Applications of the TraC gene, drugs, and methods for constructing TraC gene-deleted strains of Salmonella choleraesuis.

CN122557742APending Publication Date: 2026-08-14SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-09
Publication Date
2026-08-14

Smart Images

  • Figure CN122557742A_ABST
    Figure CN122557742A_ABST
Patent Text Reader

Abstract

This application discloses the application of the TraC gene, drugs, and a method for constructing a TraC gene-deleted strain of *Salmonella choleraesuis*, belonging to the field of biomedical technology. The technical solution involves the application of the TraC gene in the preparation of drugs that inhibit bloodstream infection of *Salmonella choleraesuis*. This application provides whole-genome and pan-genome screening to identify the key gene TraC that enhances the serum resistance and invasiveness of *Salmonella choleraesuis*. Furthermore, and more importantly, this application found that knocking out the TraC gene significantly reduces the bloodstream infectivity of *Salmonella choleraesuis*, indicating that subsequent expression inhibitors targeting this gene can, to some extent, inhibit bloodstream infection and proliferation of *Salmonella choleraesuis*.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of biomedical technology, and more specifically, relates to the application of the TraC gene, drugs, and methods for constructing TraC gene-deleted strains of Salmonella choleraesuis. Background Technology

[0002] Salmonella choleraesuis belongs to the Enterobacteriaceae family of non-typhoidal Salmonella. It is motile, does not form spores, is facultatively anaerobic, and has peritrichous flagella.

[0003] Salmonella choleraesuis has a complex pathogenic mechanism, causing not only gastroenteritis and diarrhea after infection, but also the ability to penetrate the intestinal epithelium and cause bloodstream infection, enabling it to establish systemic infection within the host. After invading host cells, Salmonella choleraesuis adapts to the intracellular environment through the type III secretion system (T3SS-2). Its virulence plasmids (such as the SPV gene cluster) enhance intracellular replication by regulating oxidative stress and apoptosis. Some strains can induce bacteremia and spread to organs such as the liver and spleen, forming purulent lesions.

[0004] In-depth research into the pathogenic molecular basis, drug resistance evolution pathways, and innovative prevention and control technology systems of this pathogen has become a cutting-edge scientific research topic for ensuring biosecurity in animal husbandry and preventing cross-transmission of zoonotic diseases.

[0005] Blood complement, as part of the innate immune system, plays a crucial role in defending against pathogens entering the bloodstream. The body can deposit complement on the surface of pathogenic microorganisms, forming a membrane-attack complex that destroys their surface protection and kills them. Simultaneously, inflammatory mediators and opsonins produced by complement activation pathways can induce inflammatory regulation and immune responses, enhancing the phagocytic efficiency of immune cells against pathogens. Investigating the mechanisms by which *Salmonella choleraesuis* survives in host blood and evades complement killing is of great significance for the prevention and control of invasive diseases caused by *Salmonella choleraesuis*.

[0006] The problem this solution aims to address is: how to reduce the evasion of Salmonella choleraesuis by complement killing, thereby inhibiting or reducing bloodstream infection by Salmonella choleraesuis. Summary of the Invention

[0007] The purpose of this application is to discover and verify the important genes in Salmonella cholerae that affect immune escape through experiments, and to reduce the immune escape phenomenon of Salmonella cholerae by regulating the expression level of these important immune escape genes, thereby inhibiting the infection and proliferation of Salmonella cholerae.

[0008] To achieve the above objectives, this protocol provides the application of the TraC gene in the preparation of drugs that inhibit Salmonella choleraesuis.

[0009] It should be noted that, during the actual experimental process, this application screened multiple genes to obtain the target gene for *Salmonella choleraesuis*.

[0010] Preferably, the drug inhibits Salmonella choleraesuis by suppressing or silencing the expression of the TraC gene.

[0011] Preferably, the drug inhibits Salmonella choleraesuis by suppressing or silencing the expression of the TraC gene, thereby inhibiting Salmonella choleraesuis through the following pathway;

[0012] (1) Reduce serum resistance to Salmonella choleraesuis;

[0013] (2) Block or reduce the evasion of Salmonella choleraesuis from macrophage internalization and intracellular survival;

[0014] (3) Reduce the invasive and adhesive ability of Salmonella choleraesuis;

[0015] (4) Reduce the blood infection capacity of Salmonella choleraesuis.

[0016] In addition, this application provides a drug for inhibiting Salmonella choleraesuis, containing an inhibitor that inhibits TraC gene expression, and a pharmaceutically acceptable carrier.

