Application of IACS-010759 in the preparation of drugs for treating diabetic nephropathy

CN122557550APending Publication Date: 2026-08-14HANGZHOU INST FOR ADVANCED STUDY UCAS
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-26
Publication Date
2026-08-14

AI Technical Summary

Technical Problem

[0006]化合物IACS-010759是一种口服有效的线粒体氧化磷酸化复合物I(OXPHOS)抑制剂,通过靶向NADH醌脱氢酶1(NQO1)破坏线粒体膜电位,目前研究表明其具有抗癌活性,主要针对血液系统恶性肿瘤和实体瘤(Jennifer R Molina,et al.An inhibitor ofoxidative phosphorylation exploits cancer vulnerability.Nat Med.2018Jul;24(7):1036-1046.),并且已完成针对晚期实体瘤和淋巴瘤的I期临床试验,具有良好的安全性,同时IACS-010759此前未披露出存在和UT相关或和免疫炎症相关的报道

Benefits of technology

[0021] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention utilizes modern biological techniques and in vitro experiments to conduct preliminary studies on the function of compound IACS-010759 in diabetic nephropathy. It was found that treatment with compound IACS-010759 significantly inhibited palmitic acid (PA)-induced inflammatory responses and ligand URP-induced inflammatory responses in in vitro tubular epithelial cells (TECs) at both the gene and protein levels. Therefore, treatment with compound IACS-010759 can be considered a novel method for treating diabetic nephropathy. Thus, compound IACS-010759 shows promising application potential in the preparation of drugs for treating diabetic nephropathy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122557550A_ABST
    Figure CN122557550A_ABST
Patent Text Reader

Abstract

This invention discloses the application of compound IACS-010759 in the preparation of drugs for treating diabetic nephropathy. Compound IACS-010759 treats diabetic nephropathy by antagonizing the activation of downstream inflammatory signaling pathways mediated by caustic vasopressin II receptor, inhibiting palmitic acid-induced inflammatory responses and caustic vasopressin II-related peptide-induced inflammatory responses in renal tubular epithelial cells in vitro, thus providing new evidence for the treatment of diabetic nephropathy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical engineering technology, specifically to the application of IACS-010759 in the preparation of drugs for treating diabetic nephropathy. Background Technology

[0002] Diabetic nephropathy is a chronic kidney disease caused by diabetes mellitus and a serious complication of diabetic microvascular complications. It has become the leading cause of end-stage renal disease. As the disease progresses, the kidneys undergo various changes, primarily manifested as extracellular matrix (ECM) deposition, pathological thickening of the glomerular basement membrane, and tubular atrophy, ultimately leading to irreversible glomerular sclerosis and renal interstitial fibrosis. These pathological changes result in clinical manifestations characterized by progressive proteinuria, refractory hypertension, and progressive renal function decline. Current clinical management strategies follow a three-tiered prevention system, focusing on metabolic regulation and management of multiple risk factors. Drug treatment regimens mainly utilize diabetes medications with cardioprotective and renal-protective effects. However, existing therapies still have significant limitations in reversing key pathological processes such as renal fibrosis, necessitating more precise pathology-guided treatment strategies.

[0003] The pathological progression of diabetic nephropathy is driven by a cascade of inflammatory responses. Its molecular pathological pathway can be summarized as follows: high glucose toxicity synergistically induces glomerular endothelial cell damage through three key axes: metabolic disorder axis (abnormal activation of the polyol / hexosamine pathway); glycosylation stress axis (AGEs-RAGE signaling cascade amplification); and hemodynamic axis (pathological increase in glomerular capillary transmembrane pressure). This process is accompanied by the expression of adhesion molecules and chemokines, prompting monocytes and macrophages to migrate directionally into the renal interstitium and differentiate into pro-inflammatory phenotypes. All three upstream pathways lead to the activation of downstream inflammatory signaling pathways, continuously amplifying local renal inflammatory damage through feedback mechanisms. This vicious cycle directly results in abnormal accumulation of extracellular matrix and irreversible interstitial fibrosis. Recent research confirms that renal tubular epithelial cells are the initiating link in triggering early renal interstitial immune microenvironment dysregulation, a finding that provides a theoretical basis for treatment and intervention in the disease progression.

[0004] Breakthrough clinical studies in recent years have found that fenelazol, a third-generation nonsteroidal mineralocorticoid receptor antagonist, can alleviate the progression of kidney inflammation and fibrosis by targeting and blocking the abnormal activation of mineralocorticoid receptors in renal tissue and inhibiting the activation of downstream inflammatory signaling pathways.

