Application of long non-coding RNA lnc-SH2B2 in the preparation of drugs for the treatment and / or prevention of atherosclerosis

Abstract

This invention relates to the field of atherosclerosis drug development technology, and particularly to the application of the long non-coding RNA lnc-SH2B2 in the preparation of drugs for the treatment and / or prevention of atherosclerosis. This invention is the first to discover that the expression level of lnc-SH2B2 in plasma endothelial-derived exosomes significantly increases in patients with coronary artery disease after EECP treatment compared to before treatment. This confirms that lnc-SH2B2 is a blood flow-protective shear-sensitive molecule that can be released into the circulatory system through endothelial exosomes, possessing a vascular protective biological basis, thus laying a theoretical foundation for clinical drugs for the treatment of atherosclerosis.

Description

Technical Field

[0001] This invention relates to the field of atherosclerosis drug development technology, and in particular to the application of long non-coding RNA lnc-SH2B2 in the preparation of drugs for the treatment and / or prevention of atherosclerosis. Background Technology

[0002] Atherosclerosis (AS) is a chronic inflammatory vascular disease. Its pathological basis involves endothelial damage, lipid deposition, inflammatory cell infiltration, and dysfunction of vascular smooth muscle cells (VSMCs), ultimately leading to vascular remodeling and luminal narrowing. Abnormal proliferation, migration, and phenotypic transformation (from contractile to anabolic) of VSMCs are key aspects of atherosclerosis and vascular remodeling, a process finely regulated by hemodynamic factors (especially shear stress) and various signaling molecules. However, the molecular mechanisms underlying the functional regulation of VSMCs remain incompletely understood.

[0003] Enhanced external counterpulsation (EECP) is a non-invasive physical therapy for coronary artery disease. By increasing diastolic pressure and generating laminar shear stress (LSS), it can significantly improve vascular endothelial function and slow the progression of atherosclerosis. Exosomes, as important carriers of intercellular communication, carry bioactive molecules such as non-coding RNA and proteins, playing a crucial role in shear stress-mediated vascular protection. Studies have shown that blood flow shear stress can regulate the phenotypic transformation of smooth muscle, thereby participating in plaque formation and the development of arterial stenosis. However, the molecular mechanisms by which blood flow shear stress regulates vascular smooth muscle cells are not fully understood, and whether shear stress affects smooth muscle proliferation by regulating lncRNAs in endothelial cell-derived exosomes has not yet been reported. Summary of the Invention

[0004] In view of this, the purpose of this invention is to solve at least one of the above-mentioned technical problems. To this end, this invention demonstrates that lnc-SH2B2 can inhibit the proliferation, migration and phenotypic transformation of vascular smooth muscle cells, and inhibit the formation of atherosclerotic plaques and vascular intimal hyperplasia. It further illustrates that lnc-SH2B2 participates in the protective process against atherosclerosis by regulating the function of vascular smooth muscle cells, thus providing a theoretical basis for the treatment of atherosclerosis.

[0005] The first aspect of this invention provides the use of long non-coding RNA lnc-SH2B2 and substances overexpressing long non-coding RNA lnc-SH2B2 in the preparation of drugs for treating and / or preventing atherosclerosis; the sequence of said long non-coding RNA lnc-SH2B2 is shown in SEQ ID NO.12; The cDNA sequence of the long non-coding RNA lnc-SH2B2 is at least one of the following: b1) At least one of the nucleotide sequences shown in SEQ ID NO. 11; b2) A complementary, degenerate, or homologous sequence of at least one of the nucleotide sequences shown in b1), wherein the homologous sequence is a nucleotide sequence having at least 85% homology with the nucleotide sequence shown in b1). b3) The nucleotide sequence that encodes an amino acid sequence with the same function formed by substitution and / or deletion and / or addition of one or more amino acids due to artificial modification or natural nucleic acid polymorphism; b4) A nucleotide sequence that hybridizes under strict conditions with the nucleotide sequence shown in b1), b2), or b3) and is capable of encoding a protein with the same function.

[0006] In a preferred embodiment, the substance that overexpresses the long non-coding RNA lnc-SH2B2 is any one of c1)-c4) below: c1) An expression cassette containing any one of the nucleotides described in b1)-b4); c2) A recombinant vector containing any of the nucleotides described in b1)-b4) or the expression cassette described in c1); c3) A recombinant virus or host cell containing at least one of the nucleotides described in any one of b1)-b4), the expression cassette described in c1), or the recombinant vector described in c2).

[0007] In a preferred embodiment, the recombinant virus includes the AAV9 virus.

[0008] In a preferred embodiment, the host cell includes vascular endothelial cells.

[0009] In a preferred embodiment, the recombinant vector comprises B-lnc-SH2B2; ​​B comprises at least one of the following vectors: K2, pcDNA3.1, pCMV, or pAAV.

[0010] In a preferred embodiment, the long non-coding RNA lnc-SH2B2 is derived from vascular endothelial cells.

