A HTNV VLP secretory enhanced nucleic acid vaccine, its preparation method, and its application

Abstract

This invention relates to the field of biotechnology, specifically to an HTNV VLP secretion-enhanced nucleic acid vaccine, its preparation method, and its application. The immunogen of this vaccine is the DNA of the Hantan virus envelope glycoprotein HTNV GP, selected from wild-type or cysteine-mutant forms, with an EABR fragment inserted at the end. The nucleotide sequence of the EABR fragment is shown in SEQ ID NO.1. The cysteine-mutant C3 is obtained by mutating the S291, T731, and G835 sites of the wild-type HTNV GP. The nucleic acid vaccine platform provided by this invention uses plasmid DNA as the antigen form, including DNA vaccine formulations or mRNA vaccine formulations. It has a short construction cycle, low production cost, and is easy to scale up. Furthermore, this vaccine can directly express the antigen in its natural conformation in vivo, possessing both endogenous and exogenous antigen presentation pathways, resulting in stronger immunogenicity.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to an HTNV VLP secretory enhanced nucleic acid vaccine and its preparation method and application. Background Technology

[0002] Hantavirus (HTNV) is a rodent-borne pathogen that causes two serious acute infectious diseases in humans: hemorrhagic fever with renal syndrome (HFRS) and Hantavirus cardiopulmonary syndrome (HCPS). HFRS is prevalent in Eurasia, particularly China and South Korea; statistics show that over 90% of new HFRS cases worldwide occur in China annually. HCPS, on the other hand, is more common in the Americas. Clinical manifestations of HFRS include fever, hemorrhage, shock, and renal impairment, with a mortality rate as high as 15% in severe cases. HCPS is characterized by acute respiratory failure, with a mortality rate as high as 30%–50%.

[0003] HFRS is mainly composed of the genus Orthohantavirus ( Orthohantavirus The disease is caused by Hantaan virus (HTNV) and Seoul virus (SEOV). Due to the high mortality rate and wide geographical distribution of HTNV infection, it has become a global public health problem. Currently, there are no specific treatments for HTNV, making vaccination the most effective means of preventing and controlling the spread of the disease. Since the 1990s, my country has begun using bivalent inactivated vaccines containing HTNV and SERV, which are the main means of preventing HFRS. However, in practical application, existing vaccines have also revealed some limitations, the most prominent being the low titer of neutralizing antibodies they induce and their relatively short duration of action. Therefore, accelerating the development of new HTNV vaccines is urgently needed.

[0004] In recent years, research on HTNV vaccines has gradually shifted its focus to genetically engineered vaccines such as nucleic acid vaccines, subunit vaccines, and virus-like particle (VLP) vaccines. Among these, nucleic acid vaccines have become a current research hotspot due to their advantages such as flexible design and ease of large-scale production. However, the immune responses they induce are biased, requiring optimization of antigen design and immunization strategies to enhance the ability to synergistically activate type 1 helper T cell (Th1) and type 2 helper T cell (Th2) immune responses.

[0005] The HTNV envelope glycoprotein (GP) is a key antigen inducing immune responses. Previously, specific amino acid sites S291, T731, and G835 on GP were mutated into cysteine ​​residues (C3) to introduce disulfide bonds. The formation of these disulfide bonds maintains a stable pre-fusion conformation of C3. When prepared as a nucleic acid vaccine, GP can elicit both humoral and cellular immune responses in mice. However, because the antigen GP expressed in this vaccine is mainly located on the host cell membrane, its secretion capacity is low. Therefore, although the vaccine induces high levels of neutralizing antibodies, it is less effective in activating Th2 CD4+. + The ability of T-cell immune responses still needs further improvement. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides an HTNV VLP secretion-enhanced nucleic acid vaccine, its preparation method, and its application. Based on the theory that endosome sorting complexes required for transport (ESCRT) can mediate the formation of virus-like particles (VLPs) from GPs and their secretion outside the cell, this invention uses the DNA of wild-type HTNV GPs (WT) and mutant C3 as immunogens. By inserting the binding region (EABR) of ESCRT and ALG-2-interacting protein X (ALIX) at their ends, the ability of GPs on the membrane surface to form VLPs is enhanced, thereby improving their immunogenicity.

[0007] The specific technical solution provided by this invention is as follows: This invention provides an HTNV VLP secretory booster nucleic acid vaccine. The immunogen of this vaccine is the DNA of the Hantan virus envelope glycoprotein HTNV GP. The DNA is selected from wild type or cysteine ​​mutant, and the EABR fragment is inserted at the end of the DNA. The nucleotide sequence of the EABR fragment is shown in SEQ ID NO.1. The cysteine ​​mutant C3 is obtained by mutating the S291, T731 and G835 sites of the wild type HTNV GP. The gene sequence of the wild type HTNV GP is shown in SEQ ID NO.12.

[0008] In a preferred embodiment of the present invention, the EABR fragment is inserted at the C-terminus of HTNV GP wild-type and cysteine ​​mutant.

[0009] In a preferred embodiment of the present invention, the carrier of the nucleic acid vaccine is pVAX1.

[0010] This invention also provides a method for preparing the HTNV VLP secretory booster nucleic acid vaccine, comprising the following steps: The EABR fragment was ligated with the double-digested pCAGGS vector to construct the recombinant plasmid pCAGGS-EABR. The wild-type and cysteine ​​mutant fragments of HTNV GP were amplified separately, and the amplified fragments were ligated into the double-digested pCAGGS-EABR vector to obtain pCAGGS-WT-EABR and pCAGGS-C3-EABR recombinant plasmids; The pCAGGS-WT-EABR and pCAGGS-C3-EABR are subcloned into the linearized DNA vaccine vector pVAX1 to obtain the pVAX1-WT-EABR and pVAX1-C3-EABR recombinant plasmids, which are the nucleic acid vaccines.

[0011] As a preferred embodiment of the present invention, the pCAGGS carrier adopts... Xho I and Bgl II was double-digested, and the pCAGGS-EABR vector was used. EcoR I and Xho The pVAX1 vector was subjected to double enzyme digestion (I). Kpn I undergoes single enzyme digestion.

[0012] In a preferred embodiment of the present invention, the EABR fragment is obtained by PCR splicing, and the gene sequences of the primers used are shown in SEQ ID NO.2~11 in sequence.

[0013] In a preferred embodiment of the present invention, when amplifying the wild-type and cysteine ​​mutant fragments of HTNV GP, the gene sequence of the upstream primer is shown in SEQ ID NO.13 and the gene sequence of the downstream primer is shown in SEQ ID NO.14.

