Application of KDR activators in improving the hypoxia tolerance of fish

Abstract

This invention discloses the application of a vascular endothelial growth factor receptor 2 (KDR) activator in improving the hypoxia tolerance of fish, belonging to the field of biology. Addressing the problem of high mortality rates in laboratory-bred zebrafish due to hypoxia stress and the lack of endogenous molecular intervention methods, this invention provides a technical solution to improve the hypoxia tolerance of cultured fish by short-term induction intervention through exogenous application of the KDR activator KLTWQELYQLKYKGI. This method is simple to operate, low in cost, does not involve permanent genomic alterations, and can effectively prolong the survival time of fish in hypoxic environments, providing a new molecular intervention pathway for the control of hypoxia stress in laboratory model fish.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of a vascular endothelial growth factor receptor 2 (KDR) activator in improving the hypoxia tolerance of laboratory-cultured fish. Background Technology

[0002] Zebrafish are internationally recognized model organisms, often referred to as "water mice." Currently, zebrafish used in laboratories are standardized strains cultured in captivity. The demand for these strains is high, and the culture systems are mature, enabling high-density artificial breeding. However, with global warming and increasing stocking densities in laboratories, drastic fluctuations in dissolved oxygen levels have become a core environmental stressor limiting the development of zebrafish laboratory culture. Hypoxia not only induces respiratory disorders and stunted growth in fish but also frequently leads to mass mortality due to acute hypoxia. Therefore, improving the hypoxia tolerance of laboratory-cultured fish is of great significance.

[0003] In fish, oxygen uptake, transport, and tissue perfusion are crucial factors determining their survival rate under hypoxic stress. Vascular endothelial growth factor receptor 2 (KDR, also known as VEGFR2) is a major functional receptor in the VEGF family, and its core functions are closely related to angiogenesis, endothelial cell proliferation, and migration. The activity of the KDR pathway directly determines the angiogenesis and development of the animal's respiratory organs and the efficiency of oxygen transport. The applicant's previous comparative genomics analysis showed that the kdr gene is a rapidly evolving gene in the hypoxic-tolerant loach (Misgurnus anguillicaudatus), suggesting that this gene has undergone positive selection pressure during hypoxic adaptation and is highly conserved in bony fishes.

[0004] Currently, interventions for hypoxic stress in fish mainly rely on physical aeration and optimized aquaculture management, lacking proactive intervention strategies based on endogenous molecular pathways. In recent years, researchers have begun to use zebrafish as a model organism to establish hypoxia research models to explore hypoxia adaptation mechanisms. For example, existing studies have used transgenic zebrafish models to screen hypoxia protective drugs targeting HIF-1α (Wang Miaomiao et al., Constructing hypoxia-responsive transgenic zebrafish using the Tol2 transposon system [J]. Chinese Marine Drugs, 2024, 43(4): 60-66), or used chemical inhibitors to explore the role of specific signaling pathways in hypoxia response (Li J, Zhou Z. Zebrafish usp3 loss promotes hypoxictolerance by disrupting deubiquitination of K63-polyubiquitinated hif-1αa [J]. Water Biology and Security, 2024). These studies have shown that, under strictly controlled laboratory conditions, chemical intervention strategies are an effective means of elucidating the regulatory mechanisms of hypoxia signaling pathways.

[0005] However, current technologies do not yet provide a safe and efficient method to enhance hypoxia tolerance in fish through exogenous activation of the KDR pathway. In particular, while KDR activators (such as the VEGF mimic peptide KLTWQELYQLKYKGI) have shown potential for activating the KDR pathway in mammalian studies, their application prospects in aquatic organisms remain unclear. More importantly, once these bioactive peptides are released into natural water bodies, their environmental fate, ecotoxicity, and potential impacts on non-target aquatic organisms lack systematic assessment, leading to certain ecological safety risks.

[0006] Based on the above considerations, this invention aims to establish a laboratory intervention model that can significantly upregulate kdr gene expression and prolong the survival time of fish under hypoxia by treating with KDR activators. This provides technical support for in-depth research on the molecular regulatory mechanism of the KDR pathway in fish hypoxia adaptation and lays the foundation for the future development of more environmentally friendly stress-resistance improvement strategies. Summary of the Invention

[0007] The purpose of this invention is to provide an application of a vascular endothelial growth factor receptor 2 (KDR) activator in improving the hypoxia tolerance of fish. This invention aims to artificially upregulate the transcriptional level of the fish KDR gene through chemical induction, thereby prolonging the survival time of fish under acute hypoxia, and providing a safe and efficient technical solution for the control of hypoxia stress in laboratory model fish.