[0011] In a preferred embodiment, the long non-coding RNA lnc-SH2B2 can inhibit the proliferation, migration and phenotypic transformation of vascular smooth muscle cells, and inhibit the formation of atherosclerotic plaques and vascular intimal hyperplasia.

[0012] In a second aspect, the present invention provides a pharmaceutical composition comprising any one of the long non-coding RNAs lnc-SH2B2 as described in b1) to b4) or any one of the substances described in c1) to c3); the pharmaceutical composition having at least one of the following uses: a drug for treating and / or preventing atherosclerosis; and / or inhibiting the proliferation, migration and phenotypic transformation of vascular smooth muscle cells and / or inhibiting the formation of atherosclerotic plaques and vascular intimal hyperplasia.

[0013] In a preferred embodiment, the drug further includes pharmaceutically acceptable excipients.

[0014] Thirdly, the present invention provides the application of inhibitors or silencing agents of long non-coding RNA lnc-SH2B2 in the construction of long non-coding RNA lnc-SH2B2 knockout cell lines; the knockout cell lines are used to exclude the role of endogenous lnc-SH2B2 in exosomes.

[0015] In a preferred embodiment, the inhibitor comprises siRNA; the silencing agent comprises a paired sgRNA that specifically targets the long non-coding RNA lnc-SH2B2. The sequence of the siRNA is shown in SEQ ID NO.3~SEQ ID NO.4; The sequence of the sgRNA is shown in SEQ ID NO.5~SEQ ID NO.6.

[0016] Fourthly, the present invention provides a knockout cell line, which is obtained by knocking out the lnc-SH2B2 gene in vascular endothelial cells using CRISPR-Cas9 technology and a paired sgRNA that specifically targets the long non-coding RNA lnc-SH2B2; ​​the sgRNA sequence is shown in SEQ ID NO.5~SEQ ID NO.6.

[0017] Compared with the prior art, the present invention achieves at least the following technical effects: This invention is the first to clearly demonstrate that protective laminar shear stress can induce high expression of lnc-SH2B2 in vascular endothelial cells, and that endothelial-derived exosomes can be used as carriers to achieve signal communication between endothelial cells and vascular smooth muscle cells. Through multi-level verification using clinical samples, in vitro cell function experiments, and in vivo animal models, lnc-SH2B2 and its overexpression preparations, recombinant vectors, recombinant viruses, and endothelial exosome delivery systems have significant anti-atherosclerotic pharmacological activity.

[0018] Clinical sample testing results showed that after enhanced external counterpulsation (EECP) therapy in patients with coronary heart disease, the expression level of lnc-SH2B2 in plasma endothelial-derived exosomes was significantly upregulated compared with that before treatment. This confirms that lnc-SH2B2 is a shear-sensitive endothelial-derived protective molecule that can be stably present in circulating exosomes. It can serve as a non-invasive molecular marker for assessing the degree of vascular endothelial damage and monitoring the clinical efficacy of EECP, and also provides a novel target for the development of targeted drugs for atherosclerosis. In vitro parallel plate flow chamber experiments confirmed that 15 dyne / cm 2 After laminar shear stress treatment of human umbilical vein endothelial cells, the expression levels of lnc-SH2B2 in intracellular cells and cell supernatant exosomes were simultaneously and significantly increased. The Transwell endothelial-smooth muscle co-culture system, the exosome inhibitor GW4869 blocking experiment, and the control experiment of lnc-SH2B2 knockout endothelial cell line constructed by CRISPR-Cas9 jointly confirmed that exosomes are an essential transport carrier for lnc-SH2B2-mediated endothelial regulation of vascular smooth muscle cell function. The absence of lnc-SH2B2 or the blocking of exosome secretion can significantly weaken the protective effect of laminar shear stress on vascular smooth muscle cells.

[0019] EdU cell proliferation assay, scratch healing assay, and Transwell transmembrane migration assay showed that endothelial cell-derived exosomes overexpressing lnc-SH2B2 significantly antagonized PDGF-BB-induced abnormal proliferation and migration of vascular smooth muscle cells, effectively reducing the cell source for neointimal formation. Combined qRT-PCR and Western blot analysis of smooth muscle phenotypic markers showed that lnc-SH2B2 significantly upregulated the mRNA and protein expression of vascular smooth muscle contractile markers ACTA2, TAGLN, and CNN1, while downregulating the expression of anabolic markers OPN, KLF4, and KLF5. This stabilized the normal contractile phenotype of smooth muscle and inhibited the pathological phenotypic transition from contractile to pro-abolic types, thus blocking the vascular remodeling process at the molecular level.

[0020] The lnc-SH2B2 recombinant overexpression vector provided by this invention can stably increase the transcription level of lnc-SH2B2 after transfection into cells, exerting a long-term vascular protective function, and is suitable for in vitro cell mechanism research and in vivo gene therapy drug delivery; the lnc-SH2B2-targeting shRNA silencing reagent can efficiently knock down the expression of endogenous lnc-SH2B2 in cells, reversing the protective effect of laminar shear stress, and can be used to construct lnc-SH2B2-deficient cell models for reverse mechanism verification, and can also be used alone to prepare agents that promote vascular smooth muscle proliferation and induce angiogenesis, suitable for disease scenarios such as ischemic tissue repair and skin wound healing; the lnc-SH2B2 knockout endothelial cell line constructed using specific sgRNA can completely eliminate endogenous lnc-SH2B2 in endothelial cells, accurately isolate the independent biological function of lnc-SH2B2, eliminate interference from other endothelial secretory factors, and significantly improve the reliability of molecular mechanism experimental data.