[0014] The present invention also provides the application of the HTNV VLP secretion-enhanced nucleic acid vaccine described above in the preparation of a drug for preventing Hantan virus infection.

[0015] In a preferred embodiment of the present invention, the nucleic acid vaccine includes a DNA vaccine formulation or an mRNA vaccine formulation, wherein the coding sequence of the mRNA vaccine is the same as that of the DNA vaccine.

[0016] The present invention also provides a drug for preventing Hantan virus infection, comprising the HTNV VLP secretory enhanced nucleic acid vaccine, and a pharmaceutically acceptable carrier, adjuvant or diluent.

[0017] HTNV GP is a major target for inducing neutralizing antibodies. This invention first synthesizes the EABR fragment using PCR, then ligates EABR into the linearized pCAGGS vector to obtain the recombinant plasmid pCAGGS-EABR. Subsequently, wild-type HTNV GP (WT) and mutant C3 are subcloned into the linearized pCAGGS-EABR vector to obtain the recombinant plasmids pCAGGS-WT-EABR and pCAGGS-C3-EABR, respectively. Western blotting confirmed the correct expression of these plasmids.

[0018] Subsequently, pCAGGS-WT-EABR and pCAGGS-C3-EABR were subcloned into the linearized DNA vaccine vector pVAX1 to obtain pVAX1-WT-EABR and pVAX1-C3-EABR, which were used for subsequent animal immunization. Mice immunized with these four plasmids were then tested for the induced T-cell immune responses and serum neutralizing antibody titers. The results showed that plasmids pVAX1-WT-EABR and pVAX1-C3-EABR significantly enhanced Th1 and Th2 immune responses, and the neutralizing antibody titers of HTNV GP in mouse serum were higher than in other groups. This indicates that the design strategy of HTNV VLP secretion-enhancing nucleic acid vaccines can induce both humoral and cellular immune responses.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention effectively enhances the aggregation of GP on the cell membrane surface and the formation and secretion of virus-like particles by inserting the EABR fragment (the binding region of ESCRT and ALIX) at the end of the wild-type and cysteine ​​mutant C3 of HTNV GP. Western blotting results showed that the expression level of GP in the supernatant of the pCAGGS-WT-EABR and pCAGGS-C3-EABR groups after EABR fusion was significantly higher than that in the control group without EABR fusion, and showed better secretion efficiency under both reducing and non-reducing conditions, indicating that this design strategy can effectively promote the release of antigen in the form of VLP, thereby improving immunogenicity.

[0020] (2) Animal immunization experiments showed that the pVAX1-WT-EABR and pVAX1-C3-EABR nucleic acid vaccines constructed in this invention can induce high levels of HTNV-specific neutralizing antibodies in mice. HTNV-based neutralization experiments showed that the serum neutralizing antibody titers of the two vaccine-immunized mice were significantly higher than those of the control group (pVAX1-WT and pVAX1-C3 groups) without EABR fusion. The pVAX1-C3-EABR group induced the highest neutralizing antibody titer, indicating that the introduction of EABR can effectively enhance the vaccine-induced humoral immune response.

[0021] (3) The vaccine provided by this invention can enhance humoral immunity while also synergistically activating cellular immune responses. ELISpot assay results showed that, under HTNV GP stimulation, the secretion levels of Th1 cytokines (IFN-γ, IL-2) and Th2 cytokines (IL-4, IL-10) in the spleen cells of mice immunized with pVAX1-WT-EABR and pVAX1-C3-EABR were significantly higher than those in the control group without EABR fusion. This indicates that the vaccine of this invention can simultaneously induce Th1 and Th2 immune responses, compensating for the shortcomings of existing nucleic acid vaccines in terms of immune response bias, and possessing superior immunoprotective potential.

[0022] (4) The nucleic acid vaccine platform provided by this invention uses plasmid DNA or mRNA as the antigen form, and has advantages such as flexible design, short construction cycle, low production cost, and ease of large-scale production and quality control. Compared with traditional inactivated vaccines, the vaccine of this invention does not require virus culture and inactivation treatment, and has lower biosafety risks during production. Compared with protein subunit vaccines, the vaccine of this invention can directly express antigens of natural conformation in vivo, and has both endogenous and exogenous antigen presentation pathways, resulting in stronger immunogenicity. In addition, the technical solution described in this invention is not only applicable to nucleic acid vaccines, but can also be extended to other types of vaccine formulations, and has good versatility and application prospects. Attached Figure Description

[0023] Figure 1 This is a graph showing the PCR results for the EABR fragment.

[0024] Figure 2 The image shows the PCR identification results of the pCAGGS-EABR plasmid.

[0025] Figure 3 The image shows the PCR results for the WT and C3 fragments.

[0026] Figure 4 PCR identification results for pCAGGS-WT-EABR and pCAGGS-C3-EABR recombinant plasmids.

[0027] Figure 5 The image shows the PCR amplification results of the EABR fragment.

[0028] Figure 6 The image shows the PCR identification results of plasmids pVAX1-WT-EABR and pVAX1-C3-EABR.

[0029] Figure 7 The image shows the identification results of cells and supernatant in the WT and WT-EABR groups.

[0030] Figure 8 The image shows the identification results of the supernatants of the WT and WT-EABR groups at different concentration ratios under reducing electrophoresis conditions.

[0031] Figure 9 The image shows the identification results of the supernatants of the WT and WT-EABR groups at different concentration ratios under non-reducing electrophoresis conditions.

[0032] Figure 10 The image shows the identification results of cells and supernatant in the C3 and C3-EABR groups.

[0033] Figure 11 The image shows the identification results of the supernatants of the C3 and C3-EABR groups at different concentration ratios under reducing electrophoresis conditions.

[0034] Figure 12 The image shows the identification results of the supernatants of the C3 and C3-EABR groups at different concentration ratios under non-reducing electrophoresis conditions.

[0035] Figure 13 To detect the serum neutralizing antibody titers in mice immunized with DNA vaccines in each group.

[0036] Figure 14 To detect the serum neutralizing antibody titers in mice immunized with mRNA vaccines in each group.

[0037] Figure 15 The secretion level of specific IFN-γ was induced in mice immunized with DNA vaccines in each group.

[0038] Figure 16 The secretion level of specific IL-2 induced in mice immunized with DNA vaccines in each group was determined.

[0039] Figure 17 The secretion level of specific IL-4 induced in mice immunized with DNA vaccines in each group was determined.

[0040] Figure 18 The secretion level of specific IL-10 induced in mice immunized with DNA vaccines in each group was determined.