[0008] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: This invention provides the application of a vascular endothelial growth factor receptor 2 activator in the preparation of a formulation for improving the hypoxia tolerance of cultured fish.

[0009] Furthermore, the present invention also provides a method for improving the hypoxia tolerance of cultured fish under laboratory conditions, comprising: applying an effective amount of KDR activator to the laboratory culture water to induce intervention in the fish, artificially upregulating the expression level of the kdr gene in the fish, thereby enhancing the physiological tolerance of the fish to hypoxia stress.

[0010] In the above applications, the KDR activator is preferably a VEGF mimic peptide with the amino acid sequence KLTWQELYQLKYKGI (SEQ ID NO: 1) and CAS accession number 917760-16-8. This mimic peptide can specifically bind to and activate the KDR receptor, thereby initiating downstream signal transduction pathways and upregulating the transcriptional expression of the kdr gene.

[0011] In the above applications, the working concentration of the KDR activator in the culture water is preferably 1 μM to 50 μM, more preferably 10 μM. Within this concentration range, the activator can effectively enter the gill tissue of the fish and exert its biological function, without causing significant acute toxicity or stress response in the fish.

[0012] In the above applications, the formulation includes an effective dose of vascular endothelial growth factor receptor 2 activator and a carrier or excipient acceptable for aquaculture.

[0013] In the above applications, the cultured fish is preferably zebrafish, but not limited to zebrafish. Based on the following reasons, the technical solution described in this invention is also applicable to other bony fish: (1) Comparative genomics analysis shows that the kdr gene is highly conserved in bony fish, with its coding region sequence similarity typically exceeding 85%, and key functional domains being almost identical. This indicates that the binding sites of KDR activators and KDR receptors are widely conserved in bony fish. (2) The KDR / VEGFR2 signaling pathway is a core conserved pathway for vascular development and hypoxia response in vertebrates. In various bony fish species (such as loach, medaka, carp, crucian carp, tilapia, etc.), the activation patterns of the KDR pathway under hypoxia conditions are highly similar. Therefore, the strategy of upregulating kdr expression through KDR activators has cross-species transferability.

[0014] The beneficial effects of this invention are: This invention establishes for the first time a fish hypoxia tolerance chemical intervention model based on KDR activators, filling the technological gap in the current field where fish hypoxia tolerance can be targeted and improved through exogenous KDR activators. This method does not involve permanent alterations to the fish genome, achieving phenotypic improvement entirely through exogenous chemical induction, thus avoiding the ecological risks and ethical controversies that may arise from gene editing technology.

[0015] This invention requires no complex equipment or operating procedures and can be directly integrated into existing laboratory aquaculture management systems. Experimental water is treated before discharge, effectively preventing the leakage of peptides into natural water bodies and overcoming the ecological safety risks associated with directly applying such activators to open aquaculture water bodies. In mammals, no cases of reproductive toxicity have been reported with this mimic peptide, and it can be broken down into non-toxic small-molecule amino acids by microorganisms in the environment, ultimately metabolizing into CO2 and H2O, without leading to long-term residues or accumulation in the ecosystem.

[0016] This invention provides a novel molecular intervention pathway for the study of hypoxia stress control and resistance mechanisms in laboratory model fish, and lays a theoretical and technical foundation for the future development of more environmentally friendly aquaculture resistance strategies. Attached Figure Description

[0017] Figure 1 Effects of mimic peptide treatment on kdr gene expression in zebrafish gill tissue. The results showed that, compared with the control group, the mRNA expression level of the kdr gene in the gill tissue of zebrafish treated with 10 μM mimic peptide was significantly upregulated (P<0.001).

[0018] Figure 2 Effect of peptide-mimicking treatment on survival time of zebrafish under hypoxic stress. The results showed that, compared with the control group, the average survival time of zebrafish treated with 10 μM peptide-mimicking treatment was significantly prolonged under 5% O2 hypoxia (P<0.001). Detailed Implementation

[0019] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0020] Example 1 1. Experimental Materials Experimental animals: Healthy 3-month-old wild-type zebrafish (WT) from the College of Fisheries, Huazhong Agricultural University. Prior to the experiment, they were acclimatized for two weeks in flowing water in square glass tanks at a water temperature of 28±0.5℃, pH of 7.6±0.1, a photoperiod of 14 h light followed by 10 h darkness, and dissolved oxygen of (6.5±0.5) mg / L. They were fed freshly hatched standard feed (brine shrimp feed) using a saturation feeding method. All experimental procedures complied with the relevant animal management regulations of Huazhong Agricultural University.