[0017] In addition, this application provides a method for constructing a TraC gene-deleted strain of Salmonella choleraesuis, comprising the following steps:

[0018] Step 1: Design primers for amplifying homologous targeting fragments, and use pKD4 plasmid as a template to amplify homologous targeting fragments;

[0019] Step 2: Competent cells were prepared using Salmonella cholerae, and then the pKD46 plasmid carrying the λRed recombinase gene was electroporated into the competent cells to obtain a Salmonella cholerae strain containing the pKD46 plasmid.

[0020] Step 3: Culture the Salmonella choleraesuis strain containing the pKD46 plasmid from Step 2, add L-arabinose to induce λRed recombinase expression, and then prepare electrotransfer competent cells again;

[0021] Step 4: Electroporate the homologous targeting fragment into the competent cells prepared in Step 3, and after verifying that the target gene replacement has been successfully achieved, pKD46 is then eliminated using temperature-sensitive properties to obtain a preliminary recombinant strain with pKD46 eliminated.

[0022] Step 5: Electroporate the pCP20 plasmid into the preliminary recombinant strain, screen with ampicillin, express Flp recombinase to remove the kanamycin resistance gene between the FRT sites on the chromosome, and then use the temperature-sensitive property to eliminate the pCP20 plasmid to obtain the TraC gene deletion strain of Salmonella cholerae.

[0023] The primers for amplifying the homologous targeting fragment were designed based on the TraC of Salmonella choleraesuis and included an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.1.

[0024] The nucleotide sequence of the downstream primer is shown in SEQ ID NO.2.

[0025] The beneficial effects of this application are:

[0026] This application provides a genome-wide and pan-genome screening of the key gene TraC, which enhances the serum resistance and invasiveness of Salmonella choleraesuis. TraC can promote bacterial adaptation to the host bloodstream and pathogenicity, resist the killing effect of serum and macrophages, and evade macrophage internalization. It also mediates its invasive adhesion ability and bloodstream infectivity. TraC can degrade complement protein C3 in serum, thereby promoting Salmonella choleraesuis's ability to evade host complement killing and its bloodstream infectivity. More importantly, this application found that knocking out the TraC gene significantly reduces the bloodstream infectivity of Salmonella choleraesuis, indicating that subsequent expression inhibitors targeting this gene can, to some extent, inhibit the bloodstream infectivity and proliferation of Salmonella choleraesuis. Attached Figure Description

[0027] Figure 1 This is a diagram showing the identification results of gene-deleted strains. Figure 1 Figure 'a' shows the PCR identification results of the TmrB gene deletion strain. Figure 1 Figure b shows the PCR identification results of the YqjZ gene deletion strain. Figure 1 Figure c shows the PCR identification results of the TraC gene deletion strain. Figure 1 Figure d shows the PCR identification results of the yokD gene deletion strain. Figure 1 The figure in the middle (e) shows the PCR identification results of the DAM gene deletion strain;

[0028] Figure 2 The image shows the identification results of TraC complemented and overexpressing strains. Figure 2 Figure 'a' shows the PCR identification results of the TraC complemented strain; Figure 2 Figure b shows the PCR identification results of the TraC overexpressing strain;

[0029] Figure 3 A comparison of growth curves for strains with different gene deletions.

[0030] Figure 4 Comparison of growth curves for wild-type strains, TraC-deleted strains, TraC-added strains, and TraC-overexpressing strains;

[0031] Figure 5 The results of serum resistance experiments for each gene deletion strain are shown in the figure.

[0032] Figure 6 Figure 1 shows the serum resistance test results of wild-type strain WT 241, deletion strain 241△TraC, complement strain 241ΔTraC R, and overexpression strain 241TraC+P.

[0033] Figure 7 This is a graph showing the transcriptional level of the wild-type TraC gene under serum conditions.

[0034] Figure 8 The image shows the colony count results of internalized Salmonella choleraesuis in RAW 264.7 cell pellet.

[0035] Figure 9 This is a graph showing the colony count results of Salmonella choleraesuis in a serum-containing supernatant culture medium.

[0036] Figure 10 This is a diagram showing the results of an experiment on the intracellular proliferation of macrophages of the strain.

[0037] Figure 11 The figure shows the results of cell adhesion and invasion experiments of wild-type WT 241 and deletion strain 241△TraC.

[0038] Figure 12 This is a graph showing the changes in mouse body weight.