[0021] This invention fully reveals a novel pathway regulating laminar shear force-endothelial exosome lnc-SH2B2-vascular smooth muscle homeostasis. Simultaneously, using natural endothelial exosomes as a delivery carrier, it exhibits high biocompatibility and low immunogenicity, enabling systemic intravenous administration. Compared to administration via viral vectors alone, it has lower toxicity and side effects. The prepared pharmaceutical composition containing lnc-SH2B2 or its recombinant vector and recombinant virus, when combined with pharmaceutically acceptable excipients, can stably achieve multiple pharmacological effects, including prevention and treatment of atherosclerosis, inhibition of vascular smooth muscle cell proliferation, migration, and pathological phenotypic transformation, and inhibition of vascular intimal hyperplasia and atherosclerotic plaque formation. It possesses extremely high clinical translational and industrial application value. Attached Figure Description

[0022] Appendix Figure 1 The graph shows the expression results of plasma exosome markers CD81 and TSG101 in patients with coronary heart disease before and after EECP treatment.

[0023] Appendix Figure 2 To detect lncRNA expression profiles after laminar shear stress (LSS) treatment using qRT-PCR.

[0024] Appendix Figure 3 To detect the expression level of lnc-SH2B2 in human umbilical vein endothelial cells (HUVECs) and their derived exosomes after laminar shear stress (LSS) treatment using qRT-PCR.

[0025] Appendix Figure 4 This is a diagram showing the experimental results of a wound healing assay to detect smooth muscle cell migration under the following conditions.

[0026] Appendix Figure 5 This is a diagram showing the results of the Transwell assay for detecting smooth muscle cell migration under the following conditions.

[0027] Appendix Figure 6 This is a graph showing the experimental results of smooth muscle cell proliferation under the following conditions using the EdU method.

[0028] Appendix Figure 7 This figure shows the results of Western blot and qRT-PCR analysis of the changes in the expression of phenotypic markers (ACTA2, TAGLN, CNN1, OPN, KLF4, KLF5) in vascular smooth muscle cells after knockdown or overexpression of lnc-SH2B2.

[0029] Appendix Figure 8 The image shows the results of VSMC phenotypic marker detection after transfection with recombinant plasmid K2-lnc-SH2B2.

[0030] Appendix Figure 9 This image shows representative results of vascular intimal hyperplasia, vascular remodeling, and atherosclerotic plaque formation in a partial left carotid artery (PCL) ligation mouse model after tail vein injection of AAV9 virus overexpressing lnc-SH2B2 or exosomes derived from endothelial cells treated with laminar flow high shear stress. The results were obtained using immunohistochemistry and immunofluorescence pathological staining. Detailed Implementation Plan

[0031] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.

[0032] Example 1: Screening and identification of long non-coding RNA lnc-SH2B2

[0033] (1) Collect 5 mL of peripheral blood from patients with coronary heart disease who received 35 enhanced external counterpulsation (EECP) sessions before and after treatment, and place them in EDTA anticoagulant tubes; centrifuge at 3000 rpm for 15 min at 4°C to collect plasma; (This experimental procedure was approved by the Medical Ethics Committee of Foshan Fosun Chancheng Hospital (Approval No.: CYEC-LCYJ-2025059-PJ-20250626, and all subjects signed voluntary informed consent forms after being fully informed)

[0034] (2) Plasma exosomes were extracted using ultracentrifugation (first centrifuged at 300×g for 10 minutes, then at 2000×g for 30 minutes, then at 10000×g for 30 minutes; finally, ultracentrifuged at 110000×g for 90 minutes at 4°C; low-speed centrifugation removed dead cells, medium-speed centrifugation removed large vesicles, and ultracentrifugation extracted exosomes; the supernatant was discarded, leaving the precipitate, which contained exosomes); then the morphology of exosomes was observed by transmission electron microscopy, the particle size distribution was analyzed by NanoSight, and the exosome markers CD81 and TSG101 were detected by Western blot for identification. The results are shown in […]. Figure 1 .

[0035] (3) Total exosome RNA extraction using the TRIzol method: The enriched exosome precipitate (approximately 100 μL) was resuspended in PBS, 1 mL of TRIzol reagent was added, and the mixture was repeatedly pipetted until complete lysis was achieved. The mixture was then allowed to stand at room temperature for 5 min. 200 μL of chloroform was added, and the mixture was vigorously shaken for 15 s. After standing at room temperature for 3 min, the mixture was centrifuged at 12,000 × g for 15 min at 4 °C. The upper aqueous phase (approximately 500-600 μL) was carefully transferred to a new RNase-free centrifuge tube, an equal volume of isopropanol was added, and the mixture was incubated at -20 °C for 30 min. The mixture was centrifuged at 12,000 × g for 10 min at 4 °C, and the supernatant was discarded. The precipitate was washed twice with 75% ethanol, dried at room temperature, and then 20 μL of RNase-free water was added to dissolve the RNA, yielding a total exosome RNA extract with a final volume of approximately 20 μL. The RNA concentration and purity were detected using Nanodrop.