[0005] Urotensin II receptor (UT) has been identified as a potential intervention target. UT, its endogenous ligand urotensin II (UII), and urotensin II-related peptide (URP) together constitute the UII / UT system. UT and its ligand are highly expressed in the kidney, and their pro-inflammatory and pro-fibrotic properties have been confirmed in cell models. Furthermore, gene silencing experiments have shown that this system participates in the progression of diabetic nephropathy through an immune-inflammatory pathway (LANGHAM RG, et al. Increased expression of urotensin II and urotensin II receptor in human diabetic nephropathy. American Journal of Kidney Diseases, 2004, 44(5):826-831.).

[0006] Compound IACS-010759 is an orally effective inhibitor of mitochondrial oxidative phosphorylation complex I (OXPHOS). It disrupts mitochondrial membrane potential by targeting NADHquinone dehydrogenase 1 (NQO1). Current research indicates that it has anticancer activity, mainly targeting hematologic malignancies and solid tumors (Jennifer R Molina, et al. An inhibitor of oxidative phosphorylation exploits cancer vulnerability. Nat Med. 2018 Jul; 24(7):1036-1046.). It has completed a phase I clinical trial for advanced solid tumors and lymphomas, showing good safety. In addition, there have been no previous reports of IACS-010759 being associated with UT or immune inflammation. Summary of the Invention

[0007] To address the aforementioned technical problems, this invention provides the application of compound IACS-010759 in the preparation of drugs for treating diabetic nephropathy. By antagonizing the activation of downstream inflammatory signaling pathways mediated by caudate vasopressin II receptors, it inhibits the inflammatory response of renal tubular epithelial cells, thereby treating diabetic nephropathy.

[0008] Application of compound IACS-010759 in the preparation of drugs for treating diabetic nephropathy.

[0009] The structure of compound IACS-010759 is shown below. Its chemical name is 5-(5-methyl-1-(3-(4-(methylsulfonyl)piperidin-1-yl)benzyl)-1H-1,2,4-triazol-3-yl)-3-(4-(trifluoromethoxy)phenyl)-1,2,4-oxadiazole, its CAS number is 1570496-34-2, and its molecular formula is C2. 25 H 25 F3N6O4S.

[0010]

[0011] Compound IACS-010759 is an orally effective inhibitor of mitochondrial oxidative phosphorylation complex I (OXPHOS). It disrupts mitochondrial membrane potential by targeting NADHquinone dehydrogenase 1 (NQO1). Current research indicates that it has anticancer activity, mainly targeting hematologic malignancies and solid tumors. It has completed a phase I clinical trial for advanced solid tumors and lymphomas, and has good safety profile.

[0012] Based on a high-throughput cell screening system, this invention discovered that compound IACS-010759 can inhibit calcium influx stimulated by UI or URP. Simultaneously, based on in vitro cell experiments, it was verified that it can inhibit the inflammatory response of renal tubular epithelial cells (TECs) by antagonizing the activation of downstream inflammatory signaling pathways mediated by urotensin II receptor (UT), thereby treating diabetic nephropathy.

[0013] Preferably, the compound IACS-010759 is used in the preparation of drugs for treating diabetic nephropathy by inhibiting the inflammatory response of renal tubular epithelial cells.

[0014] More preferably, the renal tubular epithelial cell inflammatory response is a palmitic acid-induced inflammatory response or a vasopressin II-related peptide-induced inflammatory response.

[0015] Preferably, the compound IACS-010759 is used in the preparation of a drug for treating diabetic nephropathy by targeting and antagonizing the caudate vasopressin II receptor.

[0016] Preferably, the diabetic nephropathy is a diabetes-related chronic kidney disease.

[0017] Preferably, the drug for treating diabetic nephropathy is a drug with compound IACS-010759 as the sole active ingredient or a drug composition containing compound IACS-010759.

[0018] The drug dosage form can be selected from microcapsules, intravenous emulsions, liposomes, aerosols, prodrug preparations, injections, mixtures, oral ampoules, tablets, capsules, pellets, emulsions, ointments, rubber plasters, films, sponges, iontophoresis agents, or transdermal absorption agents.

[0019] The present invention also provides a medicament for treating diabetic nephropathy, comprising compound IACS-010759 and pharmaceutically acceptable excipients.