[0039] Figure 13 Schematic diagram of tissue sections from mice infected with various bacterial strains;

[0040] Figure 14 The figures show the animal experimental results for wild-type strain WT241, deletion strain 241△TraC, complement strain 241△TraC R, and overexpression strain 241TraC+P. Figure 14 Figure 'a' shows the results of bacterial load measurement in mouse blood. Figure 14 Figure b shows the results of bacterial load measurement in mouse liver. Figure 14 Figure c shows the results of bacterial load measurement in mouse spleen.

[0041] Figure 15 Figure 1 shows the results of serum resistance phenotype identification of Salmonella choleraesuis after different treatments of serum to block the complement activation pathway (EGTA treatment to block the classical and MBL pathways, C1q antibody treatment to block the classical pathway, and 50°C incubation to block the alternative pathway).

[0042] Figure 16 Figure showing the results of serum resistance phenotype identification of wild-type strain 241 and deletion strain 241 ΔTraC after serum complement C3 blocking;

[0043] Figure 17Figure 1 shows the results of serum resistance phenotype identification of wild-type strain 241 and strain 241 with deletion after serum complement factor I blocking;

[0044] Figure 18 A graph showing the complement C3 protein content after incubation of Salmonella cholerae with serum;

[0045] Figure 19 A graph showing the C3 content of Salmonella cholerae after incubation with exogenous recombinant complement C3 protein;

[0046] Figure 20 This is a test image of TraC-mediated surface deposition of Salmonella cholerae evading C3 in serum, in which... Figure 20 Image a shows a side view of the binding capacity of invasive Salmonella choleraesuis to complement C3 at different serum concentrations. Figure 20 Figure b shows the complement C3 binding capacity test results of the deletion strain 241ΔTraC co-incubated with serum at 0 min, 30 min, 60 min, 120 min, and 180 min. Figure 20 In the middle, c is a side view of the complement C3 binding capacity of wild-type WT241 incubated with serum for 0 min, 30 min, 60 min, 120 min, and 180 min. Detailed Implementation

[0047] The present invention will now be clearly and completely described in conjunction with embodiments thereof. It should be noted that, unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0048] Gene pre-screening

[0049] It should be noted that before constructing the Salmonella choleraesuis gene deletion strain, this application conducted preliminary screening of genes related to serum resistance of Salmonella choleraesuis.

[0050] This application pre-compares the serological resistance of a total of 21 strains of Salmonella choleraesuis and finds that 13 of them have high serological resistance and 8 have weak resistance.

[0051] Furthermore, through comparison, it was found that highly invasive Salmonella choleraesuis carries thirteen genes that are absent in Salmonella choleraesuis with weak serum resistance and low invasiveness: TraC, yqjZ, TmrB, DAM, yokD, virB_1, hns_2, higB_1, hha_1, gltS_2, dcm_1, ant1_2, and bla-1. Among these, TraC, yqjZ, TmrB, DAM, and yokD have no other homologous genes; therefore, TraC, yqjZ, TmrB, DAM, and yokD genes were selected for further experiments.

[0052] Example 1: Construction of a gene-deleted strain of Salmonella choleraesuis

[0053] 1.1 Information on test materials

[0054] Salmonella choleraesuis, HeLa human cervical cancer epithelial cells, and RAW264.7 mouse macrophages were preserved by the Department of Animal Infectious Diseases, South China Agricultural University. Prokaryotic expression plasmids pKD4, pCP20, and pKD46 were purchased from Beyotime Biotechnology Co., Ltd. (Shanghai, China). pBAD-HisA was obtained from Miaoling Biotechnology Co., Ltd. (Guangzhou, China), and E. coli DH5α and BL21 competent strains were obtained from Sangon Biotech Co., Ltd. (Shanghai, China).

[0055] Fifty SPF-grade, 6-week-old female BaLB / c mice were purchased from the Guangdong Provincial Laboratory Animal Center. A one-week observation and acclimatization period was administered between purchase and experimental use to allow the mice to adapt to their environment and avoid stress. All use of the laboratory animals was approved by the Animal Ethics and Welfare Committee of South China Agricultural University.

[0056] 1.2 Major reagents, consumables and instruments are listed in Tables 1 and 2.

