A rapid detection method for aflatoxin B1

Abstract

This invention belongs to the field of food testing technology and provides a rapid detection method for aflatoxin B1. This method is based on a bidirectional primer exchange reaction regulating an allosteric DNA-zyme coupled to a ZIF-8 fluorescent biosensor. The sensor of this invention has excellent analytical performance, with advantages such as fast detection speed, simple operation, low detection limit, high specificity, and high sensitivity. It can overcome the deficiencies and shortcomings of existing aflatoxin B1 detection methods, achieving rapid and accurate quantitative detection of AFB1 in agricultural products, and has potential application prospects in food safety monitoring and environmental testing.

Description

Technical Field

[0001] This invention belongs to the field of food testing technology, specifically relating to a fluorescent biosensor for detecting aflatoxin B1. Background Technology

[0002] Aflatoxin B1 (AFB1) is a highly toxic compound produced by fungi of the genus *Aspergillus*, posing a serious threat to human and animal health and has been classified as a Group 1 carcinogen by the International Agency for Research on Cancer (IARC). As a common fungal toxin, AFB1 is widely found in agricultural products such as corn and can damage the liver, kidneys, and immune system, posing a significant carcinogenic risk. Given its serious health hazards, developing highly sensitive and easy-to-use detection methods is of great importance. Currently, AFB1 detection mainly relies on methods such as high-performance liquid chromatography-mass spectrometry (HPLC-MS) and enzyme-linked immunosorbent assay (ELISA), but these techniques are complex, time-consuming, and require highly skilled equipment and operators. Existing aptamer sensors still have significant shortcomings in detecting AFB1: First, they suffer from poor stability and reproducibility, as the nucleic acid conformation of the aptamers is easily affected by pH, temperature, and food / oil matrices, leading to large batch-to-batch variations. Second, they have weak resistance to matrix interference; colorimetric or fluorescence methods exhibit strong background signals when detecting dark-colored samples, easily resulting in false positives. Third, most are designed for single targets, making it difficult to simultaneously detect multiple toxins. Fourth, the sensor construction process is complex, relying on expensive nanomaterials for modification, resulting in high costs and long processing times, limiting their application in rapid on-site detection. Therefore, establishing a simple, efficient, and highly specific ultrasensitive detection method is of great value for the accurate detection and effective control of biotoxins. Aptamers, after in vitro screening, can specifically recognize target molecules. Combined with isothermal nucleic acid amplification technology and nanomaterials, this provides a new technical approach for food safety and environmental risk detection. Summary of the Invention

[0003] To achieve a simple, efficient, and sensitive detection of aflatoxin B1 in maize samples, this invention provides a novel "OFF-ON" fluorescence sensing strategy based on bidirectional PER-regulated allosteric DNAzyme coupled with ZIF-8, thereby overcoming the deficiencies and shortcomings of existing detection methods.

[0004] To achieve the above objectives, the present invention adopts the following technical solution.

[0005] A biosensor for detecting aflatoxin B1 includes an Apt-T strand, D1-D2 strands, a primer, an S1 strand, an S2 strand, a fluorescent chain, a Bst DNA polymerase, dNTPs, and Mg. 2+ and ZIF-8; The Apt-T chain is formed by the hybridization of the aptamer Apt and the T chain; The D1-D2 chain is formed by the hybridization of the D1 chain and the D2 chain; The nucleotide sequences of the aptamer Apt, T chain, D1 chain, D2 chain, S1 chain, S2 chain, and fluorescent chain are shown in SEQ ID NO: 1-7, respectively; and, The deoxyriboses at positions 21 and 36 of the D1 chain are modified with 2'O-methyl groups; The 9th and 24th deoxyriboses of the D2 chain are modified with 2'O-methyl groups; The 3' end of the S2 chain is linked to reverse deoxythymidine; The 5' end of the fluorescent chain is modified with a fluorescent group, the 9th position is riboadecanoside, and the 3' end is linked to reverse deoxythymidine; The sequence for Primer is: CAAAAAAT.

[0006] Preferably, the fluorescent group is selected from FAM, HEX or Cy5.

[0007] The preparation method of the Apt-T chain includes the following steps: mixing equimolar amounts of aptamer Apt and T chain in a buffer solution, thermally denaturing and annealing.