[0020] Preferably, in the drug for treating diabetic nephropathy, the content of compound IACS-010759 is 0.1 to 99 wt%.

[0021] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention utilizes modern biological techniques and in vitro experiments to conduct preliminary studies on the function of compound IACS-010759 in diabetic nephropathy. It was found that treatment with compound IACS-010759 significantly inhibited palmitic acid (PA)-induced inflammatory responses and ligand URP-induced inflammatory responses in in vitro tubular epithelial cells (TECs) at both the gene and protein levels. Therefore, treatment with compound IACS-010759 can be considered a novel method for treating diabetic nephropathy. Thus, compound IACS-010759 shows promising application potential in the preparation of drugs for treating diabetic nephropathy. Attached Figure Description

[0022] Figure 1 The calcium flux IC of compound IACS-010759 50 The result image shows that...

[0023] (A) is a protein imprint of the UT of the recombinant CHO-UT stable transgene;

[0024] (B) represents the calcium flux IACS-010759 in recombinant CHO-UT stable cell line under ligand URP activation conditions. 50 .

[0025] Figure 2 The figure shows the results of compound IACS-010759 inhibiting the inflammatory response of TECs.

[0026] (A) is a Western blot diagram of the inhibition of PA-induced NF-κB in the TECs inflammatory pathway by different concentrations of compound IACS-010759;

[0027] (B) is a statistical graph showing the mRNA levels of IL-1β, IL-6, and TNFα, which are related to inflammation in TECs induced by different concentrations of the compound IACS-010759 and inhibited by PA.

[0028] (C) is a Western blot diagram of the inhibition of NF-κB in the TECs inflammatory pathway by different concentrations of compound IACS-010759 by URP-induced inhibition.

[0029] (D) is a statistical graph showing the mRNA levels of IL-1β, IL-6, and TNFα in TECs induced by different concentrations of the compound IACS-010759, which inhibit URP-induced inflammation.

[0030] Figure 3 The figure shows the results of compound IACS-010759 inhibiting the inflammatory response in TECs after UT knockdown.

[0031] (A) is a Western blot diagram showing that after UT knockdown, compound IACS-010759 inhibits PA-induced NF-κB in the TECs inflammatory pathway.

[0032] (B) is a Western blot diagram showing that after UT knockdown, compound IACS-010759 inhibits URP-induced NF-κB in the TECs inflammatory pathway. Detailed Implementation

[0033] The present invention will be further described in detail below with reference to the embodiments, but the implementation of the present invention is not limited to the following embodiments.

[0034] All raw materials used in this invention are commercially available. Compound IACS-010759 and vasopressin II-related peptide (URP) were purchased from MCE.

[0035] I. Detection and Validation of Calcium Ion Flux: Compound IACS-010759 Inhibits UT-Mediated Activation of Downstream Calcium Flux Signals

[0036] (1) Construction of recombinant CHO-UT monoclonal stable cell line

[0037] CHO-K1 cells (Chinese Hamster Ovary cells, purchased from ATCC, catalog number CCL-61) were cultured in DMEM / F12 (Thermo Fisher Scientific) medium containing 10% FBS (VivaCell) and supplemented with antibiotics (Amresco). When cell confluence reached 85%–90%, the cells were digested, resuspended, and counted. 2 mL of cell suspension was added to each well of a 6-well plate to seed CHO-K1 cells at a density of 180,000 / mL. Cells were cultured at 37°C and 5% CO2 until adherence. For the transfection system of the 6-well plates, the transfection complex was prepared according to the GeticoFect 3000 (purchased from Gitec Biotechnology, catalog number 130102) instructions: 5 μL of GeticoFect 3000 premixed reagent was added to 125 μL of Opti-MEM per well. TM Prepare the culture medium and mix thoroughly; prepare the plasmid DNA premix by adding 2.5 μg of plasmid DNA to each well into 125 μL of Opti-MEM. TM The two premixed solutions were mixed thoroughly to obtain the DNA-GeticoFect 3000 transfection complex. After mixing, the complex was incubated at room temperature for 15 min, and then 250 μL was added to each well of a 6-well plate (the medium was changed to FBS-free and PS-free medium during transfection). The plate was then incubated at 37°C and 5% CO2 for 24 h. G418 was selected for resistance screening based on the resistance of the plasmid to obtain overexpressing CHO-K1 cells. The overexpressing CHO-K1 cells that underwent G418 resistance screening were subjected to limiting dilution to obtain a single-clone recombinant CHO-UT cell line overexpressing UT. After trypsin digestion, the cells were resuspended in complete medium (DMEM / F12 containing 10% FBS and double antibiotics). The cell suspension was diluted to a concentration of 5–10 cells per mL of medium, and then 100 μL of the diluted cell suspension was seeded into each well of a 96-well plate, ensuring that most wells contained only one cell during culture. The 96-well plates were placed in a 37°C, 5% CO2 incubator for static incubation. The plates were not moved during the first 48 hours to avoid cell aggregation. From day 3 onwards, cell growth in the wells was observed and recorded daily using an inverted microscope (×40). Wells containing only single-cell colonies (formed by the proliferation of a single cell, with clear, non-overlapping edges) were marked. When the cell density in the marked wells reached 80% confluence, the cells were sequentially transferred to 24-well and then 6-well plates for stepwise expansion. Selective medium containing 600 μg / mL G418 was used throughout the process to maintain selection pressure for subsequent monoclonal validation.