[0036] (4) Genomic DNA was removed from the extract by DNase I digestion, and ribosomal RNA was removed using the Ribo-Zero kit. A cDNA library was then constructed, and the expression changes of lncRNA in the samples were analyzed using a lncRNA microarray (Human long non-coding RNA Array V2.0, 8x15K). LncRNA expression profiles under laminar flow high shear stress were obtained. (See attached image). Figure 2 .

[0037] (5) After quality control and alignment of sequencing data, differentially expressed lncRNAs were screened. Using |log2FC|≥2 and P<0.05 as the screening criteria, a novel lncRNA that was significantly elevated after EECP treatment was found and named lnc-SH2B2. Its nucleotide sequence is shown in SEQ ID NO.12.

[0038] Example 2: Co-culture of endothelial cells and smooth muscle cells and laminar flow shear stress stimulation

[0039] (1) Cell culture: Human umbilical vein endothelial cells (HUVEC, purchased from Sciencell) were cultured in ECM complete medium (containing 10% FBS, 1% ECGS, and 1% penicillin antibiotics). Human aortic smooth muscle cells (VSMCs, purchased from Shanghai Fuheng Biotechnology Co., Ltd.) were cultured in SMEM complete medium (containing 10% FBS, 1% non-essential amino acids (NEAA), and 1% penicillin antibiotics). All cells were cultured in a 37°C, 5% CO2 incubator. When the cell density reached 80%–90%, the cells were passaged using 0.25% trypsin; the cell suspension was collected in 15 mL centrifuge tubes and centrifuged at 1000 rpm for 3 min. The supernatant was discarded, and the pellet was resuspended in 1 mL of complete medium. (2) Establishment of co-culture system: Add 150 μL of HUVEC suspension to the bottom (lower chamber) of the culture insert (Transwell) and let it stand for 2 h to allow endothelial cells to adhere to the bottom of the insert. Then add 150 μL of VSMC suspension to the upper chamber. Transfer the culture insert to a 6-well plate, add an appropriate amount of culture medium, and incubate overnight at 37°C in a 5% CO2 incubator. (3) Applying shear stress: Transfer the culture insert to the shear stress device (parallel plate flow chamber system) and continuously apply 15 dyne / cm 2 The constant laminar shear stress was treated for 24 hours. (4) Sample collection: After processing, the lower chamber (endothelial cells) and upper chamber (smooth muscle cells) were collected separately, and exosomes in the co-culture supernatant were also collected. The expression level of lnc-SH2B2 was verified by qRT-PCR. The primer sequences are as follows: SEQ ID NO.1~SEQ ID NO.2 (5 ， -3 ’ As shown in Table 1; the qRT-PCR system is shown in Table 2.

[0040] lnc-SH2B2-qF: AAGTTGGGCATTGTAGGCGA, SEQ ID NO.1; lnc-SH2B2-qR:ATGTCTTTCTCTCGCCAGCC, SEQ ID NO.2.

[0041] Table 1. qRT-PCR system (10 μL)

[0042] Table 2 Reaction Procedure

[0043] See results Figure 3 ;Depend on Figure 3It can be seen that the laminar shear stress (LSS, 15 dyne / cm) 2 Treatment with this method significantly upregulated the expression level of lnc-SH2B2 in human umbilical vein endothelial cells (HUVECs) and their derived exosomes.

[0044] Example 3: Construction of lnc-SH2B2 knockout endothelial cell line

[0045] (1) Design and synthesis of lnc-SH2B2 silencing agent (lnc-SH2B2 Silencer)

[0046] Small interfering RNAs (siRNAs) were designed and synthesized targeting the lnc-SH2B2 sequence; the siRNA sequences are shown in SEQ ID NO. 3~SEQ ID NO. 4 (5). ， -3 ， As shown in the image: Justice Chain: CCGGGGAATAGAAGGAAATGCAACTCGAGTTGCATTTCCTTCTATTCCTTTTTG; Antonyms: AATTCCAAAAAGGAATAGAAGGAAATGCAACTCGAGTTGCATTTCCTTCTATTCC.

[0047] (2) Knockout of lnc-SH2B2 in endothelial cells

[0048] Using CRISPR-Cas9 gene editing technology, a pair of sgRNAs specifically targeting the lnc-SH2B2 gene were designed to knock out the lnc-SH2B2 gene in human umbilical vein endothelial cells (HUVECs) to obtain a stably knocked-out endothelial cell line of lnc-SH2B2.

