: 1) Application in rice grain length identification; 2) Application in improving the grain length of rice offspring; When the TAAAATTTCATCTTTTGTTTCTGCCTGTTGACTGTTG fragment is deleted from positions 297 to 333 of SEQ ID NO.4 of rice, the grain length is longer than that of rice containing this fragment.

[0007] Preferably, the method for determining the length of rice grains is as follows: Genomic DNA was extracted from the rice samples to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; If the amplification product does not contain TAAAATTTCATCTTTTGTTTTGCCTGTTGACTGTTG, then the rice is a long-grain rice. The term "long grain" refers to grains with a length greater than 8.37 mm.

[0008] Preferably, the method for improving the grain length of rice offspring is as follows: Genomic DNA was extracted from the rice samples to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; By detecting the amplification products and selecting rice varieties that do not contain TAAAATTTCATCTTTTGTTTTGCCTGTTGACTGTTG as parents for breeding, the grain length of rice offspring can be improved.

[0009] Preferably, the reaction system for PCR amplification is as follows: 2 μL of 50 ng / μL genomic DNA, 0.3 μL of 10 μmol / L upstream primer, 0.3 μL of 10 μmol / L downstream primer, 10 μL of 2×EasyTaq PCR SuperMix, and water to a final volume of 20 μL.

[0010] Preferably, the PCR amplification procedure is as follows: Pre-denaturation at 94℃ for 3 minutes; Denaturation at 94℃ for 30 seconds, annealing at 55℃ for 30 seconds, extension at 72℃ for 30 seconds, for a total of 35 cycles; Extend the time to 72℃ for 5 minutes.

[0011] Preferably, the genomic DNA of the rice to be tested is derived from rice leaves.

[0012] Preferably, the method for detecting the amplification products is agarose gel electrophoresis or sequencing.

[0013] Compared with the prior art, the beneficial effects of the present invention are: This invention provides primers for an Indel molecular marker used to identify rice grain length. The nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.4, wherein positions 297-333 of SEQ ID NO.4 contain insertion / deletion variations. When the fragment TAAAATTTCATCTTTTGTTTCTGCCTGTTGACTGTTG is deleted from positions 297-333 of SEQ ID NO.4 in rice, the grain length is longer than that of rice containing this fragment. The molecular marker described in this invention is located at the Chr8:26913815 site on chromosome 8 of rice. Based on this molecular marker, this invention provides a pair of specific primers. PCR amplification of rice using these primers and detection of the products showed that rice varieties with an amplified product size of 445 bp had significantly shorter grain lengths than rice varieties with an amplified product size of 408 bp. The marker described in this invention detects insertion / deletion fragments of 37 bp, exhibiting significant differences. The two allelic variations can be clearly distinguished by ordinary agarose gel electrophoresis, requiring no expensive equipment or complex operations. This convenient and low-cost method is ideal for large-scale breeding screening. Secondly, this molecular marker enriches the existing resource library of grain length-related molecular markers, providing a more comprehensive reflection of the complex genetic background of rice grain length and effectively compensating for the insufficient coverage of existing markers. Using this molecular marker, long-grained rice varieties can be rapidly and accurately screened as parents in the early stages of breeding, thereby effectively improving the grain length of offspring and possessing significant application value for accelerating the breeding of high-quality long-grained rice varieties. Attached Figure Description

[0014] Figure 1The sequence alignment results for Hap1 and Hap2 molecular markers amplified.

[0015] Figure 2 The results are from PCR amplification using qGL8-Indel; where M is a 2000bp DNA ladder.

[0016] Figure 3 Comparison and significance analysis of grain length of Haidao 86, Nipponbare, and chromosome segment substitution lines; A: Comparison of grain lengths from different germplasm resources; B: Statistical results of graph A. Detailed Implementation

[0017] The present invention will be further illustrated below with specific embodiments, but these embodiments do not limit the scope of the invention. Modifications or substitutions to the details and form of the technical solutions of the present invention may be made without departing from the spirit and scope of the invention, but all such modifications or substitutions fall within the protection scope of the present invention.