[0038] For monoclonal validation, after removing the culture medium, wash once with preheated PBS. Add 1×SDS-PAGE Loading Buffer and lyse on ice for 5 min. Scrape into clean EP tubes, denature at 100℃ in a metal bath for 15 min, and store at -80℃ for later use. Electrophoresis and wet transfer were performed using a 10% separating gel and a 5% stacking gel system. After transfer, the target band was trimmed and blocked with 5% (w / v) skim milk (dissolved in TBST) at room temperature for 1 h. The blocked NC membranes were incubated overnight at 4℃ with the following primary antibodies: anti-GAPDH antibody (PolyNature Biotech, R24402, 1:10000 dilution), anti-p65 antibody (Abclonal, A19653, 1:1500 dilution), anti-p-p65 antibody (CST, #3033S, 1:1500 dilution), and anti-UTS2R antibody (Abclonal, A2959, 1:1500 dilution). After primary antibody incubation, a membrane washing procedure is required. Using TBST, the membrane is washed three times at room temperature, each time for 10 minutes. After washing, the NC membrane is immersed in the corresponding secondary antibody (goat anti-rabbit IgG, ZhengNeng Biotechnology, 511203, 1:4000 dilution) containing HRP and incubated at room temperature for 1 hour. Development is performed using ECL high-sensitivity chemiluminescence reagent, and the colorimetric results are captured using an imaging system.

[0039] (2) Calcium ion current detection system

[0040] The experiment was conducted using Molecular Devices (MD) company. The Type 3 multifunctional microplate detection system is equipped with a novel calcium ion fluorescent probe, Calbryte 520, AM (AAT Bioquest). The workstation features a built-in pipetting module for real-time compound delivery and simultaneous signal acquisition, with excitation and emission wavelengths set to 485 nm and 515 nm, respectively. Before experiments, Hank's balanced salt solution (HBSS, containing 2 mM probenecid) (Gibco) was used as the detection buffer and pre-equilibrated to 37°C.

[0041] CHO stable cell line overexpressing UT was used at 3 × 10⁻⁶ cells / year. 4 Cells were seeded at a density of 1:1 / well in black transparent 96-well plates and incubated at 37°C in a 5% CO2 incubator for 24 h. After removing the culture medium, 50 μL of HBSS staining solution containing 4 μM Calbryte 520, AM and 0.04% Pluronic F-127 (Sigma) was added to each well, and the plates were incubated in the dark for 50 min. The plates were then washed once with detection buffer to remove free dye.

[0042] Three groups were set up: a blank group, a control group, and an experimental group. After dye incubation, 50 μL of preheated detection buffer was added to each well of the blank and control groups, and incubated at 37°C for 15 min. 50 μL of detection buffer containing an appropriate concentration of the compound was added to each well of the experimental group, and incubated at 37°C for 15 min. The buffer used to determine the IC50 of the compound was... 50 At that time, the logarithmic concentration gradient of 4 replicate wells was set to cover the dynamic range of the suppression effect. The initial and final concentration ranges were: 0.1 nM, 1 nM, 10 nM, 100 nM, 1 μM, and 10 μM (6 orders of magnitude).

