A drug combination targeting OTUD4 and combining it with an anti-PD-L1 antibody for the treatment of colorectal cancer and its application.

CN122557723APending Publication Date: 2026-08-14CANCER HOSPITAL AFFILIATED TO GUANGXI MEDICAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-29
Publication Date
2026-08-14

AI Technical Summary

Technical Problem

因此,基于OTUD4抑制铁死亡的技术方案,无法为“OTUD4抑制剂联合抗PD-L1抗体用于抗肿瘤免疫治疗”这一全新策略提供任何技术启示

Benefits of technology

[0026]1.增强抗肿瘤免疫反应,提高结直肠癌治疗效果。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122557723A_ABST
    Figure CN122557723A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biomedicine and relates to a drug combination for the combined treatment of colorectal cancer by targeting and inhibiting OTUD4 and an anti-PD-L1 antibody, and its application. The drug combination comprises a reagent targeting and inhibiting OTUD4 and an anti-PD-L1 antibody or its antigen-binding fragment. This invention is the first to discover that OTUD4 positively regulates the expression of PD-L1 in colorectal cancer cells; knocking out OTUD4 significantly reduces PD-L1 expression and enhances the anti-tumor immunomodulatory effect of PD-L1 antibodies; the combined application of the two has a synergistic tumor-suppressive effect. This invention also provides a drug screening method targeting OTUD4 and the application of OTUD4 as a biomarker in predicting the responsiveness to combined therapy. The technical solution of this invention provides a new treatment strategy and precision medicine tool for colorectal cancer, especially MSS-type colorectal cancer that is insensitive to existing immunotherapies, and has significant clinical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a drug combination for the treatment of colorectal cancer that targets and inhibits OTUD4 and combines it with an anti-PD-L1 antibody. Background Technology

[0002] Colorectal cancer is one of the most common and serious malignant tumors worldwide, and has become one of the leading causes of cancer-related deaths (Front Oncol. 2022, 12: 911856). Traditional treatments such as surgery, radiotherapy, and chemotherapy can control tumor growth and spread to some extent, but their efficacy is limited for patients with advanced or metastatic colorectal cancer, and they are often accompanied by serious side effects. With the development of modern medicine, immunotherapy has gradually become a hot topic in tumor treatment and a new direction in the treatment of colorectal cancer, improving the prognosis of some colorectal cancer patients to some extent. However, existing immunotherapy methods for colorectal cancer only show good immune response rates for some subtypes, and the immune response rate for MSS type colorectal cancer patients, which accounts for about 85% of all patients, remains low. How to reverse its "cold tumor" characteristics and activate the body's own anti-tumor immunity remains a bottleneck that urgently needs to be overcome.

[0003] PD-L1 is an immune checkpoint protein mainly expressed on the surface of tumor cells and some immune cells. It interacts with the PD-1 receptor on the surface of T cells, forming the PD-L1 / PD-1 signaling pathway (Front Immunol. 2019, 10:2022.). Under normal physiological conditions, this signaling pathway plays a role in regulating the immune response and preventing the immune system from being overactivated and causing damage to the body. When T cells recognize an antigen, PD-1 binds to PD-L1 to transmit an inhibitory signal, which inhibits the activity of T cells and thus maintains immune homeostasis. In colorectal cancer, tumor cells often evade the body's immune attack by upregulating the expression of PD-L1. Tumor cells use PD-L1 to bind to PD-1 on T cells, inhibiting the activation and proliferation of T cells and reducing their ability to kill tumor cells, thereby achieving immune escape (J Clin Pathol. 2018, 71(3):189-94.). Studies have found that a certain proportion of colorectal cancer patients have high levels of PD-L1 expression in their tumor tissue, which is associated with poor prognosis.

[0004] The deubiquitinating enzyme OTUD4 (OTU domain-containing protein 4) has been reported to play a regulatory role in various tumors in recent years, but its function exhibits significant tumor heterogeneity. For example, Xiaohui Zhao et al. found that OTUD4 may be a potential molecular target for the diagnosis and treatment of breast cancer, liver cancer, and lung cancer. Overexpression of OTUD4 inhibited the proliferation, migration, and invasion of human breast cancer, liver cancer, and lung cancer cells by promoting cancer cell apoptosis and inhibiting the AKT signaling pathway (OTUD4: A Potential Prognosis Biomarker for Multiple Human Cancers. CancerManagement and Research, 2020, 12:1503-1512.). Xiuqing Ma et al. found that the absence of OTUD4 in triple-negative breast cancer (TNBC) cells significantly inhibited cell clonogenic ability, migration, invasion, and cancer stem cell populations in vitro, and also significantly inhibited metastasis in vivo (Deubiquitinating enzyme OTUD4 regulates metastasis in triple-negative breast cancer by stabilizing Snail1. Experimental Cell Research, 2024, 434(1): 113864.). In nasopharyngeal carcinoma, OTUD4-mediated GSDME deubiquitination enhances the radiosensitivity of nasopharyngeal carcinoma (J Exp Clin Cancer Res 2022 Nov 21;41(1):328.). In the field of colorectal cancer, existing technologies (such as patent CN119770659A) disclose the function of OTUD4 as a ferroptosis inhibitory molecule, which inhibits intracellular ferroptosis in tumor cells by stabilizing GPX4 and inhibiting autophagic degradation. This patent further proposes a treatment strategy that targets and inhibits OTUD4 in combination with ferroptosis inducers (such as Erastin) or the small-molecule targeted drug regorafenib. Its mechanism of action is to directly kill tumor cells by enhancing their own oxidative stress levels. This approach essentially falls under the category of tumor cell biology, and its core logic is "enhancing the direct killing of tumor cells themselves," without addressing the interaction between tumor cells and the host immune system.

[0005] Currently, there are no reported studies on the effect of OTUD4 on PD-L1 deubiquitination in colorectal cancer patients. This effect may inhibit T cell activation and proliferation, reducing the T cell's ability to kill tumor cells, thereby enabling tumor cells to escape immunely. Specifically, whether OTUD4 participates in tumor immune escape by regulating PD-L1 expression, and whether targeted inhibition of OTUD4 can produce a synergistic anti-tumor effect with anti-PD-L1 antibodies, have not been reported globally.