[0041] Figure 19 The specific IFN-γ secretion level was induced in mice immunized with mRNA vaccines in each group.

[0042] Figure 20 The specific IL-2 secretion level was induced in mice immunized with mRNA vaccines in each group.

[0043] Figure 21 The specific IL-4 secretion level was induced in mice immunized with mRNA vaccines in each group.

[0044] Figure 22 The specific IL-10 secretion level was induced in mice immunized with mRNA vaccines in each group. Detailed Implementation

[0045] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.

[0046] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.

[0047] 1. Experimental materials Competent DH5α cells were purchased from Sangon Biotech Ltd.; high-fidelity DNA polymerase 2 × KeyPo MasterMix (Dye Plus) was purchased from Vazyme; restriction endonucleases ( EcoR I, Xho I, Bgl II) PCR products were purchased from TaKaRa; the NovoRec® plus One step PCR Cloning Kit was purchased from Novoprotein. The wild-type Hantan virus envelope glycoprotein HTNV GP (i.e., WT-type HTNV GP) was synthesized by Nanjing Genscript Biotech Co., Ltd.; the EABR primer sequence was synthesized by Sangon Biotech Co., Ltd.; the pCAGGS vector was a gift from the Chinese Academy of Agricultural Sciences. The DNA agarose gel extraction kit was purchased from CWBIO; BSA was purchased from YEASEN; Triton X-100; 4% paraformaldehyde; HRP-Goat Anti-mouse IgG were purchased from Sangon Biotech Co., Ltd.; the precipitation-type TMB membrane substrate solution was purchased from Beijing Baizhi Biotechnology Co., Ltd.; the ELISpot (IFN-γ, IL-2, IL-4, IL-10) kit was purchased from Mabtech; ultrafiltration tubes were purchased from Millipore; and the ELISpot plate counter was purchased from Mabtech.

[0048] The HTNV76-118 virus strain was preserved in our laboratory, and antibodies G2-10 and 1A8 were prepared and preserved in our laboratory. The human embryonic kidney cell line HEK-293T was purchased from Clontech. The African green monkey kidney cell line Vero E6 was purchased from the American Type Culture Collection (ATCC).

[0049] 2. Experimental Methods 2.1 Construction of plasmids based on pCAGGS vector 2.1.1 Construction of pCAGGS-EABR plasmid The EABR sequence used in this experiment was synthesized using a one-step PCR-based gene synthesis method. The EABR sequence is shown in SEQ ID NO.1. First, 10 primers (gene sequences shown in SEQ ID NO.2~11) were designed using NIH HPC Systems, and the EABR splicing product was obtained by PCR assembly.

[0050] SEQ ID NO.1: GCTTCCCAGGAAACCCTGATCACAGGGAAATGGGAGAAACCCTTCCAGAGGAAGTAGGTGAGTACAGACAGCCCTCTGGGGGCTCAGTGCCTGTCAGCCCAGGGCCTCCATCTGGACTGGAGCCAACAAGCAGCAGCCCATACGGATCGTTCAACTCATC AATAAATAATATTCATGAAATGGAAATACAGCTGAAAGATGCTCTGGAGAAAAATCAGCAGTGGCTCGTGTATGATCAGCAGCGGGAAGTCTATGTAAAAGGACTTTTAGCAAAGATATTTGAGTTGGAAAAGAAAACGGAAACAGCTGCTCATTCACTCTAATGA SEQ ID NO.2: EABR-F1: 5'-GCATGGTACCCGGGCATGGCTCGAGGCTCTCCCAGGAAACCCT-3'; SEQ ID NO.3: EABR-F2: 5'-CCTACTTCCTCTGGAAGGGTTCCTCCCATTTCCCTGTGATCAGGGTTTCCTGGGAGAGC-3'; SEQ ID NO.4: EABR-F3: 5'-ACCCTTCCAGAGGAAGTAGGTGAGTACAGACAGCCCTCTGGGGGCTCAGTGCCTGTCAG-3'; SEQ ID NO.5: EABR-F4: 5'-GGCTGCTGCTTGTTGGCTCCAGTCCAGATGGAGGCCCTGGGCTGACAGGCACTGAGCCC-3'; SEQ ID NO.6: EABR-F5: 5'-GCCACCAAGCAGCAGCCCATACGGATCGTTCAACTCATCAATAAATAATATTCATGAAA-3'; SEQ ID NO.7: EABR-F6: 5'-TCCAGAGCATCTTTCAGCTGTATTTCCATTTCATGAATATTATTTATT-3'; SEQ ID NO.8: EABR-F7: 5'-CAGCTGAAAGATGCTCTGGAGAAAAATCAGCAGTGGCTCGTGTATGATCAGCAGCGGGA-3'; SEQ ID NO.9: EABR-F8: 5'-CAACTCAAAGATCTTTGCTAAAAGTCCTTTTACATAGACTTCCCGCTGCTGATCATACA-3'; SEQ ID NO.10: EABR-F9: 5'-ACTTTTAGCAAAGATCTTTGAGTTGGAAAAGAAAACGGAAACAGCTGCTCATTCACTCT-3'; SEQ ID NO.11: EABR-F10: 5'-GGCAGAGGGAAAAGATCTTCATTAGAGTGAATGAGCAGCTGTTT-3'.

[0051] Primer PCR was performed using EABR-F1~10 (gene sequences shown in SEQ ID NO.2~11) as templates. The PCR reaction system was as follows: 1 µL each of EABR-F1~10, 25 µL of high-fidelity DNA polymerase, and 15 µL of ddH2O.

[0052] The reaction conditions were as follows: pre-denaturation at 98℃ for 30 s, denaturation at 98℃ for 15 s, annealing at 55℃ for 10 s, and extension at 72℃ for 30 s / kb. The denaturation to extension cycle was 30 times, and the remaining steps were repeated once. The PCR products were verified by 1% agarose gel electrophoresis.

[0053] like Figure 1 The image shows the PCR results of the EABR fragment, where a band matching the expected size can be observed; the gel was cut and the target band was recovered using a gel extraction kit.

[0054] For pCAGGS vector Xho I and Bgl Double digestion at site II, in the following system: 1 μg pCAGGS vector, Xho I and Bgl II. 1 µL each of 10×Buffer and ddH2O were added to make a total volume of 30 µL. The enzyme was digested in a 37℃ water bath for 2 h. After verification of the digestion product by 1% agarose gel electrophoresis, the gel was excised and the target band was recovered using a gel extraction kit. The PCR product obtained above was ligated with the double-digested pCAGGS vector to construct the pCAGGS-EABR recombinant plasmid. The ligation reaction system was: 50 ng pCAGGS vector, 30 ng EABR fragment, 0.5 μL NovoRec Plus recombinase, 2 µL 5×Buffer, and ddH2O to make a total volume of 10 µL. The ligation reaction conditions were: 50℃ water bath for 30 min.