[0043] After incubation, transfer directly to the MD calcium flow workstation, place the pretreated cell plate inside the workstation, and start the "Time-Based Read" mode:

[0044] 1) Baseline period: The baseline fluorescence signal was continuously recorded for the first 17 seconds (sampling interval 1.6 seconds);

[0045] 2) Agonist triggering: 25 μL of UⅡ agonist solution (final concentration gradient: 100 nM) is automatically injected at 17 s via an integrated pipette arm to trigger calcium ion influx;

[0046] 3) Signal tracking: Fluorescence signals were continuously acquired for a total duration of 60 seconds, with a focus on recording the calcium transient peak and signal decay dynamics.

[0047] To eliminate signal interference from variations in buffer volume, all experimental groups maintained a consistent total reaction volume (75 μL) during the detection phase. All operations were automated using preset programs on the workstation, ensuring a sample addition timing error of <0.5 s. All compounds were prepared using detection buffer, and the final DMSO concentration was strictly controlled below 0.5%.

[0048] The dynamic changes in fluorescence intensity were recorded in real time using relative fluorescence units (RFU). The calcium response intensity was deconvolved using time-resolved fluorescence signals through MDSoftMax Pro 7.0. Background noise interference was eliminated by applying a double exponential equation model and the values ​​were automatically read to calculate the calcium flow response intensity or calcium flow inhibition rate.

[0049] (3) Results Analysis

[0050] Figure 1 The calcium flux IC of compound IACS-010759 50 The results are shown in the figure. (A) is the protein imprinting map of UT in the recombinant CHO-UT stable cell line, and (B) is the calcium flow IC50 of compound IACS-010759 in the recombinant CHO-UT stable cell line under ligand URP activation conditions. 50 As shown in the figure, UT protein can be expressed normally in monoclonal recombinant CHO-UT cells (e.g., Figure 1 In (A) of the study, under URP activation conditions, IACS-010759 can inhibit the UT-mediated downstream calcium flux response, and its IC50 value is significantly lower than that of the URP-mediated downstream calcium flux response. 50 It is 168.2 ± 10.6 nM (e.g. Figure 1 (B)). The above results indicate that compound IACS-010759 can inhibit UT-mediated activation of downstream calcium flux signaling.

[0051] II. Real-time quantitative PCR and Western blot verification of IACS-010759 inhibiting the inflammatory response in TECs.

[0052] (1) PA (palmitic acid, purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd., product number P9767-10G) induced TECs inflammation model

[0053] HKC-8 cells (human renal tubular epithelial cells) were cultured in DMEM / F12 medium containing 10% fetal bovine serum and added PS. After the HKC-8 cells grew to a suitable density, they were digested, resuspended and counted. 500 μL of cell suspension was added to each well of a 24-well plate to seed HKC-8 cells at a density of 100,000 per well. The cells were cultured at 37°C and 5% CO2 for 24 hours until they adhered to the plate.

[0054] To prepare the PA-albumin complex, crystalline PA was heated in a metal bath at 70°C for 15 min until completely liquefied. This liquefied PA was then rapidly mixed with a 10% fatty acid-free bovine serum albumin (BSA) solution preheated to 37°C (Heyuan Liji Biotechnology Co., Ltd.). The mixture was thoroughly emulsified by vortexing to form the PA-BSA complex. The complex was then added to serum-free DMEM / F12 medium containing PS to prepare a PA working solution with a final concentration of 0.3 mM (corresponding to a final BSA concentration of 0.5%). The model group was treated with serum-free medium containing 0.3 mM PA and 0.2% DMSO. The drug treatment group was treated with serum-free medium containing 0.3 mM PA and different concentrations of IACS-010759. The control group was treated with an equal volume of serum-free medium containing 0.5% BSA and 0.2% DMSO. A solvent compensation method was used to ensure a consistent final DMSO concentration (≤0.5% v / v) across all treatment groups. Before the experiment, HKC-8 cells that had grown to over 90% were washed once with PBS, and then 500 μL of the above treatment solution was replaced in each well of a 24-well plate. All treatment groups were cultured at 37°C and 5% CO2 for 24 h.