[0057] Table 1: Main Reagents and Consumables Required for the Experiment

[0058] XLT-4 Selective Plate Medium Thermo Fisher Scientific LB Broth Guangzhou Huankai Microbial Co., Ltd. LB agar Guangzhou Huankai Microbial Co., Ltd. Agarose Guangzhou Dingguo Biotechnology Co., Ltd. Ex Taq DNA polymerase Bao Ri Medical Biotechnology Co., Ltd. Restriction endonucleases NEB (Beijing) Co., Ltd. T4 ligase Bao Ri Medical Biotechnology Co., Ltd. rTaq DNA polymerase Bao Ri Medical Biotechnology Co., Ltd. PrimeSTAR®Max DNA Polymerase High-Fidelity Enzyme Bao Ri Medical Biotechnology Co., Ltd. DNA Ladder Bao Ri Medical Biotechnology Co., Ltd. DNA Gel Recovery Kit OMEGA Corporation, USA HiScript III RT SuperMix for qPCR (+gDNA wiper) Nanjing Novizan Biotechnology Co., Ltd. ChamQ Universal SYBR qPCR Master Mix Nanjing Novizan Biotechnology Co., Ltd. Ampicillin Guangzhou Dingguo Biotechnology Co., Ltd. Kanamycin sulfate Guangzhou Dingguo Biotechnology Co., Ltd. Chloramphenicol Guangzhou Dingguo Biotechnology Co., Ltd. Gentamicin sulfate Guangzhou Dingguo Biotechnology Co., Ltd. Anhydrous methanol Nanjing Chemical Reagent Co., Ltd. Anhydrous ethanol Nanjing Chemical Reagent Co., Ltd. Glycerol Tiangen Biotech Co., Ltd. PCR 8-well tubes Beebio 90 mm disposable petri dish Biosharp mouse serum Chongqing Wokawei Biotechnology Co., Ltd. EGTA McLean Recombinant protein C3 MCE C1q Rabbit pAb antibody Wuhan Aiboteke Biotechnology Co., Ltd. C3 Rabbit pAb antibody Wuhan Aiboteke Biotechnology Co., Ltd. FITC Goat Anti-Rabbit IgG (H+L) Wuhan Aiboteke Biotechnology Co., Ltd. His Rabbit pAb antibody Wuhan Aiboteke Biotechnology Co., Ltd. Anti-CFI pAb antibody Beijing Solarbio Technology Co., Ltd. Western Blot universal primary antibody diluent Shanghai Beyotime Biotechnology Co., Ltd. Western Blot universal secondary antibody diluent Shanghai Beyotime Biotechnology Co., Ltd. 30% Acrylamide Sangon Biotech Co., Ltd. reagent and consumable name Manufacturer 4× Tris-HCl buffer, pH 8.8 Sangon Biotech Co., Ltd. 10% SDS solution Sangon Biotech Co., Ltd. Tetramethylethylenediamine stock solution (TEMED) Sigma-Aldrich Trading Co., Ltd. ammonium persulfate Shanghai Baiyan Biotechnology Co., Ltd. Tris-base Guangzhou Saiguo Biotechnology Co., Ltd. Tris-HCl Guangzhou Saiguo Biotechnology Co., Ltd. Glycine Guangzhou Saiguo Biotechnology Co., Ltd. NaCl Guangzhou Chemical Reagent Factory Tween20 Sangon Biotech Co., Ltd. skim milk powder BD Company, USA Primary and secondary antibody removal solution Shanghai Beyotime Biotechnology Co., Ltd. NcmECLUltra Luminol / Enhancer Reagent(A) NewSaiMei Biotechnology Co., Ltd. NcmECLUltra StabilizedPeroxideReagent (B) NewSaiMei Biotechnology Co., Ltd. Protein Marker Thermo Fisher Scientific Protease Inhibitor 100× Shanghai Beyotime Biotechnology Co., Ltd. SDS-PAGE Sample Loading Buffer 5× Shanghai Beyotime Biotechnology Co., Ltd. RNA extraction kit OMEGA Corporation, USA DNA extraction kit OMEGA Corporation, USA Tris-HCl Solution, pH 6.8 Sangon Biotech Co., Ltd.