[0018] The inventive concept of this invention is as follows: InDel markers, short for insertion / deletion markers, are PCR amplification markers based on specific primers designed for the sequences flanking nucleotide insertion / deletion sites. They are characterized by high density, accuracy, and stability. Currently, InDel markers are widely used in rice genetic analysis and molecular-assisted breeding. Researchers have already developed molecular markers related to rice grain length. For example, patent application number "201910628478.1" discloses an InDel molecular marker primer related to rice grain length, which can be used to identify rice grain length. However, the InDel markers reported in existing technologies are not located on the same chromosome as the InDel marker described in this invention, indicating that two different genes regulate grain length.

[0019] The list of abbreviations for this invention is shown in Table 1.

[0020] Table 1. List of abbreviations for this invention To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below with reference to specific embodiments. In the description of the present invention, unless otherwise specified, all reagents used are commercially available, and all methods used are conventional techniques in the art.

[0021] Example 1 A primer for an Indel molecular marker used to identify rice grain length and its application are detailed below: 1. Development of Indel molecular marker primers.

[0022] This invention analyzed the sequences of 504 representative core rice germplasms at the Chr8:26913815 locus and discovered two haplotypes: Of these, 326 germplasm resources had the sequence “TAAAATTTCATCTTTTGTTTCTGCCTGTTGACTGTTG”, and were named Hap1 type; the other 178 germplasm resources had the above 37bp sequence missing at this position, and were named Hap2 type.

[0023] SEQ ID NO. 1: TAAAATTTCATCTTTTGTTTCTGCCTGTTGACTGTTG.

[0024] This invention further investigated and statistically analyzed the grain length trait of all the core germplasm involved, and found that the grain length of Hap1 type was significantly smaller than that of Hap2 type. p <0.01.

[0025] Based on this mutation site, this invention designs a pair of Indel molecular marker primers for identifying Hap1 and Hap2 types, namely qGL8-Indel. The upstream primer sequence of qGL8-Indel is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3.

[0026] Upstream primer qGL8-Indel-F1, SEQ ID NO.2: 5'-AGCCTCTGCAAAGGATCCAC-3'.

[0027] Downstream primer qGL8-Indel-R1, SEQ ID NO.3: 5'-CAAACAACAGCAGCAAGGCT-3'.

[0028] Based on qGL8-Indel, representative core germplasm of rice was amplified. The Hap1 type can amplify a 445bp fragment, and the sequence information is shown in SEQ ID NO.4; the Hap2 type can amplify a 408bp fragment, and the sequence information is shown in SEQ ID NO.5.

[0029] The nucleotide sequence of the Hap1 molecular marker is shown in SEQ ID NO.4.

[0030] SEQ ID NO.4: AGCCTCTGCAAAGGATCCACTGAACCTTGTATCGCTCATGTGATGCTTCACTTGCTGGCAAATGCTGGATGCAGGAAATAAAATTATTGATCCATCCGTTGTAGCATCAACCGTTGAGATGGCCGAGTTGGTCTAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACATTATTTTTCTTATTTTTCCTCTGTTGCCTTTACTGCTATTGCTGCTAAAATTTCAACATTATTTTTCTTATTTTCCCCCTGTTGCCTTTACTGCTATTGCTGCTAAAATTTCATCTTTTGTTTCTGCCTGTTGACTGTTGTAAAATTTCATCTTTTGTTTCTGCCTGTTGACTGTTGTAATTCATATATTTTTTTAGCCTTTTCTGCTAAAAGTTCATCTGTTTTCTTTCGTAGCCTTGCTGCTGTTGTTTG, where the underlined part is the sequence deleted by the Hap2 molecular marker.