[0006] From the perspective of technical implications of existing technology (CN119770659A), inhibiting OTUD4 can enhance the sensitivity of tumor cells to ferroptosis inducers or regorafenib, with the endpoint being intracellular oxidative stress death. This technical approach does not involve, nor does it imply, the regulatory role of OTUD4 on any immune checkpoint molecules on the tumor cell surface, nor does it mention the combined use with immunotherapeutic drugs (such as anti-PD-L1 antibodies). The ferroptosis pathway and the PD-L1 / PD-1 immune checkpoint pathway belong to completely different biological dimensions in terms of molecular mechanisms, signal transduction networks, drug targets, and treatment outcomes: the former belongs to the category of cell metabolism and programmed cell death, while the latter belongs to the category of tumor immune microenvironment and immune recognition. There is no necessary correlation between the two dimensions, nor can one infer the other from the other. Therefore, the technical approach based on OTUD4-based ferroptosis inhibition cannot provide any technical implications for the novel strategy of "OTUD4 inhibitors combined with anti-PD-L1 antibodies for anti-tumor immunotherapy."

[0007] In summary, current technologies lack an understanding of OTUD4's regulation of PD-L1-mediated tumor immune escape, and even more so, lack any protocols for combining OTUD4 inhibitors with anti-PD-L1 antibodies in the treatment of colorectal cancer. Further exploration of this related mechanism of action holds promise for opening up entirely new avenues and directions for cancer treatment. Summary of the Invention

[0008] This invention aims to address the following technical problem: providing a drug combination for the targeted inhibition of OTUD4 and the combined treatment of colorectal cancer with an anti-PD-L1 antibody, and its application. Completely different from existing strategies that promote tumor cell ferroptosis by inhibiting OTUD4 (such as in combination with ferroptosis inducers or regorafenib), this invention reveals and verifies for the first time that the deubiquitinating enzyme OTUD4 has a novel function of positively regulating PD-L1 expression in colorectal cancer cells, and elucidates the molecular mechanism by which it promotes tumor immune escape by upregulating PD-L1 expression, thereby affecting the progression of colorectal cancer. Based on this, this invention establishes a synergistic anti-tumor strategy of targeted inhibition of OTUD4 combined with PD-L1 antibody therapy, and confirms its synergistic effect through in vitro and in vivo experiments. Furthermore, this invention also discovers that OTUD4 is highly expressed in colorectal cancer tissues and is significantly associated with poor patient prognosis, thereby developing the application of biomarkers based on OTUD4 expression levels and a drug screening method targeting OTUD4. This provides a new drug combination and precision medicine tool for the treatment of colorectal cancer, especially MSS-type colorectal cancer.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0010] The application of OTUD4 as a target in the preparation of a drug combination for the treatment of colorectal cancer, the drug combination comprising an agent that targets and inhibits OTUD4 and an anti-PD-L1 antibody or its antigen-binding fragment; the agent that targets and inhibits OTUD4 is used to reduce the expression level of PD-L1 in colorectal cancer cells, thereby enhancing the anti-tumor immune effect of the anti-PD-L1 antibody.

[0011] Furthermore, by knocking out or inhibiting the expression or activity of OTUD4, the expression level of PD-L1 in colorectal cancer cells can be reduced, and the anti-tumor immune effect of anti-PD-L1 antibodies can be enhanced.

[0012] The present invention also provides a pharmaceutical combination for treating colorectal cancer, the pharmaceutical combination comprising an agent that targets and inhibits OTUD4 and an anti-PD-L1 antibody or an antigen-binding fragment thereof.

[0013] Preferably, the reagent for targeting and inhibiting OTUD4 is an OTUD4 knockout plasmid constructed using the CRISPR / Cas9 system. More preferably, the OTUD4 knockout plasmid contains an sgRNA sequence specifically targeting the human OTUD4 gene, the sgRNA sequence being as shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; wherein,

[0014] sgRNA1: 5'-CACCGCAGTAAGCCGGACGAAGGC - 3';

[0015] sgRNA2: 5'-CACCGATTCAGAACAGAGATGAAC - 3'.

[0016] The agent targeting OTUD4 and the anti-PD-L1 antibody or its antigen-binding fragment can be administered simultaneously, sequentially, or separately at different times via the same or different routes of administration, including oral, intravenous, subcutaneous, intramuscular, intraperitoneal, or local administration, depending on the patient's specific circumstances, to improve treatment efficacy and patient tolerability. This treatment is suitable for human colorectal cancer patients, and may offer significant therapeutic advantages, especially for those who have not responded well to conventional treatments or are resistant to immunotherapy.

[0017] The present invention also provides the use of the above-described pharmaceutical combination in the preparation of a medicament for treating colorectal cancer.

[0018] The present invention also provides a pharmaceutical preparation comprising the above-mentioned drug combination and a pharmaceutically acceptable carrier, diluent or excipient, and formulated into various dosage forms, such as oral preparations (tablets, capsules, etc.), injectable preparations (solutions, suspensions, etc.), suppositories, aerosols or patches, etc., to meet the needs of different patients and treatment scenarios.

[0019] The present invention also provides a kit for the diagnosis or monitoring of treatment efficacy in colorectal cancer, comprising reagents for specifically detecting OTUD4 expression levels.

[0020] To further clarify, the detection reagent is an antibody or probe used for immunohistochemistry or ELISA detection.

[0021] The kit comprises reagents for detecting OTUD4 expression levels, such as antibodies or probes for immunohistochemistry or ELISA. Immunohistochemistry observes the expression level and localization of OTUD4 protein on tissue sections through antigen-antibody specific binding and colorimetric reaction; ELISA, based on antigen or antibody immobilization and enzyme labeling technology, determines the content of OTUD4 protein or nucleic acid in the sample through colorimetric reaction. The kit is intended for the diagnosis of colorectal cancer or monitoring of treatment efficacy. In diagnosis, it assists in determining whether a patient has colorectal cancer and assessing the severity of the disease; in treatment monitoring, it dynamically observes changes in OTUD4 expression levels, providing a basis for adjusting the treatment plan.