[0059] Table 2: Main Instruments and Equipment Required for the Experiment

[0060] Elix100 Pure Water System Millipore, USA 5430 R centrifuge Eppendof mLS-3780 High-Temperature Steam Sterilizer Sanyo Instruments, Japan YJ-1450 Clean Bench Suzhou Purification Equipment Factory Multifunctional electroporation instrument Eppendorf Agarose gel imaging system BIO-RAD Company Real-time quantitative PCR instrument BIO-RAD Company membrane scanning instrument Thermo

[0061] 1.3 Primer Design and Synthesis

[0062] Using the complete genome sequence of *Salmonella choleraesuis* SC-B67 obtained from GenBank (serial number: AE017220.1) and the pKD4, pKD46, and pCP20 plasmid sequences obtained from SnapGene, NCBI was used to design primers for amplifying homologous target fragments targeting kanamycin resistance on the pKD4 plasmid. These primers included TraC-L1-F / R, DAM-L2-F / R, yokD-L3-F / R, TmrB-L4-F / R, and yqjZ-L5-F / R, as well as primers for the TraC gene (TraC-JD-F / R), pCP20 identification (pCP20-JD-F / R), and pKD46 identification (pKD46-JD-F / R). Furthermore, real-time quantitative PCR primers were designed for TraC (see Tables 3-4 for details).

[0063] Table 3: Primers required for PCR amplification

[0064] TraC-L1-F CACTTAAGTGCCTGGTCTGCCGTTCGTGTGTGGTGGTCGAATGAGGTCATGATAGTGTAGGCTGGAGCTGCTTC TraC-L1-R CGTACTGGATACCTCAGTCAAAACAAAATGAGGTAACCAGTAACTTAAAACGCATATGAATCCTCCTTAG DAM-L2-F TATTGTTAAATTGTTAGTGAAAATTCTGGTAAACTAATAGAGGTAAAAGTGTAGGCTGGAGCTGCTTC DAM-L2-R TATTGTTAAATTGTTAGTGAAAATTCTGGTAAACTAATAGAGGTAAAAGTGTAGGCTGGAGCTGCTTC yokD-L3-F CACTGAGCGTCAGACCCCGTATAGTGTTTTGCAGTTTAGAGGAGATATCGCGGTGTAGGCTGGAGCTGCTTC yokD-L3-R TCTTTCCGGCGCCGAAAGGTCCGTTGATCCAGATTATCATTGTCGACGGCCTCATATGAATATCCTCCTTAG TmrB-L4-F GCACGAGGCCGTCGAGCGCTCTTGCGCCTTCAGGTTAGAGGCCGTCGACAGTGTAGGCTGGAGCTGCTTC TmrB-L4-R GGTCGTGAGCCCGCCACCCTCGCTACGCTTTGCAGGCGTCGAAGGCGACATATGAATCCTCCTTAG yqjZ-L5-F CTTTCGGTACCATAAGTGTGGCATACCGATAAAGCTGAACGGAGAAGACTCGGTGTAGGCTGGAGCTGCTTC yqjZ-L5-R CTTTCGGTACCATAAGTGTGGCATACCGATAAAGCTGAACGGAGAAGACTCGGTGTAGGCTGGAGCTGCTTC TraC-PBAD-F TACCCTCGAGGGATCCATGCATCATCATCATCATCATATGGAAGGTCATGATAAGCT TraC-PBAD-R GCTTGAATTCGGATCCTCAGGCAGCTGATTTGCTCG TmrB-JD-F GTTGGTCCGCTGGCTGAAA TmrB-JD-R TCTGGGCGTTTGGTCGT yokD-JD-F ATGCATACGCGGAAGGCAAT yokD-JD-R CTAACCTGAAGGCTCGCAA DAM-JD-F TTGCGAAAACATACACCAATC DAM-JD-R TCAACGAAGGACGGCCAGAAT TraC-JD-F ATGGAAGGTCATGATAAGCTTAAGG TraC-JD-R TTCACACCATTGCCCCAACT yqjZ-JD-F ATGATTGCTGTAATATTT yqjZ-JD-R AGGATAATGTTTGA pKD46-JD-F GCAACTTTATCCGCCTCC pKD46-JD-R TCGCCCTTATTCCCTTTT pCP20-JD-F CAGTGCTGCAATGATACCGC pCP20-JD-R TCCTTGAGAGTTTTCGCCCC C4BP-F ATGCACCCCCCAAAAACTC C4BP-R TTATAGTTCTTTATCCAAAGTGGATTGTC C4BP-PXJ41-FLAG-F TCGCGGCCGCGGATCCATGGATTACAAGGACGACGATGACAAGATGTGTGCAAAGCAGCAGC C4BP-PXJ41-FLAG-R GCTTCCCGGGGGATCCCTCAGTGTGCTTCAGTGTGTT TraC-PCOLD-HA-F TACCCTCGAGGGATCCATGGATTACAAGGACGACGATGACAAGATGCACCCCCCAAAAACTCC TraC-pCOLD-R CTCGAGGGTACCGAGCTCCAGGATCCCCATAAATCCCTCCTTCACA TraC-PCAG-HA-F GATGTTCCAGATTACGCTGAATTCATGGAAGGTCATGATA TraC-PCAG-HA-R GGTACCATCGATGAGCTCGAATTCTCAGGCAGCTGATTTG