[0055] Add 10 µL of the ligation product to 50 µL of DH5α competent cells, gently mix, incubate on ice for 30 min, heat shock at 42°C for 45 s, immediately incubate on ice for 3 min, add 600 µL of antibiotic-free LB medium, mix well, and incubate at 37°C with shaking for 1 h. Centrifuge at 4000×g for 3 min, discard most of the supernatant, and retain 200 µL to resuspend the cells. Spread the bacterial suspension evenly on ampicillin-resistant 2×YT solid culture plates, and incubate the plates inverted at 37°C overnight. Pick single colonies from the plates and inoculate them into 5 mL of ampicillin-resistant 2×YT culture medium. Incubate overnight at 37°C with shaking. Collect the bacteria for plasmid extraction and identification by PCR.

[0056] 1 ng of recombinant plasmid pCAGGS-EABR, 1 µL of upstream primer EABR-F1 (gene sequence as shown in SEQ ID NO.2), 1 µL of downstream primer EABR-F10 (gene sequence as shown in SEQ ID NO.11), 25 µL of high-fidelity DNA polymerase, and 15 µL of ddH2O were used to amplify the EABR fragment. The PCR product was verified by 1% agarose gel electrophoresis. Figure 2 The image shows the PCR identification results of the pCAGGS-EABR plasmid. A band matching the expected size can be observed. The corresponding recombinant plasmid was sent to Sangon Biotech for sequencing verification, and the pCAGGS-EABR plasmid was obtained.

[0057] 2.1.2 Construction of pCAGGS-WT-EABR and pCAGGS-C3-EABR plasmids The WT-type HTNV GP used in this experiment was synthesized by Nanjing GenScript Biotech after codon optimization (gene sequence shown in SEQ ID NO. 12). The C3-type HTNV GP used in this experiment was obtained by our team through PCR mutation of the S291, T731, and G835 sites of wild-type HTNV GP to cysteine ​​residues, as shown in bold in SEQ ID NO. 12. The sequences of the above WT-type HTNV GP and C3-type HTNV GP were subcloned into the pCAGGS vector to obtain pCAGGS-WT and pCAGGS-C3, respectively. The specific construction process is as follows:

[0058] The WT and C3 fragments were amplified by PCR, and the PCR products were subjected to 1% agarose gel electrophoresis. The target bands WT and C3 were then excised and recovered. The recovered target bands were compared with those obtained by PCR. EcoR I and Xho The pCAGGS vector, after double digestion with enzyme I, was ligated to construct the pCAGGS-WT and pCAGGS-C3 recombinant plasmids, following the same experimental procedures as described previously. The transformed recombinant plasmids were sent to Sangon Biotech Co., Ltd. for sequencing and stored for later use. The specific PCR reaction system, reaction conditions, ligation reaction, and subsequent transformation were the same as those used in the construction of the CAGGS-EABR plasmid.

[0059] In this experiment, WT and C3 were subcloned into the linearized pCAGGS-EABR plasmid, as detailed below: Since the N-terminal and C-terminal sequences of WT and C3 are identical, they can share a single primer pair. Using WT as a template, primers were designed. The upstream primer WT-F gene sequence is shown in SEQ ID NO.13, and the downstream primer WT-R gene sequence is shown in SEQ ID NO.14.