[0022] The present invention also provides a method for screening drugs for the treatment of colorectal cancer, comprising: using OTUD4 as a target, screening for compounds or biological agents that can inhibit the activity or expression of OTUD4, and using the screened inhibitors as candidate drugs for the treatment of colorectal cancer.

[0023] The present invention also provides the use of OTUD4 as a biomarker in the preparation of a kit for predicting the response of colorectal cancer patients to combination therapy comprising an agent that targets and inhibits OTUD4 and an anti-PD-L1 antibody.

[0024] Predicting treatment responsiveness involves detecting OTUD4 expression levels in patient tumor tissue or blood to predict the response to targeted inhibition of OTUD4 combined with PD-L1 therapy. Patients with high OTUD4 expression may be more sensitive to this treatment regimen, providing important reference for clinicians to develop personalized treatment plans and achieve precision medicine. Screening therapeutic drugs targets OTUD4, identifying compounds or biologics that can inhibit OTUD4 activity or expression. The identified effective inhibitors or activators serve as candidates for colorectal cancer treatment, providing direction for the development of novel therapeutics.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] 1. Enhances anti-tumor immune response and improves the treatment effect of colorectal cancer.

[0027] By targeting and inhibiting OTUD4, the expression level of PD-L1 protein was reduced, effectively weakening the immunosuppressive signal generated by tumor cells utilizing the binding of PD-L1 to PD-1 on T cells. This restored T cell activity and enhanced the immune system's ability to kill tumor cells. For example, in an OTUD4 gene knockout mouse model, CD8+ expression was significantly reduced in tumor tissue. + T cells, IFN-γ + CD8 + T cells and GZMB + CD8 + The significant increase in T cell count strongly demonstrates that this combination therapy can effectively activate the body's anti-tumor immune response. Combined with PD-L1 antibody therapy, it further blocks the PD-L1 / PD-1 signaling pathway, creating a synergistic effect and significantly enhancing the anti-tumor immune response. Compared to PD-L1 antibody therapy alone, it shows superior efficacy in inhibiting tumor growth.

[0028] Experimental data clearly demonstrate that, in both in vitro cell experiments and in vivo mouse model experiments, targeted inhibition of OTUD4 combined with PD-L1 therapy significantly inhibits the growth of colorectal cancer tumors. For example, the tumor size, volume, and weight in the OTUD4 gene knockout group were significantly reduced compared to the control group, and the tumor-suppressing effect was most significant when combined with αPD-L1 therapy, effectively curbing tumor progression. This inhibits the migration and invasion of tumor cells, reduces the risk of tumor cell metastasis to other tissues and organs, thereby improving patient prognosis, prolonging survival time, and bringing greater survival benefits to patients.

[0029] 2. Providing potential strategies for personalized medicine

[0030] By detecting the expression level of OTUD4 in a patient's tissues or blood, it is possible to preliminarily predict the patient's potential response to this combination therapy. Patients with high OTUD4 expression may be more sensitive to targeted inhibition of OTUD4 combined with PD-L1 therapy, thus providing important reference for clinicians to develop personalized treatment plans and achieve precision medicine. This helps physicians rationally select the most suitable treatment strategy for each patient based on their specific circumstances, such as tumor stage, gene mutation status, and OTUD4 expression level, avoiding unnecessary treatments and side effects, improving the effectiveness and safety of treatment, and enabling patients to receive more precise and effective treatment.

[0031] 3. Promote the development of colorectal cancer treatment.

[0032] This invention reveals the crucial role of OTUD4 in immune tolerance in colorectal cancer, providing a novel target and treatment approach for colorectal cancer. It breaks through the limitations of traditional treatment methods, laying a solid theoretical foundation for developing more effective therapeutic drugs and methods, and stimulating further research and exploration in tumor immunotherapy. It also provides a valuable reference and model for combination therapy research on other tumors, promoting the development of the field of tumor combination therapy and prompting researchers to further explore the synergistic mechanisms between different targets and drugs. This is expected to lead to the development of more highly effective combination therapy regimens for different tumor types, bringing more treatment options and hope to cancer patients.

[0033] 4. Potential diagnostic and prognostic value

[0034] OTUD4 can serve as a potential biomarker for the auxiliary diagnosis of colorectal cancer. Detecting OTUD4 expression levels, in conjunction with other clinical diagnostic indicators, can help improve the accuracy of early diagnosis of colorectal cancer, enabling patients to receive treatment earlier and increasing cure rates. OTUD4 expression levels are closely related to patient prognosis; high OTUD4 expression may indicate a poor prognosis. Therefore, monitoring changes in OTUD4 expression levels can provide physicians with important reference information for assessing disease progression and prognosis, helping them adjust treatment plans in a timely manner and improve patient treatment outcomes and quality of life.

[0035] 5. Fundamental differences from existing OTUD4-targeted therapy strategies. Existing technology, Chinese patent application CN119770659A, discloses a regimen of targeting and inhibiting OTUD4 in combination with ferroptosis inducers or regorafenib. Its mechanism of action involves directly killing tumor cells by enhancing intracellular lipid peroxidation and reactive oxygen species levels, falling within the scope of tumor cell biology. This invention, however, reveals for the first time the deubiquitination and stabilizing effect of OTUD4 on PD-L1. Targeted inhibition of OTUD4 can reduce PD-L1 expression and reverse the immunosuppressive microenvironment, thereby producing a synergistic immunotherapeutic effect with anti-PD-L1 antibodies. The two approaches differ fundamentally in their dimensions of action, types of combined drugs, and the clinical problems they address. The latter cannot be derived from the former, demonstrating the significant inventiveness of this invention. Attached Figure Description

[0036] Figure 1 To investigate the effect of OTUD4 knockout on PD-L1 protein expression levels in colorectal cancer cells. Specifically, AB: Western blot analysis of PD-L1 protein expression after OTUD4 knockout in LoVo and RKO cells; CD: Flow cytometry analysis of PD-L1 protein expression after OTUD4 knockout in LoVo and RKO cells.

[0037] Figure 2 To investigate the effect of OTUD4 overexpression on PD-L1 protein expression in colorectal cancer cells. AB: Western blot was used to detect PD-L1 protein expression after OTUD4 overexpression.