[0008] The preparation method of D1-D2 includes the following steps: mixing D1 chains and D2 chains in an equimolar ratio in a buffer solution, thermally denaturing and annealing.

[0009] A kit containing the aforementioned biosensor.

[0010] The kit may also include the target aflatoxin B1 and / or a buffer solution.

[0011] A method for detecting aflatoxin B1 includes the following steps: ZIF-8 was added to the solution of the sample to be tested after co-incubation with the above biosensor at an appropriate temperature, and the fluorescence of the liquid was detected.

[0012] Compared to the blank test solution which does not contain aflatoxin B1, an increase in fluorescence intensity indicates the presence of aflatoxin B1 in the test sample.

[0013] The detection principle of this invention is as follows: Figure 1 As shown, the specific component sequence is as follows: Apt: 5'-GTTGGGCAGTGTGTTCTCTCTGTGTCTCGTCGCTTCGCTAGGCCC-3'; T: 5'-CCTAGCGAAACAGAGATTTAAACAGTGCC-3'; D1: 5'-TAGGGTGATGCATACGAGTC / Cm / CCGGTTTTTTGGGG / Gm / TCACTTGGATTTTTT GGGATCGCTGTGCTCTAAATTGTGCACCGGAAGCGATCCCAAAAAAT-3'; D2: 5'-CCAAGTGA / Cm / CCCTTTTTCCGGG / Gm / ACTGTTAGTCATCACCCTATCACTTGG-3'; S1: 5'-GACTCGTATGCATCACGGTTACACCCATGTTAGAGAAC-3'; S2: 5'-CACTGATCAGCGATTAACCGCCCTATCACT-Inverted dt-3'; Primer: 5'-CAAAAAAT-3'; Fluorescent chain: 5'-FAM-GTCTCTAT / rA / GGATCAGTG-Inverted dt-3'; This invention relates to a novel "off-on" fluorescence sensing strategy based on bidirectional primer exchange reaction-regulated allosteric DNAzyme coupling with ZIF-8. It utilizes the cleavage activity of the DNAzyme and the adsorption properties of ZIF-8 to achieve signal conversion, and achieves highly sensitive detection of aflatoxin B1 (AFB1) through a multiple signal amplification mechanism. The specific process is as follows: The arched probe Apt-T, composed of the aptamer Apt of AFB1 and a partially complementary T chain, is in a stable structure when there is no target. When the target AFB1 is present in the reaction system, the aptamer chain (Apt) binds specifically to the target, and the T chain is released. The free T strand opens the self-closing bidirectional PER hairpin structure D1-D2, activating the primer exchange reaction (PER) with the participation of Bst DNA polymerase, primers, and dNTPs, producing a large number of PER product fragments: D1': TAGGGTGATGCATACGAGT CCCCGG TTTTTT GGGGG TCACTTGG ATTTTTTGGGATCGCTTGTGCTCTAAATTGTGCACGG AAGCGATCC CAAAAAAT, D2':CCAAGTGACCCCCTTTTTTCCGGGGACTCGTATGCATCACCCTATCACTTGG, PER-21: CAAAAAAT CCAAGTGA PER-22: CAAAAAATCC AAGTGATAGGGTGATGCATACGAGTC; These fragments are partially complementary to the S1 and S2 chains, thereby bringing the S1 and S2 chains closer together to form a cleavage-active allosteric DNAzyme structure, in Mg 2+ The FAM fluorescent chain is cut short; the cut short FAM cannot be adsorbed onto the ZIF-8 surface, thus restoring the fluorescence signal and realizing the signal conversion and detection from "OFF" to "ON".