[0060] SEQ ID NO.12: TGATGGCTTCCCTGGTGTGGCCTGTGCTGACCCTGAGAAACGTGTACGACATGAAGATCGAATGCCCACACACCGTGAGCTTCGGCGAAAACTCCGTGATCGGATACGTGGAGCTGCCACCTGTGCCCCTGGCTGACACCGCTCAGATGGTGCCTGAGAGCTCCTGCAACATGGACAACCACCAGAGCCTGAACACCATCACCAAGTACACCCAGGTGTCTTGGCGTGGAAAGGCCGACCAGAGCCAGTCTAGCCAGAACTCTTTCGAGACCGTGAGCACCGAAGTGGACCTGAAGGGCACCTGCGTGCTGAAGCACAAGATGGTGGAGGAAAGCTACCGCTCCAGGAAGTCTGTGACCTGCTACGACCTGAGCTGCAACTCCACCTACTGCAAGCCAACCCTGTACATGATCGTGCCCATCCACGCTTGCAACATGATGAAGTCCTGCCTGATCGCCCTGGGCCCTTACAGAGTGCAGGTGGTGTACGAACGTTCTTACTGCATGACCGGAGTGCTGATCGAGGGAAAGTGCTTCGTGCCAGACCAGTCTGTCGTGAGCATCATCAAGCACGGTATCTTCGACATCGCTTCCGTGCACATCGTGTGCTTCTTCGTGGCCGTGAAGGGCAACACCTACAAGATCTTCGAGCAGGTGAAGAAGTCCTTCGAATCTACCTGCAACGACACCGAGAACAAGGTGCAGGGATACTACATCTGCATCGTGGGCGGAAACAGCGCTCCCATCTACGTGCCTACCCTGGACGACTTCCGCAGCATGGAAGCCTTCACCGGCATCTTCAGGTCCCCACACGGAGAGGACCACGACCTGGCTGGAGAGGAAATCGCC AGCTACTCCATCGTGGGCCCTGCTAACGCCAAGGTGCCACACAGCGCTTCCTCTGACACCCTGTCCCTGATCGCCTACAGCGGAATCCCTTCCTACAGCTCCCTGTCCATCCTGACCTCTAGCACCGAAGCTAAGCACGTGTTCTCTCCAGGCCTGTTCCCCAAGCTGAACCACACCAACTGCGACAAGTCCGCTATCCCACTGATCTGGACCGGTATGATCGACCTGCCTGGCTACTACGAGGCCGTGCACCCATGCACCGTGTTCTGCGTGCTGTCCGGCCCCGGAGCTTCTTGCGAGGCCTTCAGCGAAGGTGGCATCTTCAACATCACCTCTCCTATGTGCCTCGTGAGCAAGCAGAACAGATTCCGTCTGACCGAGCAGCAGGTGAACTTCGTGTGCCAGCGCGTGGACATGGACATCGTGGTGTACTGCAACGGCCAGAGGAAGGTGATCCTGACCAAGACCCTGGTGATCGGACAGTGCATCTACACCATCACCAGCCTGTTCTCCCTGCTGCCAGGAGTGGCTCACTCCATCGCTGTGGAGCTGTGCGTGCCCGGATTCCACGGTTGGGCTACCGCTGCTCTGCTGGTGACCTTCTGCTTCGGTTGGGTGCTGATCCCTGCTATCACCTTCATCATCCTGACCGTGCTGAAGTTCATCGCCAACATCTTCCACACCTCCAACCAGGAAAACCGCCTGAAGTCTGTGCTGAGGAAGATCAAGGAGGAGTTCGAGAAGACCAAGGGAAGCATGGTGTGCGACGTGTGCAAGTACGAGTGCGAAACCTACAAGGAGCTGAAGGCTCACGGTGTGTCTTGCCCCCAGAGCCAGTGCCCTTACTGCTTCACCCACTGCGAGCCAACCGAAGCCGCTTTCCAGGCCCACTACAAGGTGTGCCAGGTGACCCACCGCTTCAGGGACGACCTGAAGAAG ACCGTGACCCCACAGAACTTCACCCCCGGCTGCTACAGAACCCTGAACCTGTTCAGATACAAGTCTCGTTGCTACATCTTCACCATGTGGATCTTCCTGCTGGTGCTGGAAAGCATCCTGTGGGCCGCTTCTGCTAGCGAGACCCCACTGACCCCCGTGTGGAACGACAACGCTCACGGTGTGGGCAGCGTGCCAATGCACACCGACCTGGAACTGGACTTCTCCCTGACCTCCTCTAGCAAGTACACCTACCGCAGGAAGCTGACCAACCCCCTGGAGGAAGCTCAGTCTATCGACCTGCACATCGAGATCGAGGAACAGACCATCGGAGTGGACGTGCACGCTCTGGGTCACTGGTTCGACGGACGCCTGAACCTGAAGACCAGCTTCCACTGCTACGGTGCTTGCACCAAGTACGAGTACCCCTGGCACACCGCCAAGTGCCACTACGAGAGGGACTACCAGTACGAAACCTCCTGGGGCTGCAACCCTTCTGACTGCCCAGGAGTGGGCACCGGTTGCACCGCTTGCGGACTGTACCTGGACCAGCTGAAGCCTGTGGGTTCTGCCTACAAGATCATCACCATCAGATACAGCAGACGTGTGTGCGTGCAGTTCGGCGAGGAAAACCTGTGCAAGATCATCGACATGAACGACTGCTTCGTGTCCCGTCACGTGAAGGTGTGCATCATC GGAACCGTGTCTAAGTTCAGCCAGGGCGACACCCTGCTGTTCTTCGGACCACTGGAGGGAGGTGGCCTGATCTTCAAGCACTGGTGCACCTCTACCTGCCAGTTCGGCGACCCCGGAGACATCATGAGCCCTAGAGACAAGGGCTTCCTGTGCCCTGAGTTCCCCGGCAGCTTCCGTAAGAAGTGCAACTTCGCTACCACCCCCATCTGCGAGTACGACGGTAACATGGTCAGCGGCTACAAGAAGGTGATGGCCACCATCGACTCCTTCCAGTCTTTCAACACCTCCACCATGCACTTCACCGACGAGAGAATCGAATGGAAGGACCCCGACGGCATGCTGCGTGACCACATCAACATCCTGGTGACCAAGGACATCGACTTCGACAACCTGGGTGAAAACCCTTGCAAGATCGGCCTGCAGACCTCCTCTATCGAGGGAGCTTGGGGCAGCGGTGTGGGCTTCACCCTGACCTGCCTGGTGTCCCTGACCGAATGCCCCACCTTCCTGACCTCTATCAAGGCTTGCGACAAGGCCATCTGCTACGGTGCTGAGAGCGTGACCCTGACCCGCGGCCAGAACACCGTGAAGGTGTCCGGAAAGGGAGGTCACTCCGGTTCTACCTTCAGGTGCTGCCACGGAGAAGACTGCAGCCAGATCGGTCTGCACGCTGCTGCTCCACACCTGGACAAGGTGAACGGTATCTCCGAGATCGAAAACTCTAAGGTGTACGACGACGGAGCCCCCCAGTGCGGTATCAAGTGCTGGTTCGTGAAGTCCGGCGAGTGGATCTCCGGTATCTTCTCTGGCAACTGGATCGTGCTGATCGTGCTGTGCGTGTTCCTGCTGTTCAGCCTGGTGCTGCTGTCCATCC SEQ ID NO.13: WT-F:5’-TCATTTTGGCAAAGAATTCGCCACCATGGGCATCTGGAA-3’。

[0061] SEQ ID NO.14: WT-R: 5'-GGTTCCTGGGAGAGCCTCGAGCCTCACAGGGCACAGGAT-3'.

[0062] Then, the WT and C3 fragments were amplified by PCR using WT-F and WT-R primers, respectively. The specific PCR reaction system and reaction conditions were the same as those for the construction of the pCAGGS-EABR plasmid.

[0063] PCR products were verified by 1% agarose gel electrophoresis (e.g.) Figure 3 (As shown), cut the rubber and recycle the target strips WT and C3; the recycled target strips are then compared with those obtained through... EcoR I and Xho The pCAGGS-EABR vector was ligated after double digestion with enzyme I to construct pCAGGS-WT-EABR and pCAGGS-C3-EABR recombinant plasmids. The ligation reaction and subsequent transformation experiments were as described above.

[0064] The above plasmid PCR identification results are as follows: Figure 4 As shown, bands of the expected size can be observed, indicating that the plasmid was successfully constructed. Sequencing at Sangon Biotech Co., Ltd. further confirmed the successful construction of the plasmid, which is now stored for future use.

[0065] 2.2 Construction of plasmids based on pVAX1 vector The WT and C3 fragments were amplified by PCR, using the same PCR reaction system and conditions as the pCAGGS-EABR plasmid construction process. After PCR products were subjected to 1% agarose gel electrophoresis, the gel was excised and the target bands WT and C3 were recovered. The recovered target bands were compared with those obtained by... EcoR I and Kpn The pVAX1 vector, after double digestion with enzyme I, was ligated to construct the pVAX1-WT and pVAX1-C3 recombinant plasmids. The ligation reaction and subsequent transformation experiments were performed in the same manner as the pCAGGS-EABR plasmid. The transformed recombinant plasmids were sent to Sangon Biotech Co., Ltd. for sequencing and stored for later use.