[0038] Figure 3 The effect of OTUD4 overexpression on the antitumor efficacy of PD-L1 antibody (in vivo). Where A: tumor size; B: tumor volume change curve; C: tumor weight.

[0039] Figure 4 To investigate the effect of OTUD4 overexpression on PD-L1 protein expression in tumors in vivo. The results are as follows: A: Western blot analysis of PD-L1 expression in tumor tissues of each group; B: Flow cytometry analysis of PD-L1 expression in tumor tissues of each group; C: Statistical analysis of PD-L1 expression levels in different groups using flow cytometry; D: H&E staining and IHC analysis of OTUD4 and PD-L1 in different groups (scale bar = 100 μm); E: Statistical analysis of OTUD4 scores in IHC analysis of different groups; F: Statistical analysis of PD-L1 scores in IHC analysis of different groups.

[0040] Figure 5The study aimed to investigate the effect of OTUD4 overexpression on reducing lymphocyte infiltration in tumor tissues in vivo. The analysis included: A: Flow cytometry analysis of CD8+ T cell expression in different groups; B: Statistical analysis of CD8+ T cell expression in different groups using flow cytometry; C: Flow cytometry analysis of GMZB expression in different groups; D: Statistical analysis of GMZB expression in different groups using flow cytometry; E: Flow cytometry analysis of IFNγ expression in different groups; F: Statistical analysis of IFNγ expression in different groups using flow cytometry.

[0041] Figure 6 The effect of OTUD4 gene knockout on the anti-tumor efficacy of PD-L1 antibody (in vivo). Where A: tumor size; B: tumor volume change curve; C: tumor weight.

[0042] Figure 7 The effect of OTUD4 knockout on PD-L1 expression in tumors in vivo was investigated. A: Western blot analysis of PD-L1 expression in tumor tissues of each group; B: Flow cytometry analysis of PD-L1 expression in tumor tissues of each group; C: Statistical analysis of PD-L1 expression levels in different groups using flow cytometry; D: H&E staining and IHC analysis of OTUD4 and PD-L1 in different groups (scale bar = 100 μm); E: Statistical analysis of OTUD4 scores in IHC analysis of different groups; F: Statistical analysis of PD-L1 scores in IHC analysis of different groups.

[0043] Figure 8 The effect of OTUD4 knockout on lymphocyte infiltration in tumor tissue was investigated. The analysis included: A: Flow cytometry analysis of CD8+ T cell expression in different groups; B: Statistical analysis of CD8+ T cell expression in different groups using flow cytometry; C: Flow cytometry analysis of GMZB expression in different groups; D: Statistical analysis of GMZB expression in different groups using flow cytometry; E: Flow cytometry analysis of IFNγ expression in different groups; and F: Statistical analysis of IFNγ expression in different groups using flow cytometry.

[0044] Figure 9 This section describes the expression of OTUD4 in colorectal cancer tissues and its relationship with patient prognosis. A: Immunohistochemical detection of OTUD4 expression; B: Kaplan-Meier survival curves for the OTUD4 high-expression group and the low-expression group. Please supplement with the following: What do the CDEF plot represent? A: Immunohistochemical detection of OTUD4 expression; B: Statistical analysis of OTUD4 expression detected by immunohistochemistry; C: Statistical analysis of OTUD4 expression detected by q-PCR; D: Western blot detection of OTUD4 expression; E: IHC analysis of high and low OTUD4 expression in colorectal cancer tissues; F: Kaplan-Meier survival curves for the OTUD4 high-expression group and the low-expression group.

[0045] Figure 10 This is a nomogram prediction model constructed based on factors such as OTUD4 expression.

[0046] Figure 11 The diagram shows the ROC and DCA curves for the prediction model. (A) The ROC curve shows the AUC values ​​for 1 year, 3 years, and 5 years; (B) The DCA curve shows the net return of the model at different thresholds. Detailed Implementation

[0047] All features disclosed in this specification, or steps in all methods or processes disclosed herein, may be combined in any way, except for mutually exclusive features and / or steps.

[0048] Unless otherwise stated, each feature disclosed in this specification (including any appended claims and abstract) is merely one example of a series of equivalent or similar features.

[0049] Example 1: Preparation and screening of OTUD4 knockout cells

[0050] This embodiment aims to construct a colorectal cancer cell model with OTUD4 gene knockout, providing experimental materials for subsequent studies on OTUD4 function and its effect on PD-L1 expression.

[0051] 1.1 Construction of OTUD4 knockout plasmid

[0052] To achieve stable knockout of the OTUD4 gene, a plasmid for OTUD4 gene knockout was designed and constructed. OTUD4 was knocked out in colorectal cancer cells using the CRISPR / Cas9 system to verify the knockout and evaluate its effect on anti-tumor cell immunity.

[0053] 1.1.1 Design specific sgRNA sequences targeting the human OTUD4 gene using online tools (such as the CRISPR Design Tool, Entrez Gene accession number: 54726). Select target sequences located in the OTUD4 exon region to ensure high specificity and low off-target effects. Design two different sgRNAs, targeting two different sites in the OTUD4 gene respectively, to ensure effective knockout. Designed sgRNA sequences:

[0054] sgRNA1: 5'- CACCGCAGTAAGCCGGACGAAGGC -3'

[0055] sgRNA2: 5'-CACCGATTCAGAACAGAGATGAAC-3'

[0056] 1.1.2 sgRNA insertion into plasmid vector

[0057] The CRISPR / Cas9 plasmid (e.g., PX330) is digested with BbsI to remove the original sgRNA occupant sequence. An oligonucleotide pair containing the designed sgRNA sequence is synthesized, annealed to produce a double strand, and ligated to a linearized PX330 vector to construct a CRISPR / Cas9 plasmid carrying the sgRNA.

[0058] 1.1.3 Plasmid amplification and identification

[0059] The constructed plasmid was transformed into competent E. coli, and positive clones were screened. Single clones were picked, cultured, and sequenced to verify whether the sgRNA was correctly inserted.