[0055] HKC-8 cells were collected after being treated according to experimental groups. After removing the culture medium, the cells were washed once with pre-warmed PBS. 1×SDS-PAGE Loading Buffer was added and the cells were lysed on ice for 5 min, followed by denaturation at 100℃ in a metal bath for 15 min to collect Western blot (WB) protein samples. 300 μL of Trizol was added and the cells were lysed on ice for 30 min to collect RNA samples. cDNA was synthesized using reverse transcriptase for subsequent real-time quantitative PCR detection. Primers were synthesized by Shanghai Sangon Biotech Co., Ltd., and the primers and PCR conditions are shown below:

[0056] Table 1: Primers and sequences used in PCR

[0057] Primer name Primer sequences (5' to 3') Serial Number h-ACTIN-F CATGTACGTTGCTATCCAGGC SEQ ID NO.1 h-ACTIN-R CTCCTTAATGTCACGCACGAT SEQ ID NO.2 h-UTS2R-F CCCAACGCAACCCTCAACA SEQ ID NO.3 h-UTS2R-R ACCACGTAGACGTACATGGAG SEQ ID NO.4 h-IL1β-F ATGATGGCTTATTACAGTGGCAA SEQ ID NO.5 h-IL1β-R GTCGGAGATTCGTAGCTGGA SEQ ID NO.6 h-IL6-F ACTCACCTCTTCAGAACGAATTG SEQ ID NO.7 h-IL6-R CCATCTTTGGAAGGTTCAGGTTG SEQ ID NO.8 h-TNFα-F GAGGCCAAGCCCTGGTATG SEQ ID NO.9 h-TNFα-R CGGGCCGATTGATCTCAGC SEQ ID NO.10 h-TGFβ1-F CTAATGGTGGAAACCCACAACG SEQ ID NO.11 h-TGFβ1-R TATCGCCAGGAATTGTTGCTG SEQ ID NO.12

[0058] The amplification program employed a three-step method: pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, and extension at 72℃ for 30 s, with a cycle number of 45. For data processing, the β-actin gene was used as an internal reference for normalization, and the relative expression levels of the target gene were calculated and analyzed.

[0059] All experimental conditions were performed with four biological replicates to ensure data reliability. Quantitative data were visualized as arithmetic mean ± standard error (mean ± SEM). Data analysis was performed using GraphPad Prism 9.0 statistical software, specifically employing t-tests or one-way ANOVA for inter-group differences. Based on generally accepted biostatistical standards, p < 0.05 was established as the threshold for statistical significance, and all significance markers were annotated according to this standard.

[0060] (2) URP ligand-specific induced TECs model

[0061] After HKC-8 cells grew to a suitable density, they were digested, resuspended, and counted. 500 μL of cell suspension was added to each well of a 24-well plate to seed HKC-8 cells at a density of 85,000 per well. The cells were cultured at 37°C and 5% CO2 for 24 hours until they adhered to the plate.

[0062] The experiment used serum-free DMEM / F12 medium containing 0.5% fatty acid-free bovine serum albumin (BSA) as the basic induction system. The model group was treated with medium containing 50 μM URP and 0.2% DMSO containing 0.5% fatty acid-free BSA. The drug-treated groups were treated with medium containing 50 μM URP and different concentrations of IACS-010759 containing 0.5% fatty acid-free BSA. The control group was treated with an equal volume of serum-free medium containing 0.5% BSA and 0.2% DMSO. The final DMSO concentration (≤0.5% v / v) was ensured to be consistent across all treatment groups using a solvent compensation method. Before the experiment, HKC-8 cells were washed once with pre-warmed PBS to remove residual medium, and 500 μL of treatment solution was added to each well of a 24-well plate. All treatment groups were cultured at 37°C and 5% CO2 for 72 h (with fresh compound-containing medium added as needed during the culture).

[0063] HKC-8 cells were collected after being treated according to experimental groups and PCR detection was performed using the same method as in (1).

[0064] (3) Results Analysis

[0065] Figure 2 The figure shows the results of the compound IACS-010759 inhibiting the inflammatory response of TECs. (A) is a Western blot diagram showing the inhibition of NF-κB in PA-induced TEC inflammation by different concentrations of IACS-010759; (B) is a statistical graph showing the mRNA levels of IL-1β, IL-6, and TNFα in PA-induced TEC inflammation by different concentrations of IACS-010759; (C) is a Western blot diagram showing the inhibition of NF-κB in URP-induced TEC inflammation by different concentrations of IACS-010759; and (D) is a statistical graph showing the mRNA levels of IL-1β, IL-6, and TNFα in URP-induced TEC inflammation by different concentrations of IACS-010759. As shown in the figure, in the PA-induced TEC inflammation model, IACS-010759 significantly reduced UT protein expression in a dose-dependent manner, while simultaneously inhibiting NF-κB p65 phosphorylation (e.g., ...). Figure 2 In (A) of the study, IACS-010759 can reduce the expression levels of UT and pro-inflammatory cytokines IL-1β, IL-6 and TNFα mRNA in a dose-dependent manner (e.g., Figure 2 (B)). In the URP ligand-specific induced TECs model, IACS-010759 significantly reduced UT protein expression in a dose-dependent manner, while inhibiting NF-κB p65 phosphorylation (e.g., Figure 2In (C) of the study, IACS-010759 can reduce the expression levels of UT and pro-inflammatory cytokines IL-1β, IL-6, and TNFα, as well as the pro-fibrotic factor TGF-β1 mRNA, in a dose-dependent manner (e.g., Figure 2 (D)). The above results demonstrate at both the mRNA and protein levels that compound IACS-010759 inhibits the inflammatory response in TECs in a concentration-dependent manner.