[0014] The present invention has the following advantages: The biosensor provided by this invention utilizes the specific recognition ability of aptamers for AFB1, combined with the precise nucleic acid cleavage activity of DNAzyme, to achieve highly specific detection of the target analyte, effectively avoiding the influence of other interfering substances in complex samples. Employing a dual signal amplification mechanism of bidirectional primer exchange reaction (B-PER) and DNAzyme cleavage, the detection sensitivity is significantly improved through cascade amplification, with a detection limit as low as 3.51 pg / mL. The introduction of ZIF-8 metal-organic framework material cleverly achieves "OFF-ON" fluorescence signal conversion by utilizing the difference in its adsorption capacity for long and short-chain nucleic acids, effectively reducing background signal interference. The entire detection process is completed in a homogeneous solution, eliminating the need for complex separation steps, making the operation simple and rapid, and the reaction conditions mild (37℃), demonstrating good practicality and operability. The ZIF-8 material has a simple synthesis method and good biocompatibility. The constructed biosensor strategy exhibits stable performance and can be applied to the detection of AFB1 in complex real-world samples such as corn and wine, with high recovery rates, showing promising practical application prospects. Attached Figure Description

[0015] Figure 1 This is a schematic diagram illustrating the working principle of a biosensor; Figure 2 The fluorescence response of biosensors constructed with different ZIF-8 concentrations to AFB1; Figure 3 The fluorescence response of the biosensor to AFB1 at different ZIF-8 adsorption times; Figure 4 The fluorescence response of the biosensor to AFB1 at different reaction times; Figure 5 The fluorescence response of the biosensor to AFB1 was constructed under different D1-D2 and Primer ratios. Figure 6 The fluorescence response of the biosensor to AFB1 was constructed under different fluorescent chain concentrations; Figure 7 The results show the response of the biosensor to different concentrations of AFB1 (A), the fluorescence intensity calibration curves of different concentrations of AFB1 at 520 nm (B), and the logarithmic curve of fluorescence intensity at 520 nm versus AFB1 concentration (C). Figure 8 It refers to the fluorescence intensity of the biosensor in response to different interfering substances, among which, p <0.001. Detailed Implementation

[0016] The present invention will be further described below with reference to the embodiments and accompanying drawings, but the present invention is not limited to the following embodiments.

[0017] Example 1: Construction of Biosensors (1) Preparation of Apt-T arched probe Commercial synthesis of the T-strand and aflatoxin aptamer Apt: Apt and the T DNA strands were mixed at the same molecular concentration in 1×NEBuffer 2.1 (10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl, 100 μg / mL recombinant albumin, pH=7.9), then heated to 95°C and held for 5 min, and then naturally cooled to room temperature to form a stable arched probe structure, which was stored at 4°C for later use.

[0018] (2) Preparation of bidirectional PER hairpin structure D1-D2 Commercially synthesized D1 and D2 chains were prepared according to the Apt-T method and stored at 4°C for later use.

[0019] (3) Preparation of ZIF-8 Zn(NO3)2·6H2O (25 mM, 7.5 mL) and 2-methylimidazole (25 mM, 7.5 mL) were mixed in methanol and the reaction was maintained at room temperature for 12 h. ZIF-8 was then collected by centrifugation (10000 g, 5 min), washed with methanol and centrifuged 3 times, and then dried under vacuum for 12 h.

[0020] (4) Construction of biosensors AFB1 (50 ng / mL, 3 μL) was added to a reaction mixture consisting of Apt-T (3 μL, 1 μM), D1-D2 (3 μL, 0.2 μM), Primer (3 μL, 10 μM), Bst DNA polymerase (3 μL, 8 U / μL), 10×Bst Buffer (3 μL), dNTP (3 μL, 10 mM), S1 (3 μL, 10 μM), S2 (3 μL, 10 μM), FAM fluorescent chain (3 μL, 20 μM), and 3 μL 1×NEBuffer 2.1 buffer. The mixture was incubated at 37°C for 60 min to obtain solution A. 100 μL of ZIF-8 (40 μg / mL) was mixed with solution A and reacted at 25°C for 10 min. The excitation wavelength was set to 488 nm, and the emission wavelengths between 500 and 650 nm were collected using a fluorescence spectrophotometer. The fact that the biosensor can respond to AFB1 indicates that the biosensor has been successfully constructed.

[0021] Example 2: Sensor Optimization and Performance Analysis 1. ZIF-8 concentration Determine the optimal ZIF-8 concentration for the reaction using the following steps: 50 μL of ZIF-8 at different concentrations (0-50 μg / mL) was mixed with fluorescent chains (2 μL, 20 μM) to obtain group a solutions; 50 μL of ZIF-8 at different concentrations (0-50 μg / mL) were mixed with Apt-T (3 μL, 1 μM), D1-D2 (3 μL, 0.2 μM), Primer (3 μL, 10 μM), Bst DNA polymerase (3 μL, 8 U / μL), 10×Bst Buffer (3 μL), dNTP (3 μL, 10 mM), S1 (3 μL, 10 μM), S2 (3 μL, 10 μM), and FAM fluorescent chain (2 μL, 20 μM) to obtain group b solutions; Fluorescence measurements were performed under identical conditions (excitation wavelength 488 nm, detection range 500-650 nm) to determine the optimal ZIF-8 concentration.