[0066] In this experiment, the EABR fragment was subcloned into the pVAX1-WT and pVAX1-C3 plasmids. Relevant upstream and downstream primers were designed, including the EABR-infu pVAX1-F primer with gene sequence as shown in SEQ ID NO.15 and the EABR-infu pVAX1-R primer with gene sequence as shown in SEQ ID NO.16. The EABR fragment was amplified by PCR. The specific PCR reaction system and reaction conditions were the same as those for the construction of the pCAGGS-EABR plasmid.

[0067] SEQ ID NO.15: 5'-TCCTGTGCCCTGTGAGGGCTCTCCCAGGAAACCCTGATCA-3' SEQ ID NO.16: 5'-AGGCTCTGAGCAGAAGCTGATCTCAGAGGAGGACCTGGCTCTCCCAGGAA-3' PCR products were subjected to 1% agarose gel electrophoresis ( Figure 5 ), and then cut and recycle the rubber. The recycled target strips are then compared with those obtained through... Kpn The pVAX1-WT and pVAX1-C3 vectors, after being digested by enzyme I, were ligated to construct plasmids pVAX1-WT-EABR and pVAX1-C3-EABR. The ligation reaction and subsequent transformation experiments have been described previously.

[0068] The successfully constructed plasmid was then identified by PCR using the WT-F primers shown in SEQ ID NO. 13 and the WT-R primers shown in SEQ ID NO. 14 for the gene sequence. Figure 6 As shown, bands of the expected size can be observed, indicating that the plasmid was successfully constructed. Sequencing at Sangon Biotech Co., Ltd. further confirmed the successful construction of the plasmid, which is now stored for future use.

[0069] 2.3 Construction of plasmids based on PFBN vector and preparation of mRNA-LNP In this experiment, the WT, C3, WT-EABR, and C3-EABR fragments were subcloned into the PFBN vector, respectively. The specific PCR reaction system and conditions were the same as those used in the construction of the pCAGGS-EABR plasmid. After PCR products were subjected to 1% agarose gel electrophoresis, the gel was excised and the target band was recovered. The recovered target band was compared with... EcoR I and Xho The PFBN vector, after double digestion with enzyme I, was ligated to construct recombinant plasmids PFBN-WT, PFBN-C3, PFBN-WT-EABR, and PFBN-C3-EABR. The ligation reaction and subsequent transformation experiments were performed according to the same procedure as for the pCAGGS-EABR plasmid. The transformed recombinant plasmids were sent to Sangon Biotech Co., Ltd. for sequencing and storage for later use. They were then further sent to GenScript Biotech Co., Ltd. for preparation and packaging as mRNA-LNP, and stored at -80℃ for later use.

[0070] 3. Western blotting to identify HTNV VLP-enhanced secretion plasmid HEK293T cells were seeded in four T25 cell culture flasks and cultured overnight until the cell density reached approximately 70%. The cells were then slowly washed once with PBS and replaced with serum-free DMEM medium. Recombinant plasmids pCAGGS-WT, pCAGGS-WT-EABR, pCAGGS-C3, and pCAGGS-C3-EABR were transfected, respectively. After 48 h of culture, cells and cell culture supernatant were harvested. The collected culture supernatant was centrifuged sequentially as follows: 300×g for 5 min to remove suspended cells; 1000×g for 10 min to remove dead cells and large debris; and 10000×g for 30 min to remove microsomes and subcellular structures. The supernatant was transferred to a 50 kDa ultrafiltration tube and centrifuged at 5000×g at 4°C to a volume of approximately 500 μL to obtain a concentrated supernatant sample. Pre-chilled RIPA lysis buffer (containing 1% PMSF + 1× protease inhibitor cocktail) was prepared on ice. Discard any remaining culture medium from the culture flask, wash the cells once with PBS, add 600 μL of pre-chilled lysis buffer, incubate on ice for 5 min, scrape off cells with a cell scraper, transfer to a 1.5 mL EP tube, and lyse on ice for 30 min. Then centrifuge at 12000×g for 15 min, collect the supernatant and transfer it to a new EP tube, discarding the pellet (containing the cytoskeleton and unlysed cells).

[0071] After quantifying the protein samples using the BCA kit, the protein concentration was calculated based on the standard curve. To prepare non-denatured protein samples, the protein samples were mixed with protein loading buffer (4×) at a 3:1 ratio. After gentle pipetting and mixing, a brief centrifugation was performed, and the samples were directly loaded into the wells of a Native-PAGE gel. For reduced protein samples, the samples were mixed with protein loading buffer (4×, containing β-mercaptoethanol) at a 3:1 ratio, heated in a metal bath at 95°C for 5–10 min, cooled to room temperature, and then loaded into the wells of an SDS-PAGE gel for electrophoresis and transfer to a PVDF membrane. After transfer, the PVDF membrane was washed with TBST (containing 0.1% Tween-20) for 2 min. 5% skim milk powder (prepared with TBST) was added, and the membrane was blocked on a shaker at room temperature for 1 h. After blocking, the primary antibody G2-10 was diluted 1:1000, incubated overnight, and then washed three times with TBST for 10 min each time. The membrane was then incubated with the fluorescent secondary antibody at room temperature in the dark for 1 h (1:15000 dilution), and finally washed with TBST in the dark (3 times, 10 min each time) before scanning imaging was performed using Odyssey.

[0072] Experimental results are as follows Figures 7-9 As shown, GP was expressed in the supernatant of both the WT and WT-EABR groups. The GP expression level in the supernatant of the WT-EABR group was significantly higher than that in the WT group. Furthermore, due to the coupling of the EABR fragment, the molecular weight of Gc increased from 50 kDa to 70 kDa.

[0073] Identification of supernatants at different concentration folds revealed that, under both reducing and non-reducing conditions, the GP expression level in the supernatant of the pCAGGS-WT-EABR group was significantly higher than that of the pCAGGS-WT group. The experimental results are as follows: Figures 10-12 As shown, the supernatant of the pCAGGS-C3-EABR group expressed GP, while the supernatant of the pCAGGS-C3 group showed almost no expression. Furthermore, due to the coupling with the EABR fragment, the molecular weight of Gc increased from 50 kDa to 70 kDa. Identification of supernatants at different concentration folds revealed that, under both reducing and non-reducing conditions, the GP expression level in the supernatant of the pCAGGS-C3-EABR group was higher than that in the pCAGGS-C3 group. These experimental results indicate that WT, C3, and EABR are well-integrated, and the secretion of WT and C3 is significantly enhanced after EABR coupling.