[0049] 1. Based on the genomic sequence of the lnc-SH2B2 gene, pairing sgRNAs specifically targeting the exon regions of the lnc-SH2B2 gene were designed. The sgRNA sequences are shown in SEQ ID NO.5~SEQ ID NO.6 (5'→3'): sgRNA name sequence (5'→3') PAM sequence sgRNA-1 ccaaaacgtatcaacccatg; CGG sgRNA-2 tcagcaactccctcacacgt; TGG The aforementioned sgRNA was synthesized and purified by a biotechnology company (such as Guangzhou Ruibo Biotechnology Co., Ltd.).

[0050] 2. Mix the paired sgRNA and Cas9 protein at a molar ratio of 1:1.2 and incubate at room temperature for 15 min to form a ribonucleoprotein (RNP) complex. Take HUVECs in the logarithmic growth phase and... 5 HUVECs were seeded at a density of cells / well and seeded until the cells reached 70%–80% confluence. The RNP complex was then transfected into HUVECs according to the instructions of Lipofectamine® 3000 or CRISPRmax™ transfection reagent. After 48 hours of transfection, the culture medium was replaced with fresh medium and the cells were cultured for another 24 hours.

[0051] 3. After transfection, the cells were digested with 0.25% trypsin and seeded into 96-well plates using a limiting dilution method, with approximately 0.5-1 cells per well. The cells were then cultured at 37°C in a 5% CO2 incubator for 7-14 days. The wells containing monoclonal cells were observed and labeled under a microscope. Once the monoclonal cells had expanded to a sufficient number, the culture was gradually expanded to 12-well plates, 6-well plates, and T25 culture flasks.

[0052] 4. Collect candidate monoclonal cells and extract genomic DNA. Using the genomic DNA as a template, perform PCR amplification using specific identification primers. The primer sequences are shown in SEQ ID NO.7~SEQ ID NO.8 (5'→3'): lnc-SH2B2-JD-F:acagccatcccttcca; lnc-SH2B2-JD-R:ctcttcccagcctacctt.

[0053] After identification by agarose gel electrophoresis, the PCR products were sent to a sequencing company for Sanger sequencing. The sequencing results were compared with the wild-type lnc-SH2B2 gene sequence to determine the gene knockout status.

[0054] (3) Endothelial cell lines and lnc-SH2B2 knockout endothelial cell lines were co-cultured with vascular smooth muscle cells (VSMCs) according to the method in Example 2. Then, EdU staining, wound healing experiments (after the endothelial cells were fully adhered, uniform scratches were created on the surface of the smooth muscle cell monolayer using a 200 μL sterile pipette tip to simulate the damage or migration interface, and photographs were taken at 12 and 24 hours) and Transwell experiments were performed to detect the proliferation and migration abilities of VSMCs. The experiment included a blank group, a static culture control group, and a simple laminar shear stress (15 dyne / cm²) control group. 2 The treatment group, the laminar shear stress combined with exosome inhibitor (GW4869) group, and the laminar shear stress combined with exosomes derived from lnc-SH2B2 knockout cell line group were all treated with PDGF-BB (20 ng / mL) to induce VSMC migration, except for the blank group.

[0055] The procedure for detecting vascular smooth muscle cell proliferation (EdU method) is as follows: The proliferation of vascular smooth muscle cells (VSMCs) was detected using the EdU method, and the proliferation of aortic smooth muscle cells (VSMCs) was assessed using the Cell-Light EdU Apollo567 in vitro assay kit (RiboBio, China, C10310-1).

[0056] 1) Dilute the EdU solution with SMEM complete medium at a volume ratio of 1000:1 to prepare an appropriate amount of 50 μM EdU medium; 2) Add 200 μL of 50 μM EdU medium to each well and incubate for 2 h, then discard the medium; 3) Use 200 μL of PBS per well and wash the cells twice with a shaker for 5 min each time; 4) Add 100 μL of cell fixation medium (PBS containing 4% paraformaldehyde) to each well, incubate at room temperature for 30 min, and discard the waste liquid; 5) Add 100 μL of glycine at a concentration of 2 mg / mL to each well, incubate on a decolorizing shaker for 5 min, then discard the glycine solution; incubate with 1×Apollo staining solution for half an hour at room temperature in the dark; after rinsing with PBS again, observe and count the cells labeled with EdU using a Leica DMI 8 fluorescence microscope (Germany).

[0057] 6) Add 200 μL of PBS to each well, wash on a decolorizing shaker for 5 min, and discard the PBS; 7) Add 200 μL of 1×Apollo staining reaction solution to each well, incubate at room temperature in the dark for 30 min, and then discard the staining reaction solution; 8) Add 200 μL of 1×Hoechst 33342 solution to each well to stain the cell nuclei; 9) Wash each well twice with 200 μL of PBS; 10) Add 200 μL of PBS to each well and store for later use; The procedure for detecting vascular smooth muscle cell migration (Transwell assay) is as follows: The migration ability of vascular smooth muscle cells (VSMCs) was assessed using the Transwell assay, following the instructions from Corning Pharmaceuticals (USA). The specific steps are as follows (using a Transwell chamber compatible with a 24-well plate as an example): 1) Cell preparation: Collect VSMCs treated with or transfected with exosomes, resuspend them in serum-free SMEM medium, and adjust the cell density to 5 × 10⁶ cells / year. 4 200μL per cell.