[0022] The results are as follows Figure 2 As shown, the fluorescence intensity gradually decreased with increasing ZIF-8 concentration, and almost stopped changing after the concentration reached 40 μg / mL.

[0023] 2. ZIF-8 adsorption time Determine the optimal adsorption time by following these steps: Add 3 μL of water to a reaction mixture consisting of Apt-T (3 μL, 1 μM), D1-D2 (3 μL, 0.2 μM), Primer (3 μL, 10 μM), Bst DNA polymerase (3 μL, 8 U / μL), 10×Bst Buffer (3 μL), dNTP (3 μL, 10 mM), S1 (3 μL, 10 μM), S2 (3 μL, 10 μM), FAM fluorescent chain (3 μL, 20 μM), and 3 μL of 1×NEBuffer 2.1 buffer. Incubate at 37°C for 60 min to obtain solution A. Solution A' was obtained by mixing 30 μL of water, 3 μL of FAM fluorescent chain (20 μM), and 3 μL of 1×NEBuffer 2.1 buffer and incubating at 37°C for 60 min. ZIF-8 (40 μg / mL, 50 μL) was mixed with solution A or solution A' and reacted at 25°C for 0 min, 10 min, 20 min, 30 min, 40 min, 50 min, and 60 min; fluorescence measurements were performed under identical conditions to determine the optimal quenching time.

[0024] The results are as follows Figure 3 As shown, the fluorescence intensity gradually decreased over time, and reached an equilibrium state at 10 min where it hardly changed. Therefore, 10 min was selected as the optimal adsorption time for the system.

[0025] 3. Optimal reaction time Determine the optimal reaction time by following these steps: AFB1 (50 ng / mL, 3 μL) was added to a reaction mixture consisting of Apt-T (3 μL, 1 μM), D1-D2 (3 μL, 0.2 μM), Primer (3 μL, 10 μM), Bst DNA polymerase (3 μL, 8 U / μL), 10×Bst Buffer (3 μL), dNTP (3 μL, 10 mM), S1 (3 μL, 10 μM), S2 (3 μL, 10 μM), FAM fluorescent chain (3 μL, 20 μM), and 3 μL 1×NEBuffer 2.1 buffer. The mixture was incubated at 37°C for 0 min, 30 min, 45 min, 60 min, 75 min, and 90 min to obtain solution A. ZIF-8 (40 μg / mL, 50 μL) was mixed with solution A and reacted at 25°C for 10 min for fluorescence detection.

[0026] The results are as follows Figure 4As shown, the fluorescence intensity gradually increased over time, and reached an equilibrium state at 60 min where it hardly changed. Therefore, 60 min was selected as the optimal reaction time for the system.

[0027] 4. Optimization of the ratio between D1-D2 and Primer Determine the optimal ratio of D1-D2 to Primer reaction by following these steps: Add AFB1 (50 ng / mL, 3 μL) to a reaction mixture consisting of Apt-T (3 μL, 1 μM), D1-D2 (3 μL, 0.2 μM), Primer (0.6 μL, 1.2 μL, 3.0 μL, and 6.0 μL respectively, corresponding to molar ratios of 1:10, 1:20, 1:50, and 1:100), Bst DNA polymerase (3 μL, 8 U / μL), 10× Bst Buffer (3 μL), dNTPs (3 μL, 10 mM), S1 (3 μL, 10 μM), S2 (3 μL, 10 μM), FAM fluorescent chain (2 μL, 20 μM), and 1× NEBuffer 2.1 buffer (to a total volume of approximately 30-40 μL). Incubate at 37°C for 60 min to obtain solution A; ZIF-8 (40 μg / mL, 50 Mix μL of the solution with solution A and react at 25°C for 10 min for fluorescence detection. The optimal molar ratio is determined by the one with the highest signal-to-noise ratio.