[0065] Table 4: Primers required for real-time PCR amplification

[0066] TraC-QF CATTGATGCGCTTTACTCTG TraC-QR CTCTGCGTTGTAGATGAGAA

[0067] 1.4 Extraction and whole-genome sequencing of bacterial DNA

[0068] Salmonella choleraesuis was inoculated onto XLT-4 agar plates for resuscitation and then incubated overnight at 37°C. After colony formation, selected single colonies were inoculated into 1 mL of LB medium at 37°C and 180 rpm and incubated for 12–14 h. The following day, the culture was diluted 1:100 to 7 mL of fresh LB medium. Subsequently, Salmonella choleraesuis DNA was extracted according to the instructions of the Omega bacterial DNA extraction kit and stored at -80°C. The -80°C bacterial DNA was then removed, placed in an ice box, and sent to Novogene Sequencing Technology Co., Ltd. for sequencing analysis.

[0069] 1.5 Construction of strains with deletions of TmrB, YqjZ, TraC, Yokd, and DAM genes

[0070] The TmrB, YqjZ, TraC, Yokd, and DAM genes of *Salmonella choleraesuis* 241 were knocked out using Red homologous recombination technology. Through this process, gene deletion strains of 241△TmrB, 241△YqjZ, 241△TraC, 241△Yokd, and 241△DAM were successfully constructed. The main operational steps are summarized as follows:

[0071] (1) Amplification of homologous targeting fragments

[0072] Primers TraC-L1-F / R, DAM-L2-F / R, yokD-L3-F / R, TmrB-L4-F / R, and yqjZ-L5-F / R were used to amplify homologous targeting fragments. Using pKD4 plasmid as a template, PrimeSTAR® Max DNA Polymerase reagent was employed for PCR amplification to obtain homologous targeting fragments carrying the corresponding gene homologous arms. The specific amplification reaction system is shown in Table 5. Reaction conditions: denaturation at 98℃ for 5 min, followed by 35 cycles of 98℃ denaturation for 10 s, annealing at 55℃ for 15 s, extension at 72℃ for 1.5 min, and a final extension at 72℃ for 10 min to ensure product integrity. After the reaction, PCR products were analyzed by gel electrophoresis, and the target band was efficiently recovered using a DNA gel extraction kit. The concentration of the recovered product was accurately measured using a superspectral spectrophotometer and stored properly at -80℃.

[0073] Table 5: Homologous Targeting Fragment Amplification System

[0074] PrimeSTAR®Max DNA Polymerase(2×) 25 μL upstream primer 10-15 pmol Downstream primer 10-15 pmol DNA template <200 of ddH2O up to 50 μL

[0075] (2) Preparation of competent states

[0076] First, *Salmonella choleraesuis* 241 was inoculated onto XLT-4 agar plates and incubated at 37°C for 16–18 h. Then, single colonies were selected from the culture dishes and inoculated into centrifuge tubes containing 1 mL of fresh LB medium. These tubes were incubated at 37°C and 180 rpm for 12 h. The cultured bacterial solution was then diluted 1:100 with fresh LB medium and incubated until the bacterial optical density (OD) reached a certain value. 600The concentration of the cultured bacteria (nm) was brought to between 0.4 and 0.6. The cultured bacterial solution was then transferred to 50 mL centrifuge tubes and chilled on ice for 30 min. Immediately afterwards, the tubes were centrifuged at 4800 rpm for 8 min. After gently removing the supernatant, 20 mL of pre-cooled 10% glycerol was carefully added to the precipitated bacteria, and the bacteria were gently stirred with a pipette to resuspend them. After resuscitation, the bacteria were again chilled on ice for 3 min. The centrifugation process was then repeated, centrifuging at 4°C and 5000 rpm for 10 min, with the supernatant gently removed. The bacteria were then gently stirred with 20 mL of pre-cooled 10% glycerol, a step repeated twice. Finally, the supernatant was removed, leaving only 200 μL of pre-cooled 10% glycerol, which was then gently stirred with a pipette to resuspend the bacteria. Finally, 100 μL of the prepared competent cells were aliquoted into 1.5 mL EP tubes and stored properly at -80°C for subsequent experiments.