[0058] 2) Sample loading: Add 200 μL of cell suspension (containing 5 × 10⁶ cells / mL) to the upper chamber of a Transwell chamber (8 μm pore size, Corning, USA). 4 (1 cell), and at the same time, 20 ng / mL PDGF-BB was added to the upper chamber as a chemotactic inducer. 600 μL of SMEM complete medium containing 10% FBS was added to the lower chamber (24-well plate).

[0059] 3) Incubation: Place the Transwell chamber in a 24-well plate and incubate at 37°C in a 5% CO2 incubator for 24 hours.

[0060] 4) Fixation and Staining: Remove the chamber and gently wash twice with PBS. Gently wipe the unmigrated cells from the upper surface of the chamber with a cotton swab. Immerse the lower surface of the chamber in 4% paraformaldehyde solution and fix for 15 min at room temperature. Remove the chamber and wash once with PBS. Immerse the lower surface of the chamber in 1% crystal violet staining solution and stain for 30 min at room temperature. Wash the chamber twice with PBS to remove excess staining solution.

[0061] 5) Imaging and Counting: After the chambers are air-dried, they are observed and photographed under an inverted microscope (such as a Leica DMI 8 from Germany) at 200x magnification. Six different fields of view are randomly selected from each chamber, and the number of cells that have migrated to the lower surface is counted. The average value is taken as the number of migrated cells in that well.

[0062] Blank group, static culture control group, and simple laminar shear stress (15 dyne / cm) 2 The treatment methods for the following groups are as follows: laminar shear stress combined with exosome inhibitor (GW4869) group, and laminar shear stress combined with exosomes derived from lnc-SH2B2 knockout cell lines. Control group: Endothelial cells and vascular smooth muscle cells were co-cultured in a resting state according to the method in Example 2; Static culture control group: Endothelial cells and vascular smooth muscle cells were co-cultured in a resting state according to the method in Example 2; at the same time, PDGFBB was added to the VSMC layer as a control. Simple laminar shear stress treatment group: In addition to the static culture control group, shear stress was applied to the co-cultured endothelial layer with a shear parameter of 15 dyne / cm. 2 The stimulation time is 12 or 24 hours; Laminar shear stress combined with lnc-SH2B2 knockout cell line exosome group: The co-cultured endothelial cell line was replaced with the previously described lnc-SH2B2 knockout cell line, and other conditions were the same as those for simple laminar shear stress (15 dyne / cm). 2 The processing groups are the same; Finally, the laminar shear stress combined with exosome inhibitor (GW4869) group: In addition to the static culture control group, shear stress was applied to the co-cultured endothelial layer; at the same time, exosome inhibitor (GW4869, 10 μM) was added to the endothelial cell layer.

[0063] Culture supernatants from four groups of endothelial cells were collected: static culture, simple laminar flow shear stress treatment, laminar flow shear stress + GW4869 treatment, and lnc-SH2B2 knockout endothelial cell line + laminar flow shear stress treatment. Exosomes were extracted using the ultracentrifugation method described earlier. After the concentration was determined by BCA protein quantification, the cells were resuspended in PBS and adjusted to the same protein concentration (20 μg / mL). Each group of exosomes (20 μg / mL) was added to a VSMC culture system in the lower chamber of a Transwell assay and incubated for 24 h before Transwell migration assays were performed. The concentration of GW4869 (exosome inhibitor) used was 10 μM.

[0064] The results showed that, compared with the static control group, high shear stress treatment alone significantly inhibited PDGF-BB-induced VSMC proliferation and migration; however, the inhibitory effect of laminar shear stress was significantly weakened after the addition of exosome inhibitors or the use of exosomes from cell lines knocked out by lnc-SH2B2, and the proliferation and migration rates of VSMCs were significantly higher than those in the laminar shear stress treatment alone group. Figure 4 , Figure 5 , Figure 6 The above results indicate that endothelial cell-derived lnc-SH2B2 inhibits VSMC proliferation and migration through intercellular communication, and this molecule plays a key role in the treatment of atherosclerosis.

[0065] Meanwhile, VSMC phenotypic markers were detected by Western blot and qRT-PCR. The results showed that after lnc-SH2B2 knockdown treatment, the expression levels of VSMC shrinkage markers ACTA2, TAGLN, and CNN1 decreased, while the expression levels of synthesis markers OPN, KLF4, and KLF5 increased. Figure 7 ).

[0066] Example 4: Construction of recombinant expression vector.

[0067] (1) Construction of lnc-SH2B2 overexpression vector

[0068] Using human 293T cell cDNA as a template, specific primers were designed to amplify the full-length cDNA sequence of lnc-SH2B2. The amplified sequence is shown in SEQ ID NO. 11. Appropriate restriction enzyme sites (EcoRI digestion) were introduced upstream and downstream of the primers. The primer sequences are shown in SEQ ID NO. 9~SEQ ID NO. 10 (5...， -3 ， As shown in the image: lncSH2B2-F: TCCACCGGTCGCCACCGGCAGAGCGTAAAACAAGCCCCAGCCCTACT; lncSH2B2-R:TCGAGCGGAATTCGATTTATTGTGTTTGTATAAAAGATATTTACT.