[0028] The results are as follows Figure 5 As shown, the fluorescence intensity gradually increased with the change of concentration ratio. The fluorescence intensity reached an equilibrium state at 1:50 and hardly changed. Therefore, 1:50 was selected as the optimal reaction concentration ratio of the system.

[0029] 5. Optimization of fluorescent chain concentration Determine the optimal fluorescent chain concentration for the reaction using the following steps: AFB1 (50 ng / mL, 3 μL) was added to a reaction mixture consisting of Apt-T (3 μL, 1 μM), D1-D2 (3 μL, 0.2 μM), Primer (3 μL, 10 μM), Bst DNA polymerase (3 μL, 8 U / μL), 10×Bst Buffer (3 μL), dNTP (3 μL, 10 mM), S1 (3 μL, 10 μM), S2 (3 μL, 10 μM), FAM fluorescent chain (3 μL, 10 μM, 20 μM, or 30 μM), and 3 μL 1×NEBuffer 2.1 buffer. After incubation at 37°C for 60 min, solution A was obtained. ZIF-8 (40 μg / mL, 50 μL) was mixed with solution A and reacted at 25°C for 10 min for fluorescence detection.

[0030] The results are as follows Figure 6 As shown, the fluorescence intensity gradually increased with the change in concentration, and reached an equilibrium state at 20 μM where it hardly changed anymore. Therefore, 20 μM was selected as the optimal reaction concentration for the system.

[0031] 6. Sensor detection limit Add 3 μL of water or AFB1 (0.01, 0.1, 1, 10, 50, 100, 200, 500 ng / mL) to a reaction mixture consisting of Apt-T (3 μL, 1 μM), D1-D2 (3 μL, 0.2 μM), Primer (3 μL, 10 μM), Bst DNA polymerase (3 μL, 8 U / μL), 10×BstBuffer (3 μL), dNTP (3 μL, 10 mM), S1 (3 μL, 10 μM), S2 (3 μL, 10 μM), FAM fluorescent chain (3 μL, 10 μM, 20 μM, or 30 μM), and 3 μL of 1×NEBuffer 2.1 buffer. Incubate at 37°C for 60 min to obtain solution A. Mix ZIF-8 (40 μg / mL, 50 μL) with solution A and react at 25°C for 10 min for fluorescence detection.

[0032] like Figure 7 As shown, within the concentration range of 0-500 ng / mL, the fluorescence intensity generated by the biosensing strategy gradually increased with the gradual increase of the AFB1 concentration in the reaction system. A logarithmic curve was plotted between the concentration and its fluorescence intensity at 525 nm, showing a good linear correlation. The linear regression equation was Y = 12.43941lgC + 395.98172 (R²). 2=0.9901). The limit of detection (LOD) was calculated to be 3.506 pg / mL based on the 3σ / k principle of the blank response. Therefore, this biosensing strategy is feasible for detecting AFB1 and exhibits good selectivity and sensitivity.

[0033] 7. Sensor specificity Prepare test samples as follows: Select a mixed sample of OTA, ZEN, MC-LR, STX, or the above four toxins and AFB1, and then perform the test according to the following method: 3 μL of different detection samples were added to a reaction mixture consisting of Apt-T (3 μL, 1 μM), D1-D2 (3 μL, 0.2 μM), Primer (3 μL, 10 μM), Bst DNA polymerase (3 μL, 8 U / μL), 10×Bst Buffer (3 μL), dNTP (3 μL, 10 mM), S1 (3 μL, 10 μM), S2 (3 μL, 10 μM), FAM fluorescent chain (3 μL, 10 μM, 20 μM, or 30 μM), and 3 μL 1×NEBuffer 2.1 buffer. After incubation at 37°C for 60 min, solution A was obtained. ZIF-8 (40 μg / mL, 50 μL) was mixed with solution A and reacted at 25°C for 10 min for fluorescence detection.

[0034] The results are as follows Figure 8 As shown, only the mixed samples and positive samples containing the target analyte produced strong fluorescence signals, while other samples without AFB1 produced extremely weak, almost negligible fluorescence signals. This demonstrates that the designed biosensing strategy has good selectivity for AFB1 and can specifically detect AFB1 in complex samples.