[0060] 1.2 Plasmid transfection and gene knockout

[0061] 1.2.1 Cell transfection

[0062] The constructed CRISPR / Cas9-sgRNA plasmid was transfected into LoVo and RKO cells (both purchased from the ATCC cell bank) using Lipofectamine 3000 transfection reagent. Forty-eight hours after transfection, positive clones were selected using medium containing puromycin. Forty-eight hours after selection, the remaining cells were diluted 1:100 and evenly seeded into 96-well cell culture plates.

[0063] 1.2.2 Gene Knockout Validation

[0064] Western blot analysis: Cells amplified from a single cell line were selected and Western blot was used to verify whether OTUD4 protein expression disappeared, thereby confirming the knockout effect of the OTUD4 gene.

[0065] Example 2: Effect of Targeted Inhibition of OTUD4 on PD-L1 Protein Expression

[0066] This embodiment aims to verify the effect of OTUD4 knockout on the expression of PD-L1 protein in colorectal cancer cells and to explore the regulatory relationship between OTUD4 and PD-L1.

[0067] 2.1 Experimental Methods

[0068] After confirming OTUD4 knockout, Western blot and flow cytometry were used to detect the effect of OTUD4 gene knockout on PD-L1 protein expression in tumor cells.

[0069] Western blot: Collect cells from the control group and OTUD4 knockout group, lyse and extract total protein, separate by SDS-PAGE electrophoresis, transfer to membrane, block and incubate with anti-PD-L1 antibody and anti-GAPDH antibody (internal control) respectively, and then perform ECL color development after incubation with secondary antibody.

[0070] The specific steps are as follows:

[0071] 1. Assemble the electrophoresis gel preparation device and prepare 10% separating gel and stacking gel;

[0072] 2. Load 10 μL of denatured protein sample into the well of the stacking gel, and add protein marker at the same time. First, electrophoresis is performed at a constant voltage of 60V until an orange-red band appears on the gel. Then, the voltage is adjusted to a constant voltage of 120V until the bromophenol blue is close to the bottom of the gel.

[0073] 3. Use the "sandwich" transfer method (filter paper-gel-PVDF membrane-filter paper) and wet transfer for 90 minutes under constant current of 350mA. Pre-cool the transfer solution to 4°C to avoid protein degradation.

[0074] 4.5% skim milk powder sealing solution, sealed on a shaker at room temperature for 2 hours.

[0075] 5. After blocking, wash the membrane three times with TBST for 5 minutes each time, cut the membrane and put it into the primary antibody overnight;

[0076] 6. The next day, wash the membrane three times with TBST for 5 minutes each time, then add the secondary antibody and incubate on a shaker at room temperature for 2 hours;

[0077] 7. After incubation with the secondary antibody, repeat the washing process three times as described above;

[0078] 8. Prepare ECL developer (solution A:solution B = 1:1), add it evenly to the film surface, and after complete coverage, place it in a chemiluminescence imaging system for exposure and development, acquire images and analyze the gray values ​​of the bands.

[0079] Flow cytometry: Collect cells, wash with PBS, add APC-labeled anti-PD-L1 antibody, incubate at 4°C in the dark for 30 minutes, wash again, and then perform flow cytometry.

[0080] The specific steps are as follows:

[0081] 1. After digesting and dissecting the tumor tissue with collagenase, the red blood cells were lysed and then cultured at 37°C for 8 hours in a medium containing a Cell-stimulating cocktail (1:500, eBioscience).

[0082] 2. For cell surface staining, cells were stained with Zombie, anti-CD45 and anti-CD8 antibodies (1:100, Biolegend).

[0083] 3. For intracellular staining, cells were treated with a fixation / permeation solution kit (Invitgen) and stained with anti-IFN-γ and anti-granzyme B antibodies (1:100 dilution, Biolegend).

[0084] 4. In addition, at the end of the cell experiments, the cells were digested with EDTA-free trypsin and stained with anti-PD-L1 antibody (1:100 dilution, Biolegend).

[0085] 5. Data was acquired on CytoFLEX (Beckman Coulter, USA) and analyzed using FlowJo software (TreeStar Inc., USA).

[0086] 2.2 Experimental Results: In human colorectal cancer cells (LoVo and RKO cells), knocking out the OTUD4 gene resulted in a significant decrease in PD-L1 protein expression levels, as shown by Western blot analysis. Figure 1 AB); flow cytometry results further confirmed this finding ( Figure 1 CD).

[0087] 2.3 Experimental Conclusions

[0088] This embodiment demonstrates that OTUD4 knockout can significantly reduce the protein expression level of PD-L1 in colorectal cancer cells, indicating that OTUD4 positively regulates the expression of PD-L1, providing a molecular basis for subsequent combination therapy strategies.

[0089] Example 3: Effect of OTUD4 overexpression on PD-L1 protein expression

[0090] This embodiment aims to further confirm the positive regulatory effect of OTUD4 on PD-L1 through reverse verification.

[0091] 3.1 Experimental Methods

[0092] The OTUD4 gene was overexpressed in human colorectal cancer cells using lentivirus; and OTUD4 was overexpressed in HEK293T cells (purchased from the ATCC cell bank) by transfection with the OTUD4 plasmid. PD-L1 protein expression levels were detected by Western blot.

[0093] 3.2 Experimental Results

[0094] Western blot results showed that PD-L1 protein expression level was significantly increased after overexpression of OTUD4. Figure 2 AB).

[0095] 3.3 Experimental Conclusions

[0096] This example confirms that OTUD4 overexpression promotes PD-L1 protein expression, which corroborates the results of Example 2 and further confirms the positive regulatory effect of OTUD4 on PD-L1.

[0097] Example 4: Effect of OTUD4 overexpression on the anti-tumor immune response of PD-L1

[0098] This embodiment aims to investigate the effect of OTUD4 overexpression on the anti-tumor effect of PD-L1 antibody through in vivo experiments, and to verify the role of OTUD4 in tumor immune escape.

[0099] 4.1 Experimental Methods

[0100] 4.1.1 Cell lines and animals

[0101] Balb / C mouse colorectal cancer cells CT26, Balb / C mice (6-8 weeks old, female).

[0102] 4.1.2 Lentiviral Construction and Transduction

[0103] OTUD4 overexpressing lentivirus was constructed, and CT26 cells were infected. Cell lines stably overexpressing OTUD4 (Otud4-OE) were selected using puromycin.