[0069] The PCR amplification system is shown in Table 3; Table 3 PCR amplification system

[0070] The PCR amplification procedure is shown in Table 4. Table 4 PCR amplification program

[0071] The amplified products were recovered and purified by agarose gel electrophoresis, digested with the restriction endonuclease EcoRI, and the digested fragments were recovered; the digestion system is shown in Table 5. Table 5 Enzyme digestion system

[0072] The K2 vector (purchased from Invitrogen) was recovered by digestion with the same enzyme to obtain a linearized vector; the linearized vector was ligated with the lnc-SH2B2 digested fragment using Exnase MultiS (purchased from Novizan Biotechnology) to obtain a recombinant plasmid; the ligation system is shown in Table 6. Table 6 Connection System

[0073] The recombinant plasmid was transformed into *E. coli* DH5α competent cells and plated on LB agar plates containing ampicillin, then incubated overnight at 37°C. Positive clones were picked for sequencing verification. The validated plasmid was named K2-lnc-SH2B2. The plasmid was extracted using an endotoxin-free plasmid extraction kit (Tiangen Biotech Co., Ltd.) for later use.

[0074] Seeding and transfection of vascular smooth muscle cells

[0075] 1) The vascular smooth muscle cells were cultured using the same method as in Example 2. When the density reached about 90%, the culture medium was discarded, and the cells were washed twice with preheated PBS. 2) Add 0.25% trypsin and digest for 5 minutes. Observe under a microscope until most cells float up, then immediately add an equal volume of SMEM complete medium to stop the digestion. 3) Use a pipette tip to blow off the attached cells and mix them evenly. Transfer the cell suspension to a centrifuge tube, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant. 4) Wash twice with PBS, then centrifuge at 1000 rpm for 5 minutes; 5) Gently resuspend the cell pellet in SMEM complete medium, evenly distribute it into each well, add more SMEM complete medium to make up the volume, gently shake well, and incubate in an incubator; observe the cell status after about 24 hours. When the cell confluence reaches about 75-90%, transfect vascular smooth muscle cells with K2-lnc-SH2B2 plasmid; the transfection method is performed according to the Invitrogen Lipofectamine 3000 kit instructions; set up 3 replicates for each group; after transfection, incubate the cells at 37°C in a 5% CO2 incubator; observe the cell status 48 hours after transfection. If the cells are growing well, they can be collected.

[0076] Phenotypic markers of VSMCs were detected by Western blot and qRT-PCR. The results showed that after lnc-SH2B2 overexpression treatment, the expression levels of VSMC contractile markers ACTA2, TAGLN, and CNN1 increased, while the expression levels of synthetic markers OPN, KLF4, and KLF5 decreased. Figure 8 This indicates that lnc-SH2B2 can inhibit the transformation of VSMCs from condensed to synthetic forms, i.e., inhibit the phenotypic transformation of VSMCs.

[0077] Example 5: Partial Left Carotid Artery (LCA) Ligation Mouse Model

[0078] (1) Construction of AAV

[0079] Shanghai Redmond Biotechnology Co., Ltd. designed and packaged recombinant AAV serotype 9 (AAV9) plasmids named AAV9-SM22α-lnc-SH2B2 and AAV9-SM22α-Control. This transgene was inserted into an AAV vector and regulated by the mouse SM22α promoter to achieve smooth muscle cell-specific expression. To prepare viral particles, the recombinant AAV expression vector, along with the pHelper plasmid providing adenovirus helper function and the pAAV-RC plasmid providing the AAV replication and cap genes, were co-transfected into AAV-293 cells. Cells were collected and lysed 48–72 h post-transfection to release the AAV particles mainly stored within the cells. The original viral lysate was subjected to iodixanol density gradient centrifugation and ultrafiltration to remove cell debris and increase the viral particle concentration. Finally, quantitative PCR analysis was used to determine the concentration of the purified AAV genome.

[0080] (2) Partial LCA ligation surgery

[0081] Eight-week-old male Apoe were selected - / - Mice were fed a high-fat diet (HFD). At week 3, the left common carotid artery (LCA) was partially ligated and injected with the AAV9 viral vector. Fifty mice were purchased from Jicui Pharmaceutical Co., Ltd., and their pre-operative weight was approximately 25-28g. Mice in all groups were active eaters with stable feed consumption, and no obvious abnormalities were observed in general behavior. Mice were anesthetized with isoflurane inhalation, fixed in a supine position, and the midline of the neck was incised to separate the left common carotid artery (LCA). The LCA was ligated with 6-0 silk suture (approximately 70% of the vessel diameter) approximately 5mm proximal to the bifurcation to establish a blood flow disturbance model. In the sham-operated group, only the artery was separated without ligation. Samples were collected 8 weeks post-operation.