[0021] Main reagents: KDR activator KLTWQELYQLKYKGI (purchased from MedChemExpress, USA), RNA extraction reagent (TaKaRa RNAiso Plus), reverse transcription and qPCR kit (TaKaRa).

[0022] Main instruments: tissue homogenizer, low-temperature high-speed centrifuge, real-time quantitative PCR instrument (AppliedBiosystems QuantStudio series), micro spectrophotometer.

[0023] 2. Experimental Methods 2.1 Experimental Grouping and Processing WT zebrafish were randomly divided into two groups: a control group placed in 500 mL of water, and a treatment group where a 30 mM stock solution of KLTWQELYQLKYKGI was prepared using pure water (ddH2O). This stock solution was then diluted in the culture water to achieve a final working concentration of 10 μM, with a volume of 500 mL. Each group had three replicates, with six zebrafish per replicate. The water was kept still during the treatment period, and half of the water was replaced every 48 hours for four consecutive days.

[0024] 2.2 Sample Collection and Gene Expression Analysis Four days after treatment, three zebrafish from each group were euthanized, and their gill tissue was quickly dissected, flash-frozen in liquid nitrogen, and stored at -80°C.

[0025] 2.2.1 Total RNA Extraction Total RNA was extracted from zebrafish gill tissue using TaKaRa RNAiso Plus reagent. The specific steps are as follows: 1) On the 4th day after treatment, zebrafish from each group were euthanized, and gill tissue was quickly dissected, flash-frozen in liquid nitrogen, and stored at -80℃ or RNA was directly extracted. 30mg and 50mg of tissue samples were placed in 2mL centrifuge tubes, which were then placed in an ice bath. 1.5mL of RNAiso Plus reagent and 3 zirconium oxide beads that had been soaked in DEPC water overnight and autoclaved were added beforehand. The mixture was then homogenized using a tissue homogenizer until it became clear and free of particles. 2) Add chloroform to the above homogenate lysis buffer, the amount of which is 1 / 5 of the volume of RNAiso Plus reagent. Cover the centrifuge and shake vigorously by hand for 15 seconds. After the emulsification is complete, let it stand at room temperature for 5 minutes. 3) Transfer the centrifuge tubes to a low-temperature high-speed centrifuge and centrifuge at 12000 r / min and 4℃ for 15 min; 4) Carefully remove the centrifuge tube from the centrifuge. At this point, the homogenate will be divided into three layers: a colorless supernatant, a middle white protein layer, and a lower organic layer with a bright red color. Transfer the supernatant to another new centrifuge tube. 5) Add an equal volume of isopropanol to the supernatant, mix thoroughly, and let stand at room temperature for 10 minutes; 6) When centrifuged at 12000 r / min in a low-temperature centrifuge, a precipitate will appear at the bottom of the test tube; 7) Washing of RNA precipitate: Carefully discard the supernatant, slowly add 1 mL of 75% ethanol solution along the tube wall, gently invert to mix and wash the tube wall, centrifuge at 12000 r / min and 4℃ for 5 min, and carefully discard the ethanol. 8) Dry the precipitate at room temperature in a clean bench for 25 min, then add 10-20 µL of RNase-free water to dissolve the precipitate; 9) Take 12 µL of the fully dissolved RNA sample and detect the RNA extraction results by 12% agarose gel electrophoresis; 10) Take 12 µL of the fully dissolved RNA sample and use a UV spectrophotometer to detect the RNA concentration and purity.

[0026] After passing quality tests by agarose gel electrophoresis and spectrophotometry, cDNA was synthesized using the PrimeScript™ 1stStrand cDNA Synthesis Kit.

[0027] 2.2.2 cDNA Synthesis 1) Removal of genomic DNA Prepare the following reaction mixture in a dedicated RNA extraction centrifuge tube: Total RNA 1 µg; 5×gDNA Eraser Buffer 2 µL; gDNA Eraser 1 µL; RNase-free Water to a final volume of 10 µL. Incubate the reaction mixture at 42°C for 2 min on a PCR instrument, then rapidly cool it on ice to prevent RNA thermal degradation.