[0104] 4.1.3 Establishment of a subcutaneous xenograft model

[0105] Balb / C mice were randomly divided into 4 groups (n=8 / group): Ctrl group, αPD-L1 group, Otud4-OE group, and Otud4-OE+αPD-L1 group.

[0106] Ctrl group: Subcutaneous inoculation with control CT26 cells (5×10⁻⁶) 5 (each animal), intraperitoneal injection of PBS;

[0107] αPD-L1 group: control CT26 cells were subcutaneously inoculated and anti-PD-L1 antibody (200 μg / animal, once every 3 days) was injected intraperitoneally.

[0108] Otud4-OE group: Otud4-OE CT26 cells were subcutaneously inoculated and PBS was injected intraperitoneally;

[0109] Otud4-OE+αPD-L1 group: Otud4-OE CT26 cells were subcutaneously inoculated and anti-PD-L1 antibody (200 μg / mouse, once every 3 days) was injected intraperitoneally.

[0110] 4.1.4 Tumor growth monitoring

[0111] Measure the tumor's long and short diameters with calipers every 3 days and calculate the tumor volume (V = long diameter × short diameter). Continue measuring for 21 consecutive days.

[0112] 4.1.5 Sample Collection and Analysis

[0113] At the experimental endpoint, mice were euthanized by neck dislocation, and tumor tissue was removed and weighed. A portion of the removed tumor tissue was used for Western blot detection of PD-L1 expression, and another portion was used for flow cytometry detection of lymphocyte infiltration.

[0114] 4.1.6 Flow cytometry detection of lymphocyte infiltration

[0115] Tumor tissue was minced and digested with collagenase and DNase I to prepare a single-cell suspension. The suspension was then stained with fluorescently labeled anti-CD8, anti-CD45, anti-IFN-γ, and anti-GZMB antibodies and detected by flow cytometry.

[0116] 4.2 Experimental Results

[0117] 4.2.1 OTUD4 overexpression promotes tumor growth

[0118] Compared with the control group, the tumor size, tumor volume, and tumor weight were significantly increased in the Otud4-OE group. Although the tumor size and weight in the Otud4-OE+αPD-L1 group were lower than those in the Otud4-OE group, they were still significantly higher than those in the Ctrl group and the αPD-L1 group. Figure 3 AC). This indicates that overexpression of OTUD4 can promote tumor growth and counteract the tumor-suppressing effect of PD-L1 antibody.

[0119] 4.2.2 OTUD4 overexpression promotes PD-L1 expression in tumors in vivo.

[0120] Western blot and flow cytometry results showed that overexpression of OTUD4 increased the protein expression level of PD-L1 in vivo, and OTUD4 overexpression could counteract the inhibitory effect of PD-L1 antibody on PD-L1 expression in tumors. Figure 4 AF).

[0121] 4.2.3 OTUD4 overexpression reduces lymphocyte infiltration in tumor tissue

[0122] Flow cytometry results showed that OTUD4 overexpression reduced the proportion of CD8+ T cells in the tumor, as well as the levels of IFN-γ and GZMB secreted by T cells in the tumor. Even after PD-L1 antibody treatment, OTUD4 overexpression still resisted the therapeutic effect of PD-L1 antibody on the tumor. Figure 5 AF).

[0123] 4.3 Experimental Conclusions

[0124] This embodiment demonstrates that OTUD4 overexpression promotes tumor growth and resists the therapeutic effect of PD-L1 antibodies by upregulating PD-L1 expression, inhibiting lymphocyte infiltration and function in tumor tissue. This provides reverse validation for the therapeutic strategy of targeting and inhibiting OTUD4 in combination with PD-L1 antibodies.

[0125] Example 5: The effect of OTUD4 knockout on the anti-tumor immune response of PD-L1

[0126] This embodiment aims to investigate the effect of OTUD4 knockout on the anti-tumor effect of PD-L1 antibody through in vivo experiments, and to verify the synergistic anti-tumor effect of combined therapy with targeted inhibition of OTUD4 and PD-L1 antibody.

[0127] 5.1 Experimental Methods

[0128] 5.1.1 OTUD4 knockout cell construction

[0129] Using the OTUD4 knockout plasmid constructed in Example 1, OTUD4 was knocked out in CT26 cells to obtain a stable knockout cell line (sgOtud4).

[0130] 5.1.2 Establishment of a subcutaneous xenograft model

[0131] Balb / C mice were randomly divided into 4 groups (n=8 / group): Ctrl group, αPD-L1 group, sgOtud4 group, and sgOtud4+αPD-L1 group.

[0132] Ctrl group: Control CT26 cells (5×10^5 cells / animal) were subcutaneously inoculated and PBS was injected intraperitoneally;

[0133] αPD-L1 group: control CT26 cells were subcutaneously inoculated and anti-PD-L1 antibody (200 μg / animal, once every 3 days) was injected intraperitoneally.

[0134] sgOtud4 group: sgOtud4 CT26 cells were subcutaneously inoculated and PBS was injected intraperitoneally;

[0135] sgOtud4+αPD-L1 group: sgOtud4 CT26 cells were subcutaneously inoculated and anti-PD-L1 antibody (200 μg / mouse, once every 3 days) was injected intraperitoneally.

[0136] 5.1.3 Tumor growth monitoring and sample collection

[0137] Same as Example 4.

[0138] 5.2 Experimental Results

[0139] 5.2.1 OTUD4 knockout inhibits tumor growth

[0140] Compared with the control group, the sgOtud4 group showed significantly reduced tumor size, tumor volume, and tumor weight. The sgOtud4 + αPD-L1 group exhibited the best tumor-suppressing effect, significantly superior to the sgOtud4 monotherapy group and the αPD-L1 monotherapy group. Figure 6 (AC). This indicates that OTUD4 knockout can inhibit tumor growth and has a synergistic antitumor effect when combined with PD-L1 antibody.

[0141] 5.2.2 OTUD4 knockout reduces PD-L1 expression in tumors in vivo

[0142] Western blot and flow cytometry results showed that OTUD4 knockout could reduce PD-L1 protein expression levels in vivo, and OTUD4 knockout combined with PD-L1 antibody could more significantly inhibit PD-L1 expression in tumors. Figure 7 AF).