[0035] Example 3: Sensor Detection of Actual Samples Commercially available corn flour was selected as a representative sample, dried at low temperature to constant weight, and the detection of AFB1 in actual samples was verified using the spiking method. 1. Preparation of substrate solution Corn flour was extracted using a methanol-deionized water mixture. After mixing the sample with the extract, the mixture was shaken for 30 min to ensure the full release of the target substances from the sample into the extract. Subsequently, the shaken mixture was centrifuged at 12000 g in a high-speed refrigerated centrifuge to remove solid impurities. After centrifugation, the supernatant was collected and filtered through a 0.45 μm filter membrane to further purify the sample solution and obtain the base solution.

[0036] 2. Spike testing In the base solution, respectively according to the table The amount added to AFB1 stock solution was increased to obtain the test solution, and then tested according to the following two methods: Method 1: 3 μL of the test solution with different spiking volumes was added to a reaction mixture consisting of Apt-T (3 μL, 1 μM), D1-D2 (3 μL, 0.2 μM), Primer (3 μL, 10 μM), Bst DNA polymerase (3 μL, 8 U / μL), 10×Bst Buffer (3 μL), dNTP (3 μL, 10 mM), S1 (3 μL, 10 μM), S2 (3 μL, 10 μM), FAM fluorescent chain (3 μL, 10 μM, 20 μM, or 30 μM), and 3 μL 1×NEBuffer 2.1 buffer. After incubation at 37°C for 60 min, solution A was obtained. ZIF-8 (40 μg / mL, 50 μL) was mixed with solution A and reacted at 25°C for 10 min for fluorescence detection.

[0037] Method 2: The same samples were tested using high performance liquid chromatography-fluorescence detection (HPLC-FL). Table 1 Spike recovery rate of biosensors The results are shown in Table 1. The recovery rate of the biosensor constructed using this invention was 92.33%-104.00%, which is consistent with the HPLC-FL results. This indicates that the fluorescence biosensing strategy has good accuracy and reliability for the analysis and detection of AFB1 in actual samples.

Claims

1. A biosensor for detecting aflatoxin B1, characterized in that, Includes Apt-T strand, D1-D2 strand, Primer, S1 strand, S2 strand, fluorescent strand, Bst DNA polymerase, dNTPs, and Mg. 2+ and ZIF-8; The Apt-T chain is formed by the hybridization of the aptamer Apt and the T chain; The D1-D2 chain is formed by the hybridization of the D1 chain and the D2 chain; The nucleotide sequences of the aptamer Apt, T chain, D1 chain, D2 chain, S1 chain, S2 chain, and fluorescent chain are shown in SEQ ID NO:1-7, respectively; and, The deoxyriboses at positions 21 and 36 of the D1 chain are modified with 2'O-methyl groups; The deoxyriboses at positions 9 and 24 of the D2 chain are modified with 2'O-methyl groups; The 3' end of the S2 chain is linked to reverse deoxythymidine; The 5' end of the fluorescent chain is modified with a fluorescent group, the 9th position is riboadecanoside, and the 3' end is linked to reverse deoxythymidine; The nucleotide sequence of Primer is: CAAAAAAT.

2. The biosensor for detecting aflatoxin B1 according to claim 1, characterized in that, The fluorescent group is selected from FAM, HEX or Cy5.

3. The biosensor for detecting aflatoxin B1 according to claim 1, characterized in that, The preparation method of the Apt-T chain includes the following steps: mixing equimolar amounts of aptamer Apt and T chain in a buffer solution, thermally denaturing and annealing.

4. The biosensor for detecting aflatoxin B1 according to claim 1, characterized in that, The preparation method of D1-D2 includes the following steps: mixing D1 chains and D2 chains in an equimolar ratio in a buffer solution, thermally denaturing and annealing.

5. A kit comprising the biosensor as described in any one of claims 1-4.

6. The reagent kit according to claim 5, characterized in that, The kit also includes the target aflatoxin B1 and / or a buffer solution.

7. A method for detecting aflatoxin B1, characterized in that, Includes the following steps: ZIF-8 was added to the solution of the sample to be tested after co-incubation with the biosensor as described in any one of claims 1-4 at an appropriate temperature, and the fluorescence of the liquid was detected.

Images