[0074] 4. Immunological experiment 4.1 Grouping and Immunization Strategies of Experimental Animals 4.1.1 Grouping and Immunization Strategies for Experimental Animals Based on DNA Vaccines The pVAX1 empty vector, pVAX1-WT, pVAX1-WT-EABR, pVAX1-C3, and pVAX1-C3-EABR plasmids were all administered to BALB / c mice via bilateral intramuscular injection at a dose of 50 μg / mouse in the hind thigh groin.

[0075] The immunization procedure consisted of three doses administered four weeks apart. Two weeks after the last immunization, mice were anesthetized and euthanized to collect blood and dissect the spleens. Humoral and cellular immune response indicators were then measured.

[0076] 4.1.2 Grouping and Immunization Strategies for mRNA-Based Vaccines in Experimental Animals The mRNA-LNP empty vector control, WT-LNP, WT-EABR-LNP, C3-LNP, and C3-EABR-LNP plasmids were administered to BALB / c mice via bilateral intramuscular injection at a dose of 10 μg / mouse. Each plasmid treatment group was labeled as: PFBN-WT (WT-LNP), PFBN-C3 (C3-LNP), PFBN-WT-EABR (WT-EABR-LNP), and PFBN-C3-EABR (C3-EABR-LNP). The immunization protocol consisted of two injections, three weeks apart. Two weeks after the last immunization, mice were anesthetized and sacrificed, and blood and spleens were dissected for the detection of humoral and cellular immune response indicators.

[0077] 4.2 Detection of humoral immune response indicators in experimental animals 4.2.1. Collect mouse serum The mouse is quickly immobilized using the left hand by grasping its back and lifting its neck. The right hand holds a capillary glass tube (0.5–1.0 mm inner diameter) and slowly inserts it into the posterior orbital venous plexus along the inner side of the mouse's eye, rotating and advancing it. Blood will flow naturally along the inner wall of the capillary glass tube. Immediately place the blood collection tube below the outlet to collect blood, with a collection volume of 200–400 μL per mouse. During blood collection, the head must be kept immobilized to prevent the capillary glass tube from being inserted too deeply. After blood collection, the capillary glass tube is quickly removed, and a sterile cotton ball is applied to the collection site for 10 seconds, while observing for any continuous bleeding. After the collected whole blood has stood at room temperature for 1 hour, serum will naturally separate out. Centrifuge the serum at 3500 × g for 10 minutes at 4°C, aspirate the supernatant serum (avoiding aspiration of red blood cells), transfer it to a new EP tube, aliquot and label, and store at -80°C.

[0078] (1) Detection of HTNV neutralizing antibodies in mouse serum 1) Cell preparation: Vero E6 cells were prepared at a rate of 1×10⁶ cells / year. 4 Cells were seeded at a density of 1 / well in 96-well cell culture plates and cultured in DMEM medium containing 10% FBS at 37°C and 5% CO2 until monolayer confluence. 2) Serum treatment and virus neutralization: Serum from immunized mice was serially diluted 2-fold (starting at 1:20) with dual-free DMEM and a positive virus control was set up: 100 FFU HTNV76-118 + DMEM. The diluted serum was mixed with an equal volume of virus solution containing 100 FFU (final volume 100 μL) and incubated at 37°C for 1 h for neutralization.

[0079] 3) Cell infection: Add 100 μL of the neutralization mixture to each well of Vero E6 cells that have formed a monolayer, infect at 37°C for 2 h, and set up two parallel replicates simultaneously; 4) Cover culture: Discard the neutralization mixture, add 50 μL of 1.2% methylcellulose covering solution (DMEM containing 2% FBS) to each well, and incubate at 37℃ in a 5% CO2 incubator for 7 days; 5) Cell fixation: After culturing for 7 days, discard the covering medium, wash 3 times with PBS (100 μL / time), add 100 μL of 4% paraformaldehyde to each well, and fix at room temperature for 15 min; 6) Cell permeabilization: Discard the fixative, add 100 μL of 0.5% Triton X-100 to each well, permeabilize at room temperature for 10 min, and wash 3 times with PBS; 7) Primary antibody incubation: Dilute the mouse-derived 1A8 monoclonal antibody (1:1000) with 3% BSA-PBS, add 100 μL / well, and incubate overnight at 4°C; 8) Secondary antibody incubation: The primary antibody was recovered, washed three times with PBS, and HRP-labeled goat anti-mouse IgG (1:5000 dilution) was added and incubated at room temperature for 2 h; 9) Color development and counting: After washing with PBST 3 times, add 100 μL of pre-warmed precipitant TMB color development solution to each well, develop color at room temperature in the dark for 15 min, add an equal volume of ddH2O to terminate the reaction, and count the blue focal formation units (FFU) in each well after drying. 10) Titer calculation: Calculate the blood sample dilution required to reduce the number of infected cell spots by 50% compared with the virus-positive control group spots, i.e., FRNT, and use this to calculate the HTNV neutralizing antibody titer.

[0080] The titers of neutralizing antibodies in the serum of mice in each group were detected by the HTNV neutralization assay, and the results are as follows: Figure 13 , 14 As shown. Under DNA vaccine immunization conditions, the serum neutralizing antibody titers of the pVAX1-WT-EABR group and the pVAX1-C3-EABR group were significantly higher than those of the pVAX1-WT group, the pVAX1-C3 group, and the pVAX1 empty vector group, with the pVAX1-C3-EABR group having the highest serum neutralizing antibody titer.

[0081] Under mRNA vaccine immunization conditions, the serum neutralizing antibody titers of the WT-EABR-LNP group and the C3-EABR-LNP group were significantly higher than those of the WT-LNP group, the C3-LNP group and the mRNA-LNP empty vector control group, with the C3-EABR-LNP group having the highest serum neutralizing antibody titer.

[0082] The above results indicate that WT and C3 nucleic acid vaccines conjugated with EABR can induce high levels of neutralizing antibodies, with the mRNA vaccine showing better efficacy.

[0083] 4.3 Detection of cellular immune response indicators in experimental animals 4.3.1 Preparation of mouse spleen single-cell suspension 1) After collecting blood using the enucleation method, the mice were euthanized by cervical dislocation. The mouse carcasses were completely immersed in 75% ethanol solution for 3 minutes for disinfection, and then transferred to a clean bench and fixed to a dissecting board (supine position, with the limbs pinned).