[0077] (3) Electroporation of pKD46 plasmid

[0078] The clean, sterile electroporation cuvette was placed in a laminar flow hood and sterilized by UV irradiation for 1 hour, ensuring it was completely dry. Then, the cuvette was placed on ice for 30 minutes. Next, 3 μL of plasmid pKD46 was gently added to the previously prepared competent cells, mixed thoroughly, and incubated on ice for 5 minutes. The plasmid-bacterial mixture was then added to the electroporation cuvette. The electroporator parameters were set as follows: resistance 200 OHMs, capacitance 25 uF, and voltage 1.8 kV. After electroporation, 1 mL of preheated (37°C) SOC medium was immediately added to the cuvette and gently stirred to mix. The bacterial culture was then transferred to a clean, sterile 1.5 mL EP tube and incubated at 30°C and 180 rpm for 2 hours. After incubation, 200 μL of the bacterial culture was evenly spread onto an LB agar plate containing 100 μg / mL ampicillin. The plates were incubated at 30°C for 12 h. A single colony was selected from the plate and inoculated into LB medium containing 100 μg / mL ampicillin, and incubated for another 4 h at 30°C and 180 rpm. Subsequently, PCR amplification was performed using primers pKD46JD-F / R to verify the presence of plasmid pKD46. Specific primer sequences are shown in Table 3. Details of the PCR amplification reaction system are shown in Table 6. The amplification conditions were: initial denaturation at 95°C for 5 min, followed by 30 cycles, each cycle consisting of 95°C denaturation for 1 min, 55°C annealing for 45 s, 72°C extension for 1 min, and a final extension at 72°C for 8 min to ensure product integrity. After the PCR reaction, the PCR products were analyzed by gel electrophoresis to verify whether plasmid pKD46 was successfully introduced into wild-type strain 241. The successfully verified strain was named X-pKD46.

[0079] Table 6: 20 μL PCR amplification system

[0080] rTaq enzyme 10 <![CDATA[ddH2O]]> 6 Upstream primer (20 μmol) 1 Downstream primer (20 μmol) 1 DNA template 2 Total volume 20

[0081] (4) Induction of recombination and preparation of competent cells

[0082] The pKD46 strain was revived on LB agar containing ampicillin and cultured overnight at 30°C. The following day, after culturing, single colonies were selected from agar plates and inoculated into LB agar containing the same concentration of ampicillin, and cultured for another 12 h at 30°C and 180 rpm. Then, the culture was inoculated at a 1:100 ratio into fresh LB agar containing 100 μg / mL ampicillin and cultured at the same temperature and speed. After 4 h of culture at 30°C and 180 rpm, 100 mmol / L sterile L-arabinose was added. Cultured under the same conditions until the bacterial optical density (OD) value was reached. 600 The nanoparticle size (nm) reached the range of 0.4 to 0.6. Competent cells were prepared according to the above method.

[0083] (5) Electro-optical target shooting segment

[0084] 100 ng of a fragment carrying the resistance gene was electroporated into competent cells containing pKD46 under conditions of 25 uF capacitance, 200 OHMs resistance, and 1.6 kF voltage. Then, 1 mL of preheated 37°C SOC medium was added to the electroporation cuvette. The bacterial culture was then transferred to sterile 1.5 mL EP tubes using a pipette and incubated at 37°C on a shaker at 180 rpm for 3 h. After incubation, 200 μL of the bacterial culture was evenly spread onto LB agar plates containing 50 μg / mL kanamycin and incubated at 37°C for 12 h. Single colonies were picked and cultured in LB stomatology medium containing kanamycin for another 4 h at 37°C and 180 rpm. Subsequently, PCR amplification was performed using primers TraC-JD-F / R, DAM-JD-F / R, yokD-JD-F / R, TmrB-JD-F / R, and yqjZ-JD-F / R for verification. The PCR amplification reaction conditions and system were as described in section 1.5(1), and the successfully sequenced strain was named X-pKD46-pKD4-TmrB / YqjZ / TraC / Yokd / DAM.

[0085] (6) Elimination of pKD46 plasmid

[0086] The successfully sequenced strains were inoculated onto LB antibiotic-free agar plates and cultured at 42°C for 12 h to utilize the temperature-sensitive properties of the pKD46 plasmid to eliminate it. After 12 h, the same colonies were selected from the plates and inoculated into 1 mL of fresh LB medium containing 50 μg / mL kanamycin and 100 μg / mL ampicillin, respectively, and then cultured at 37°C and 180 rpm for 4 h. After culturing, strains that could only grow in LB medium containing kanamycin were screened out. Then, the elimination of pKD46 was confirmed by PCR using the method described in section 1.5(3). Please refer to Table 4 for the specific primer sequences.