[0031] The nucleotide sequence of the Hap2 molecular marker is shown in SEQ ID NO.5.

[0032] SEQ ID NO.5: AGCCTCTGCAAAGGATCCACTGAACCTTGTATCGCTCATGTGATGCTTCACTTGCTGGCAAATGCTGGATGCAGGAAATAAAATTATTGATCCATCCGTTGTAGCATCAACCGTTGAGATGGCCGAGTTGGTCTAAGGCGCCAGATTAAGGTTCTGGTCCGAAAGGGCGTGGGTTCAAATCCCACTCTCAACATTATTTTTCTTATTTTTCCTCTGTTGCCTTTACTGCTATTGCTGCTAAAATTTCAACATTATTTTTCTTATTTTCCCCCTGTTGCCTTTACTGCTATTGCTGCTAAAATTTCATCTTTTGTTTCTGCCTGTTGACTGTTGTAATTCATATATTTTTTTAGCCTTTTCTGCTAAAAGTTCATCTGTTTTCTTTCGTAGCCTTGCTGCTGTTGTTTG.

[0033] 2. The above-mentioned Indel molecular marker primers were used to verify the populations of Nipponbare, Haidao 86 and their chromosome substitution lines.

[0034] The haplotype of Nipponbare is Hap1, and the haplotype of Haidao 86 is Hap2. Sequencing results are shown below. Figure 1 Based on Nipponbare and Haidao 86, and using Nipponbare as the recurrent parent, a chromosome segment substitution line population was constructed through hybridization and multiple generations of backcrossing, thereby creating three introductory lines containing the Hap1 type and three introductory lines containing the Hap2 type.

[0035] The three import lines containing Hap1 type are BA69, BA144 and BA151; the three import lines containing Hap2 type are BA56, BA68 and BA80.

[0036] The haplotypes of Nipponbare, Haidao 86, and chromosome segment substitution lines were verified using qGL8-Indel primers. The specific method is as follows: (1) Extraction of genomic DNA from rice leaves.

[0037] Young leaves from individual rice plants were selected, and genomic DNA was extracted using the SDS method. The specific steps are as follows: ① Place the leaf in a 2mL centrifuge tube, add 300μL of DNA extraction solution and one steel ball, and shake for 30s using a tissue homogenizer.

[0038] ② Place the centrifuge tubes in a 65℃ water bath for 30 minutes, inverting them three times during this period to mix them.

[0039] ③ Let it stand until room temperature, add an equal volume of chloroform, shake vigorously up and down to mix thoroughly.

[0040] ④ Centrifuge at 12000 rpm for 10 min, and aspirate about 200 μL of the supernatant into a new sterile 1.5 mL centrifuge tube.

[0041] ⑤ Add 200 μL of pre-cooled isopropanol and mix by inverting the container. Incubate at -20°C for 30 min to allow the DNA to precipitate completely.

[0042] ⑥ Centrifuge at 12000 rpm for 10 min, discard the supernatant, and rinse once with 500 μL of 75% ethanol.

[0043] ⑦ Centrifuge briefly at 12000 rpm, discard the supernatant, invert the centrifuge tube onto a paper towel, and let it stand for 2 minutes.

[0044] ⑧ After drying the DNA in the fume hood, add 1×TE buffer to dissolve the DNA.

[0045] ⑨ Store at -20℃ for later use.

[0046] (2) PCR amplification of Nipponbare, Haidao 86 and BC5F3 segregating populations was performed using qGL8-Indel.

[0047] PCR amplification was performed using qGL8-Indel, and the reaction system is shown in Table 2.

[0048] Table 2 PCR reaction system The PCR reaction procedure is as follows: Pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, for a total of 35 cycles; extension at 72℃ for 5 min.

[0049] (3) Agarose gel electrophoresis detection and genotype determination of amplification products.