[0028] 2) Reverse transcription of cDNA Prepare the following reaction mixture in a separate centrifuge tube specifically for RNA extraction: 10 µL of the reaction solution from the previous step; 4 µL of RNase-free Water; 4 µL of 5× Prime Script Buffer; 1 µL of RT Primer mix; and 1 µL of Primer Script RT Enzyme Mix I. Mix thoroughly and run the following PCR program in a PCR instrument: 37℃ for 15 min; 85℃ for 5 s; stop at 4℃. This will yield the zebrafish gill tissue cDNA template.

[0029] 2.2.3 Real-time quantitative PCR (qPCR) Specific primers were designed based on the conserved sequence of the zebrafish kdr gene (GenBank accession number: NM_001024653).

[0030] KDR upstream primer: CCAATGAGACAGGCGAATACC (SEQ ID NO: 2) KDR downstream primer: CCTCCACAGACACCAGACAG (SEQ ID NO: 3) Primers for the internal reference gene β-actin: Upstream: TTCCTGGGTATGGAGTCTTGCG (SEQ ID NO: 4) Downstream: AGAGGTTTAGGTTGGTCGTTT (SEQ ID NO: 5) qPCR reaction system (10 μL): 5 μL SYBR Premix Ex Taq™ II (2×), 0.4 μL each of forward and reverse primers, 1 μL cDNA template, and RNase-free water to a final volume of 10 μL. Reaction program: 95℃ pre-denaturation for 30 s; 95℃ for 5 s, 60℃ for 30 s, for a total of 40 cycles; finally, melting curve analysis was performed. 2... The relative expression level of the kdr gene was calculated using the ΔΔCt method.

[0031] 2.3 Hypoxia tolerance test (hypoxia stress test) After the initial treatment, three zebrafish from each group were used for hypoxia stress experiments. The zebrafish were placed in conical flasks containing 200 mL of aerated water and placed in a hypoxia workstation (Ruskinn INVIVO2 I-300) for hypoxia treatment at 5% O2 and 28°C. The behavior of the zebrafish was closely monitored during the treatment, and the time when the zebrafish completely lost balance was recorded as the time of death. The average survival time of each group was calculated.

[0032] 2.4 Data Processing Experimental data are expressed as mean ± standard error. Independent samples t-tests were performed using SPSS software, with P < 0.05 as the criterion for statistical significance.

[0033] 3. Experimental Results 3.1 The mimic peptide significantly upregulated the expression of the kdr gene in the gill tissue of zebrafish. like Figure 1 As shown, compared with the control group, the mRNA expression level of the kdr gene in the gill tissue of zebrafish treated with KLTWQELYQLKYKGI was significantly upregulated at the sampling time (day 4 after treatment) (P<0.001), indicating that 10 μM KLTWQELYQLKYKGI treatment can effectively activate the kdr signaling pathway in zebrafish.

[0034] 3.2 The mimic peptide significantly prolonged the survival time of zebrafish under hypoxic stress. like Figure 2 As shown, in the hypoxic stress experiment, the average survival time of zebrafish in the KLTWQELYQLKYKGI treatment group reached (300±20 min), which was significantly higher than that in the control group (140±20 min) (P<0.001). This indicates that short-term treatment with KLTWQELYQLKYKGI activates the KDR pathway and can significantly enhance the survival ability of zebrafish under hypoxic conditions.

Claims

1. Application of vascular endothelial growth factor receptor 2 activator in the preparation of formulations to improve the hypoxia tolerance of cultured fish.

2. The application according to claim 1, characterized in that, The vascular endothelial growth factor receptor 2 activator is a mimic peptide with the amino acid sequence shown in SEQ ID NO:

1.

3. The application according to claim 1, characterized in that, The formulation comprises an effective dose of vascular endothelial growth factor receptor 2 activator and an acceptable carrier or excipient.

4. The application according to claim 2, characterized in that, The working concentration of the simulated peptide in the culture water is 1 μM to 50 μM.

5. The application according to claim 4, characterized in that, The working concentration of the simulated peptide in the culture water is 10 μM.

6. The application according to claim 1, characterized in that, The fish being cultured is zebrafish.

Images