[0143] 5.2.3 OTUD4 knockout increases lymphocyte infiltration in tumor tissue

[0144] Flow cytometry results showed that OTUD4 knockout significantly increased the number of CD8+ T cells, IFN-γ+CD8+ T cells, and GZMB+CD8+ T cells in the tumor region. The combination therapy group had the highest level of lymphocyte infiltration. Figure 8 (AF). This indicates that OTUD4 gene knockout can enhance the anti-tumor immune effect of PD-L1 antibody.

[0145] 5.3 Experimental Conclusions

[0146] This embodiment confirms that OTUD4 knockout inhibits tumor growth by reducing PD-L1 expression, promoting lymphocyte infiltration and function in tumor tissue. The combination of OTUD4 knockout and PD-L1 antibody exhibits a synergistic anti-tumor effect, more effectively activating the anti-tumor immune response, providing key experimental evidence for the core technical solution of this invention.

[0147] Example 6: Analysis of the clinical significance and biomarker application of OTUD4 in colorectal cancer

[0148] This embodiment aims to study the expression characteristics of OTUD4 in colorectal cancer tissues and its relationship with patient prognosis through clinical sample analysis, and to explore the clinical application value of OTUD4 as a biomarker.

[0149] 6.1 Experimental Methods

[0150] 6.1.1 Clinical Sample Collection: Clinical data and related surgical specimens from 112 colorectal cancer patients were collected (from our hospital, with approval from the ethics committee and informed consent from the patients).

[0151] 6.1.2 OTUD4 Expression Detection

[0152] The expression level of OTUD4 in colorectal cancer tissues was detected by immunohistochemistry, Western blot, and q-PCR. Immunohistochemical staining results were independently scored by two pathologists. Patients were divided into high-OTUD4 expression and low-OTUD4 expression groups based on a combined score of staining intensity and percentage of positive cells.

[0153] 6.1.3 Statistical Analysis

[0154] Kaplan-Meier survival analysis and Log-rank test were used to compare the survival differences between patients in the high-expression and low-expression OTUD4 groups. Univariate and multivariate Cox regression analyses were used to assess the relationship between OTUD4 expression and other clinicopathological factors and patient prognosis. Based on the results of multivariate analysis, a nomogram prediction model was constructed, and the predictive efficacy of the model was evaluated using ROC curves and DCA curves.

[0155] 6.2 Experimental Results

[0156] 6.2.1 OTUD4 is highly expressed in colorectal cancer and is associated with poor prognosis.

[0157] Immunohistochemical, q-PCR, and Western blot analyses showed that OTUD4 mRNA and protein expression levels in colorectal cancer tissues were significantly higher than those in adjacent normal tissues. Figure 9 AD. Kaplan-Meier survival analysis showed that patients with high OTUD4 expression had significantly shorter overall survival than patients with low OTUD4 expression (AD). Figure 9 EF).

[0158] 6.2.2 OTUD4 expression is an independent prognostic factor for colorectal cancer patients.

[0159] In this clinical study, univariate analysis of the collected data showed that OTUD4 expression, sex, age, tumor size, clinical stage, and tumor budding status were all statistically significant with the target study outcome. Specifically, differences in OTUD4 expression were observed across different patient groups; sex showed a different tendency in its impact on outcome between male and female patients; the range of age variation was significantly associated with outcome; different dimensions of tumor size were closely related to outcome; patients in each clinical stage, classified according to established criteria, showed significant differences in outcome performance; and different categories of tumor budding status also had a significant statistical association with outcome.

[0160] Further multivariate analysis was conducted using an appropriate Cox proportional hazards regression model to comprehensively consider the above factors. The results showed that OTUD4 expression, gender, tumor size, clinical stage, and tumor budding status remained statistically significant in influencing the study outcome after excluding the influence of other factors. Specifically, OTUD4 expression level remained a key independent variable affecting the outcome in a multivariate environment; gender differences continued to show an independent effect on the outcome in the comprehensive analysis; tumor size measurement data still had a significant independent influence on the outcome in the context of multivariate synergistic effects; clinical stage remained a significant factor significantly affecting the outcome after considering the confounding effects of multiple factors; and tumor budding status also independently maintained a significant statistical association with the outcome in the multivariate model. These results indicate that the above factors not only have an impact on the target outcome in this clinical study at the univariate level, but also play an independent and crucial role in multivariate comprehensive consideration, providing a solid basis and key entry point for further in-depth research on disease mechanisms, the development of precision treatment strategies, and prognostic assessment (Table 1). Based on the results of univariate and multivariate analyses, we constructed nomograms. Through multidimensional variable visualization and survival analysis, we aimed to reveal the impact of multiple disease-related factors on patient survival prognosis, providing data support for clinical decision-making and further research. The nomogram prediction model constructed based on the above factors is as follows: Figure 10 As shown.

[0161] Table 1. Univariate and multivariate Cox regression analyses of overall survival in colorectal cancer patients.

[0162]

[0163] 6.2.3 Performance Evaluation of the Predictive Model

[0164] The ROC curve, through the dynamic relationship between the true positive rate and the false positive rate, intuitively reflects the discriminative ability of the predictive model constructed based on factors such as OTUD4 expression, gender, tumor size, clinical stage, and tumor budding status. Figure 11 A). Its area under the curve (AUC 1 year) reached 0.791, a value that clearly indicates that the model has good accuracy and reliability in distinguishing between surviving and deceased patients. Through detailed analysis of the ROC curve, we can determine the most suitable prediction threshold under different clinical needs, thereby ensuring a certain true positive rate while controlling the false positive rate within an acceptable range. This provides a key reference for clinical decision-making. For example, when determining whether patients need more aggressive treatment interventions, this threshold can more confidently screen out the truly benefiting patient group.

[0165] Meanwhile, the DCA curve further evaluated the predictive model in depth from a clinical practicality perspective. Figure 11 B, Note: Specific performance of net benefits for different models (such as the Cox model and its correlation with comprehensive factors) and different time spans (1 year, 3 years, 5 years) under various risk threshold settings. Considering the different costs and consequences of false positives and false negatives in clinical decision-making, the DCA curve clearly shows the model's net benefits under different threshold probabilities. In this study, the DCA curve was significantly higher than the extreme curves where all patients were considered positive or all patients were considered negative over a fairly wide threshold range, which fully demonstrates the effectiveness and practicality of this predictive model in real-world clinical applications.