[0050] The PCR amplification products were subjected to agarose gel electrophoresis and observed using a Junyi gel imaging system. The results showed that the Indel molecular marker primer qGL8-Indel described in this invention could amplify clear and bright bands in the rice population, and the fragment size was consistent with expectations. Figure 2 As shown. Figure 2 In the study, bands from Nipponbare and Haidao 86 were used as controls. The band size consistent with Nipponbare was identified as Hap1, and the band size consistent with Haidao 86 was identified as Hap2. Based on the results of qGL8-Indel primer detection, the results were 100% consistent with the actual haplotype results. The three introgression lines containing the Hap1 type, BA69, BA144, and BA151, amplified bands of 445bp, which is the same band type as the short-grain material Nipponbare. The three introgression lines containing the Hap2 type, BA56, BA68, and BA80, amplified bands of 408bp, which is the same band type as the long-grain material HD86.

[0051] 3. QTL mapping of grain length in populations of chromosome segment substitution lines Haidao 86 and Nipponbare.

[0052] One hundred plump, uniformly sized seeds were selected from each of the Haidao 86, Nipponbare, and replacement lines. Grain length was measured using a Wanshen seed analyzer, with three measurements taken for each replacement line. The results are shown in Table 3. Figure 3 As shown.

[0053] Table 3. Correlation between Indel molecular marker primer amplification band patterns and rice grain length Linkage analysis between seed weight, seed length, and molecular marker genotypes in rice populations revealed a strong linkage between the molecular markers and seed length. Therefore, the Indel molecular marker primers of this invention can be used for molecular-assisted breeding of rice.

[0054] As can be seen from the above embodiments, the Indel molecular marker primers and methods of the present invention can be used to identify the length of rice grains.

[0055] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0056] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A primer for identifying an Indel molecular marker of rice grain length, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4, wherein positions 297-333 of SEQ ID NO.4 have insertion / deletion variations.

2. Use of primers according to claim 1, characterized in that, The application refers to at least one of the following: 1) Application in rice grain length identification; 2) Application in improving the grain length of rice offspring; When the TAAAATTTCATCTTTTGTTTCTGCCTGTTGACTGTTG fragment is deleted from positions 297 to 333 of SEQ ID NO.4 of rice, the grain length is longer than that of rice containing this fragment.

3. Use according to claim 2, wherein the compound is ###0002### The method for determining the length of rice grains is as follows: Genomic DNA was extracted from the rice samples to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; If the amplification product does not contain TAAAATTTCATCTTTTGTTTTGCCTGTTGACTGTTG, then the rice is a long-grain rice. The term "long grain" refers to grains with a length greater than 8.37 mm.

4. The use according to claim 2, wherein The following methods can be used to improve the grain length of rice offspring: Genomic DNA was extracted from the rice samples to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; By detecting the amplification products and selecting rice varieties that do not contain TAAAATTTCATCTTTTGTTTTGCCTGTTGACTGTTG as parents for breeding, the grain length of rice offspring can be improved.

5. The application as described in claim 3 or claim 4, characterized in that, The reaction system for PCR amplification is as follows: 2 μL of 50 ng / μL genomic DNA, 0.3 μL of 10 μmol / L upstream primer, 0.3 μL of 10 μmol / L downstream primer, 10 μL of 2×EasyTaq PCR SuperMix, and water to a final volume of 20 μL.

6. The application as described in claim 3 or claim 4, characterized in that, The procedure for PCR amplification is as follows: Pre-denaturation at 94℃ for 3 minutes; Denaturation at 94℃ for 30 seconds, annealing at 55℃ for 30 seconds, extension at 72℃ for 30 seconds, for a total of 35 cycles; Extend the time to 72℃ for 5 minutes.

7. The application as described in claim 3 or claim 4, characterized in that, The genomic DNA of the rice to be tested was derived from rice leaves.

8. The application as described in claim 3 or claim 4, characterized in that, The amplification products were detected by agarose gel electrophoresis or sequencing.

Images