[0084] 2) Using aseptic technique, open the abdominal cavity, remove the spleen, and place it in a 10 cm sterile culture dish. Rinse with PBS buffer (pH 7.4) containing 2% FBS to remove surface blood clots and connective tissue membranes. Hold one end of the spleen with forceps and place it on a 70 μm cell sieve. Gently grind the spleen with a 10 mL syringe plunger, simultaneously adding pre-cooled RPMI-1640 basal medium (containing 2% FBS) to keep the tissue moist. Continue grinding until the spleen structure is completely dissolved. Collect the cell suspension (approximately 8-10 mL) under the sieve into a 15 mL centrifuge tube.

[0085] 3) After centrifuging at 800×g for 10 min at 4℃, discard the supernatant, add 3~4 mL of erythrocyte lysis buffer, and incubate on ice for 15 min (during which time gently invert and mix once every 5 min). 4) Add 2 mL of pre-cooled PBS to terminate the lysis reaction, centrifuge at 800×g for 10 min, discard the supernatant, resuspend the cells in 5 mL of RPMI-1640 complete medium (containing 10% FBS) and count them; 5) Adjust the concentration to 4×10 6 Cells / mL, seeded at 1 mL / well in a 24-well culture plate, and incubated at 37°C in a 5% CO2 incubator for later use.

[0086] 4.3.2 ELISApot detection of cytokine levels secreted by mouse spleen cells 1) Plate pretreatment: Rinse the ELISpot plate 3 times with sterile PBS, 200 μL / well each time, add 1640 medium containing 10% FBS for blocking (200 μL / well), let stand at room temperature for 2 h for blocking, then discard the blocking solution and dry the plate (tap it gently on absorbent paper). 2) Cell seeding and stimulation: One negative control well and one positive control well were set up for each mouse spleen cell, and two experimental wells were set up. Cell suspension (100 μL / well) was added according to the group, and HTNV GP stimulant was added simultaneously. Then, the cells were incubated in a 37℃, 5% CO2 incubator for 24~48 h (avoid moving the cells).

[0087] 3) Primary antibody incubation: Discard cell supernatant, wash 3 times with PBST (containing 0.05% Tween-20), 200 μL / well each time, add biotin-labeled IFN-γ / IL-2 / IL-4 / IL-10 primary antibody (1:1000, prepared with antibody dilution buffer) (100 μL / well), and incubate at room temperature for 1 h; 4) Secondary antibody incubation: Discard the primary antibody, wash 3 times with PBST, add HRP-labeled secondary antibody (100 μL / well), and incubate at room temperature for 2 h; 5) Color development and termination: Discard the secondary antibody, wash twice with PBST, then wash once with PBS. Add TMB substrate color development solution (100 μL / well) and incubate at room temperature in the dark for 15-30 min. When the spots are clearly visible, stop the color development with deionized water.

[0088] 6) Data Analysis: Invert the plate onto absorbent paper to dry, then scan it using the ELISpot automated analysis system and record the number of spot-forming cells (SFC) in each well, expressed as SFC / 10. 6 cells.

[0089] Experimental results are as follows Figures 15-22 As shown. Under DNA vaccine immunization conditions: After stimulation with HTNV GP, the induced secretion levels of specific IFN-γ, IL-2, IL-4 and IL-10 in mouse spleen cells of the pVAX1-WT-EABR group and the pVAX1-C3-EABR group were significantly higher than those in the pVAX1-WT group and the pVAX1-C3 group.

[0090] Under mRNA vaccine immunization conditions, mouse spleen cells stimulated with HTNV GP showed significantly higher levels of specific IFN-γ, IL-2, IL-4, and IL-10 secretion compared to the WT-LNP and C3-LNP groups.

[0091] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A HTNV VLP secretory booster nucleic acid vaccine, characterized in that, The immunogen of this vaccine is the DNA of the Hantan virus envelope glycoprotein HTNV GP, which is selected from wild type or cysteine ​​mutant, and the EABR fragment is inserted at the end of the DNA. The nucleotide sequence of the EABR fragment is shown in SEQ ID NO.

1. The cysteine ​​mutant is obtained by mutating the S291, T731 and G835 sites of the wild type HTNV GP. The gene sequence of the wild type is shown in SEQ ID NO.

12.

2. The HTNV VLP secretion-enhanced nucleic acid vaccine according to claim 1, characterized in that, The EABR fragment was inserted into the C-terminus of both the wild-type and cysteine-mutant HTNV GP.

3. The HTNV VLP secretion-enhanced nucleic acid vaccine according to claim 1, characterized in that, The vector for the nucleic acid vaccine is pVAX1.

4. A method for preparing the HTNV VLP secretory-enhanced nucleic acid vaccine according to claim 1, characterized in that, Includes the following steps: The EABR fragment was ligated with the double-digested pCAGGS vector to construct the recombinant plasmid pCAGGS-EABR. The wild-type and cysteine ​​mutant fragments of HTNV GP were amplified separately, and the amplified fragments were ligated into the double-digested pCAGGS-EABR vector to obtain pCAGGS-WT-EABR and pCAGGS-C3-EABR recombinant plasmids; The pCAGGS-WT-EABR and pCAGGS-C3-EABR are subcloned into the linearized DNA vaccine vector pVAX1 to obtain the pVAX1-WT-EABR and pVAX1-C3-EABR recombinant plasmids, which are the nucleic acid vaccines.

5. The preparation method according to claim 4, characterized in that, pCAGGS carrier uses Xho I and Bgl II was double-digested, and the pCAGGS-EABR vector was used. EcoR I and Xho The pVAX1 vector was subjected to double enzyme digestion (I). Kpn I undergoes single enzyme digestion.

6. The preparation method according to claim 4, characterized in that, The EABR fragment was obtained by PCR splicing, and the gene sequences of the primers used are shown in SEQ ID NO.2~11.

7. The preparation method according to claim 4, characterized in that, When amplifying the wild-type and cysteine ​​mutant fragments of HTNV GP, the gene sequence of the upstream primer is shown in SEQ ID NO.13 and the gene sequence of the downstream primer is shown in SEQ ID NO.

14.

8. The use of the HTNV VLP secretory enhanced nucleic acid vaccine according to any one of claims 1 to 3 in the preparation of a drug for preventing Hantan virus infection.

9. The application according to claim 8, characterized in that, The nucleic acid vaccine includes DNA vaccine formulations or mRNA vaccine formulations.

10. A drug for preventing Hantan virus infection, characterized in that, It includes the HTNVVLP secretory booster nucleic acid vaccine as described in any one of claims 1 to 3, and a pharmaceutically acceptable carrier, adjuvant, or diluent.

Images