[0082] (3) Tail vein injection

[0083] After LCA ligation in mice, mice were injected weekly via tail vein for four consecutive weeks with either a control suspension or an lnc-SH2B2 virus suspension, with each dose containing 5 × 10⁻⁶ mmol / L. 11 Vector genome / only.

[0084] (4) In a partial left carotid artery (LCA) ligation mouse model, AAV9 virus overexpressing lnc-SH2B2 was injected via the tail vein. After 8 weeks of high-fat feeding, the mice were sacrificed, and left carotid artery tissue was harvested. Pathological analysis of the tissue sections was performed using immunohistochemistry, immunofluorescence, and Sirius red and EVG staining methods, allowing direct observation of changes in vascular intimal hyperplasia and plaque area. The results showed that overexpression of lnc-SH2B2 significantly reduced vascular intimal hyperplasia, delayed vascular remodeling, and inhibited the formation of atherosclerotic plaques. Figure 9 This further validates the important role of lnc-SH2B2 in protecting against atherosclerosis.

[0085] The embodiments of this disclosure have been described above. However, these embodiments are for illustrative purposes only and are not intended to limit the scope of this disclosure. The scope of this disclosure is defined by the appended claims and their equivalents. Various substitutions and modifications can be made by those skilled in the art without departing from the scope of this disclosure, and all such substitutions and modifications should fall within the scope of this disclosure.

Claims

1. The use of long non-coding RNA lnc-SH2B2 and substances overexpressing long non-coding RNA lnc-SH2B2 in the preparation of drugs for treating and / or preventing atherosclerosis; characterized in that, The sequence of the long non-coding RNA lnc-SH2B2 is shown in SEQ ID NO.12; The cDNA sequence of the long non-coding RNA lnc-SH2B2 is at least one of the following: b1) At least one of the nucleotide sequences shown in SEQ ID NO. 11; b2) A complementary, degenerate, or homologous sequence of at least one of the nucleotide sequences shown in b1), wherein the homologous sequence is a nucleotide sequence having at least 85% homology with the nucleotide sequence shown in b1). b3) The nucleotide sequence that encodes an amino acid sequence with the same function formed by substitution and / or deletion and / or addition of one or more amino acids due to artificial modification or natural nucleic acid polymorphism; b4) A nucleotide sequence that hybridizes under strict conditions with the nucleotide sequence shown in b1), b2), or b3) and is capable of encoding a protein with the same function.

2. The application according to claim 1, characterized in that, The substance that overexpresses the long non-coding RNA lnc-SH2B2 is any one of c1)-c3) below: c1) An expression cassette containing any one of the nucleotides described in b1)-b4); c2) A recombinant vector containing any of the nucleotides described in b1)-b4) or the expression cassette described in c1); c3) A recombinant virus or host cell containing at least one of the nucleotides described in any one of b1)-b4), the expression cassette described in c1), or the recombinant vector described in c2).

3. The application according to claim 2, characterized in that, The recombinant virus includes the AAV9 virus; and / or, The host cells include vascular endothelial cells.

4. The application according to claim 2, characterized in that, The recombinant vector includes B-lnc-SH2B2; ​​B includes at least one of the following vectors: K2, pcDNA3.1, pCMV, or pAAV.

5. The application according to claim 1, characterized in that, The long non-coding RNA lnc-SH2B2 is derived from vascular endothelial cells; and / or, The long non-coding RNA lnc-SH2B2 can inhibit the proliferation, migration, and phenotypic transformation of vascular smooth muscle cells, and inhibit the formation of atherosclerotic plaques and vascular intimal hyperplasia.

6. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises any one of the long non-coding RNAs lnc-SH2B2 described in b1) to b4) or any one of the substances described in c1) to c3); the pharmaceutical composition has at least one of the following uses: a drug for treating and / or preventing atherosclerosis; and / or inhibiting the proliferation, migration and phenotypic transformation of vascular smooth muscle cells and / or inhibiting the formation of atherosclerotic plaques and vascular intimal hyperplasia.

7. The pharmaceutical composition according to claim 6, characterized in that, The drug also includes pharmaceutically acceptable excipients.

8. The application of inhibitors or silencing agents of long non-coding RNA lnc-SH2B2 in the construction of long non-coding RNA lnc-SH2B2 knockout cell lines; characterized in that, The knockout cell line is used to exclude the role of endogenous lnc-SH2B2 in exosomes.

9. The application according to claim 8, characterized in that, The inhibitor includes siRNA; the silencing agent includes a paired sgRNA that specifically targets the long non-coding RNA lnc-SH2B2; The sequence of the siRNA is shown in SEQ ID NO.3~SEQ ID NO.4; The sequence of the sgRNA is shown in SEQ ID NO.5~SEQ ID NO.

6.

10. A knockout cell line, characterized in that, The knockout cell line shown was obtained by knocking out the lnc-SH2B2 gene in vascular endothelial cells using CRISPR-Cas9 technology and a pairing sgRNA that specifically targets the long non-coding RNA lnc-SH2B2.

Images