[0066] III. Real-time quantitative PCR and Western blotting demonstrated that the inhibitory effect of compound IACS-010759 on the inflammatory response is dependent on UT.

[0067] (1) Construction method of transfection system

[0068] When the HKC-8 cells reached 85%–90% confluence, the culture medium was removed, and the cells were washed with PBS pre-warmed to 37°C. Then, 2 mL of pre-warmed trypsin digestion solution was injected for dissociation, and the mixture was kept at 37°C for 90 seconds. Immediately afterwards, twice the volume of DMEM / F12 medium containing 10% fetal bovine serum was added to terminate the enzymatic reaction, and the cells were gently pipetted to collect the digested cell suspension. The cells were centrifuged at 800 rpm for 3 minutes, the supernatant was removed, and the cells were resuspended in DMEM / F12 complete medium for cell counting. 500 μL of the cell suspension was added to each well of a 24-well plate to seed HKC-8 cells at a density of 70,000 cells / well. The cells were cultured at 37°C and 5% CO2 for 24 hours until cell adhesion was achieved.

[0069] The siRNA sequence targeting the hUTS2R gene (Gene ID: 2837) was obtained from the literature and synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd. The negative control siRNA (NC-siRNA) was a random sequence without target homology. The specificity of all siRNA sequences was verified by BLAST alignment. The lyophilized powder was diluted to 20 μM stock solution with sterile, enzyme-free water and stored at -80℃ for later use. For the 24-well plate transfection system, siRNA delivery systems were constructed based on the standardized operating procedures of the RNAiMAX transfection reagent. First, the vector composite solution was prepared by mixing 1.5 μL of RNAiMAX transfection reagent with 25 μL of Opti-MEM. TMSerum-free medium was initially mixed in an EP tube and homogenized by pipetting. Simultaneously, a premixed siRNA solution was prepared by adding 1 μL of siRNA (final concentration 40 nM) or 2 μL of siRNA (final concentration 80 nM) to another EP tube, followed by 25 μL of homogenate medium. The mixture was then repeatedly pipetted to ensure homogenization. The two phases were then mixed in a 1:1 volume ratio to obtain the siRNA-RNAiMAX transfection complex. After pipetting to ensure homogenization, the mixture was allowed to stand at room temperature for 10 min. Subsequently, the prepared transfection mixture was added at 50 μL / well to a 24-well plate pre-replaced with serum-free and antibiotic-free medium. The plate was then incubated at 37°C with 5% CO2 for 48 hours to achieve gene silencing.

[0070] The siRNA used is:

[0071] hUTS2R-siRNA(5'to 3')ACGCAACCCUCAACAGCUCTT, SEQ ID NO.13;

[0072] Negative Control(5'to 3')UUCUCCGAACGUGUCACGUTT, SEQ ID NO.14.

[0073] (2) In a PA-induced TECs inflammation model

[0074] Forty-eight hours after transfection, PA-induced TECs inflammation models were induced under si-NC and si-UT experimental conditions. The model group was treated with serum-free medium containing 0.3 mM PA and 0.1% DMSO, the drug-treated group was treated with serum-free medium containing 0.3 mM PA and 1 μM IACS-010759, and the control group was treated with an equal volume of serum-free medium containing 0.5% BSA and 0.1% DMSO. Solvent compensation was used to ensure a consistent final DMSO concentration (≤0.5% v / v) across all treatment groups.