[0166] 6.3 Experimental Conclusions

[0167] This embodiment confirms that OTUD4 is highly expressed in colorectal cancer and is closely associated with poor patient prognosis. Combining the results of Examples 2-5, patients with high OTUD4 expression may benefit more from treatment with an OTUD4 inhibitor combined with a PD-L1 antibody. Therefore, OTUD4 can serve as a biomarker for predicting patient response to combination therapy containing an OTUD4-targeting inhibitor and an anti-PD-L1 antibody, and can be used to prepare corresponding predictive kits.

[0168] Example 7: Application of OTUD4 as a drug screening target

[0169] This embodiment aims to establish a drug screening system based on OTUD4, providing a methodological basis for the discovery of novel OTUD4 inhibitors.

[0170] 7.1 Screening Method

[0171] Establish a drug screening system based on OTUD4:

[0172] Construct a colorectal cancer cell line overexpressing OTUD4;

[0173] Establish an OTUD4 deubiquitinase activity detection system;

[0174] Establish a reporter gene system for the regulatory relationship between OTUD4 and PD-L1 expression.

[0175] 7.2 Screening Process

[0176] Initial screening: OTUD4 overexpressing cells were treated with a compound library or natural product library, and changes in PD-L1 expression were detected;

[0177] Secondary screening: For compounds that were positive in the initial screening, their inhibitory effect on OTUD4 deubiquitinase activity was detected.

[0178] Validation: The in vivo antitumor effects of the candidate compounds and their synergistic effect with PD-L1 antibodies were validated in a mouse model of colorectal cancer.

[0179] 7.3 Application Prospects

[0180] This embodiment establishes a drug screening method targeting OTUD4, which can be used to discover novel OTUD4 inhibitors. These inhibitors are expected to be used in combination with PD-L1 antibodies for the treatment of colorectal cancer, providing an effective tool for the development of new drugs for colorectal cancer.

[0181] In summary, the above experiments demonstrate that this invention is the first to reveal that the deubiquitinating enzyme OTUD4, as a positive regulator of PD-L1, plays a crucial role in immune escape in colorectal cancer. In vitro cell experiments confirmed that knocking out OTUD4 significantly reduces the protein expression level of PD-L1 in colorectal cancer cells, while overexpression of OTUD4 promotes PD-L1 expression, clarifying the regulatory relationship between OTUD4 and PD-L1. In vivo animal experiments further confirmed that the combined application of OTUD4 knockout and PD-L1 antibody has a synergistic anti-tumor effect. Specifically, compared with the single treatment group, the combined treatment group showed significantly reduced tumor volume and tumor weight, exhibiting the best tumor suppression effect; PD-L1 expression levels in tumor tissue were significantly decreased, while the proportion of CD8+ T cell infiltration and the secretion levels of IFN-γ and GZMB were significantly increased, indicating that the combined treatment can effectively activate the anti-tumor immune response. Furthermore, clinical sample analysis showed that OTUD4 is highly expressed in colorectal cancer tissue and is significantly associated with poor patient prognosis; patients with high OTUD4 expression had significantly shorter overall survival than those with low expression. The predictive model built based on factors such as OTUD4 expression exhibits good discriminative ability (AUC 1 year = 0.791), suggesting that OTUD4 can serve as a biomarker for predicting patient response to combination therapy. This target and its applications can be used to prepare drug combinations for colorectal cancer treatment, develop diagnostic kits, and establish drug screening methods, providing new strategies for precision treatment of colorectal cancer, especially MSS-type colorectal cancer, and possessing significant clinical translational value.

[0182] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. A pharmaceutical combination for treating colorectal cancer, characterized in that, The drug combination comprises an effective amount of an agent that targets and inhibits OTUD4 and an effective amount of an anti-PD-L1 antibody or its antigen-binding fragment; the agent that targets and inhibits OTUD4 is used to reduce the expression level of PD-L1 in colorectal cancer cells, thereby enhancing the anti-tumor immune effect of the anti-PD-L1 antibody.

2. The drug combination according to claim 1, characterized in that, The reagent used to target and inhibit OTUD4 is an OTUD4 knockout plasmid constructed using the CRISPR / Cas9 system.

3. The drug combination according to claim 2, characterized in that, The OTUD4 knockout plasmid contains an sgRNA sequence that specifically targets the human OTUD4 gene, as shown in SEQ ID NO: 1 and / or SEQ ID NO:

2. sgRNA1: 5'-CACCGCAGTAAGCCGGACGAAGGC -3' and sgRNA2: 5'-CACCGATTCAGAACAGAGATGAAC-3'.

4. The drug combination according to claim 1, characterized in that, The anti-PD-L1 antibody or its antigen-binding fragment is a humanized antibody or its antigen-binding fragment.

5. Use of the pharmaceutical combination according to any one of claims 1-4 in the preparation of a medicament for treating colorectal cancer.

6. A pharmaceutical preparation, characterized in that, It comprises the pharmaceutical combination according to any one of claims 1-4, and a pharmaceutically acceptable carrier, diluent, or excipient.

7. A kit for diagnosing or monitoring treatment efficacy in colorectal cancer, characterized in that, It contains reagents for detecting OTUD4 expression levels.

8. The detection kit according to claim 7, characterized in that, The detection reagent is an antibody or probe used for immunohistochemistry or ELISA detection.

9. A method for screening drugs for the treatment of colorectal cancer, characterized in that, Targeting OTUD4, we screened compounds or biological agents that could inhibit OTUD4 activity or expression, and selected the effective inhibitors or activators as candidates for colorectal cancer treatment.

10. The use of OTUD4 as a biomarker in the preparation of kits for predicting the response of colorectal cancer patients to combination therapy containing an agent that targets and inhibits OTUD4 and an anti-PD-L1 antibody.

Citation Information

Patent Citations

  • Anti-tumor combined pharmaceutical composition and application thereof

    CN119770659A