[0075] After the intervention, inflammatory markers were detected by Western blotting (WB). HKC-8 cells were collected after being treated according to the experimental groups, the culture medium was removed, and the cells were washed once with pre-warmed PBS. 1×SDS-PAGE Loading Buffer was added and the cells were lysed on ice for 5 min, followed by denaturation in a metal bath at 100℃ for 15 min to collect WB protein samples.

[0076] (3) In the URP ligand-specific induced TECs model

[0077] Simultaneously with si-NC and si-UT transfection for 48 h, URP ligand-specific TECs inflammation models were induced. The model group was treated with serum-free medium containing 0.3 mM PA and 0.1% DMSO, the drug-treated group was treated with serum-free medium containing 0.3 mM PA and 1 μM IACS-010759, and the control group was treated with an equal volume of serum-free medium containing 0.5% BSA and 0.1% DMSO. The final DMSO concentration was ensured to be consistent across treatment groups (≤0.5% v / v) using a solvent compensation method. Alternatively, the model group was treated with serum-free medium containing 50 μM URP and 0.1% DMSO, along with 0.5% fatty acid-free bovine serum albumin. The drug-treated group was treated with 50 μM URP and 1 μM IACS-010759, along with 0.5% fatty acid-free bovine serum albumin. The control group was treated with an equal volume of serum-free medium containing 0.5% BSA and 0.1% DMSO. The final DMSO concentration (≤0.5% v / v) of each treatment group was ensured to be consistent using the solvent compensation method. Before the experiment, HKC-8 cells were washed once with pre-warmed PBS to remove residual culture medium, and 500 μL of treatment solution was added to each well of a 24-well plate. All treatment groups were cultured at 37°C and 5% CO2 for 48 h. The induction medium containing the Si transfection complex was then removed, and the corresponding induction medium was replaced, followed by another 24 h of culture.

[0078] After the intervention, inflammatory markers were detected by Western blotting (WB). HKC-8 cells were collected after being treated according to the experimental groups, the culture medium was removed, and the cells were washed once with pre-warmed PBS. 1×SDS-PAGE Loading Buffer was added and the cells were lysed on ice for 5 min, followed by denaturation in a metal bath at 100℃ for 15 min to collect WB protein samples.

[0079] (4) Results Analysis

[0080] Figure 3 The figure shows the results of the inhibitory effect of compound IACS-010759 on the inflammatory response in TECs after UT knockdown. (A) is a Western blot diagram showing the inhibition of PA-induced NF-κB inflammatory pathway in TECs by compound IACS-010759 after UT knockdown; (B) is a Western blot diagram showing the inhibition of URP-induced NF-κB inflammatory pathway in TECs by compound IACS-010759 after UT knockdown. As shown in the figure, in the PA-induced TECs inflammation model, UT knockdown significantly weakened the inhibitory effect of IACS-010759 on the phosphorylation of PLC and NF-κB p65. Figure 3 (A)); In the URP ligand-specific induced TECs model, UT knockdown significantly weakened the inhibitory effect of IACS-010759 on the phosphorylation of PLC and NF-κB p65. Figure 3(B)). The above results demonstrate at the protein level that compound IACS-010759 inhibits the inflammatory response in TECs in a manner dependent on the UT receptor.

[0081] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of compound IACS-010759 in the preparation of drugs for treating diabetic nephropathy.

2. The application according to claim 1, characterized in that, The compound IACS-010759 is used in the preparation of drugs for treating diabetic nephropathy by inhibiting the inflammatory response of renal tubular epithelial cells.

3. The application according to claim 2, characterized in that, The aforementioned renal tubular epithelial cell inflammatory response is either palmitic acid-induced or vasopressin II-related peptide-induced.

4. The application according to claim 1, characterized in that, The compound IACS-010759 is used in the preparation of drugs for treating diabetic nephropathy by targeting and antagonizing the caudate vasopressin II receptor.

5. The application according to claim 1, characterized in that, The diabetic nephropathy mentioned above is a chronic kidney disease associated with diabetes.

6. The application according to claim 1, characterized in that, The aforementioned drug for treating diabetic nephropathy uses compound IACS-010759 as the sole active ingredient or is a pharmaceutical composition containing compound IACS-010759.

7. A drug for treating diabetic nephropathy, characterized in that, This includes compound IACS-010759 and pharmaceutically acceptable excipients.

8. The medicament for treating diabetic nephropathy according to claim 7, characterized in that, In the aforementioned drug for treating diabetic nephropathy, the content of compound IACS-010759 is 0.1–99 wt%.