[0087] (7) Elimination of the kanamycin gene

[0088] The temperature-sensitive plasmid pCP20 was electroporated into X-TmrB / YqjZ / TraC / Yokd / DAM competent cells. The electroporation operation and parameter settings followed the electroporation method described in Section 1.5(3). After the electroporation operation was completed, 1 mL of fresh SOC broth was immediately added to the system and cultured at 30°C and 180 rpm for 2 h. The above culture solution was evenly spread on LB agar plates containing 100 μg / mL ampicillin. After culturing at 30°C for 12 h, a single colony was selected from the agar plate and inoculated into LB broth containing the same concentration of ampicillin, and cultured under the same conditions for another 4 h. Subsequently, the transformation of plasmid pCP20 was verified by PCR using the primers in Table 4. The system and conditions of the PCR amplification reaction were also performed as described in Section 1.5(3).

[0089] To remove plasmid pCP20, positive strains selected in the previous step were streaked onto antibiotic-free LB agar plates and cultured at 42°C for 12 h. Subsequently, single colonies were picked from the plates and cultured at 37°C and 180 rpm for 4 h. Strains that could only grow in LB broth without kanamycin were selected. Subsequently, bacterial culture PCR was performed using primers TmrB / YqjZ / TraC / Yokd / DAM-JD-F / R to confirm the deletion of the target gene. The specific sequences of the primers are shown in Table 4. The PCR amplification reaction system and reaction conditions followed the experimental methods in section 1.5(3). After the PCR reaction was completed, the products were analyzed by electrophoresis, and the results are as follows. Figure 1As shown, the amplified fragment sizes of wild-type WT241 were 2113bp, 1721bp, 2391bp, 1861bp, and 1925bp, respectively. The amplified fragment sizes after successful gene knockout were 629bp, 171bp, 195bp, 909bp, and 491bp, respectively. Related gene deletion strains were successfully constructed and named 241△TmrB, 241△Yqjz, 241△TraC, 241△Yokd, and 241△DAM, respectively.

[0090] It should be noted that, Figure 1 In Figure 'a', the strain was identified by PCR using primers TmrB-JD-F / R, with lane M serving as the DNA molecular quality standard. Lanes 4, 5, 6, and 7 represent samples with successful TmrB knockout, while lanes 1, 2, and 3 represent the amplified bands of the wild-type strain WT241.

[0091] Figure 1 In Figure b, the strain was identified using primers YqjZ-JD-F / R, with lane M used as the DNA molecular quality standard. In this experiment, lanes 1, 2, and 4 represent the successful knockout of the Yqjz gene, while lanes 3, 5, 6, and 7 represent the amplified bands of the wild-type strain WT241.

[0092] Figure 1 In the experiment, lane M was used as the DNA molecular quality standard, lanes 6 and 7 indicated that the TraC gene was successfully knocked out, while lanes 1-5 represented the amplification bands of the wild-type WT241 strain.

[0093] Figure 1 In the image, lane d represents the PCR identification of the strain using primers yokD-JD-F / R, and lane M is used as the DNA molecular quality standard. Lanes 4, 5, and 6 successfully knocked out the DAM gene, while lanes 1, 2, and 3 still showed amplified bands of the wild-type strain WT241.

[0094] Figure 1 The strains were identified by PCR using primers DAM-JD-F / R, with lane M serving as the DNA molecular quality standard. Lanes 1 and 4 represent samples with successful TmrB knockout, while lanes 2, 3, 5, and 6 represent amplified bands of the wild-type strain WT241.

[0095] 1.6 Construction of the complemented strain 241△TraC R and the overexpressing strain 241TraC+P

[0096] 1.6.1 PCR amplification of the TraC gene

[0097] Based on the nucleotide sequence of the TraC gene of *Salmonella choleraesuis* published in the GenBank database, a pair of PCR primers carrying restriction enzyme sites was designed and named TraC-HF / R. The specific primer sequences are detailed in Table 3. For PCR amplification, genomic DNA from the wild-type strain WT241 was used as a template, and the PCR reaction system shown in Table 7 was employed. The PCR amplification conditions were set as follows: a 5-minute pre-denaturation at 95°C was performed, followed by 35 cycles of amplification, each cycle consisting of 1 minute of denaturation at 95°C, 45 seconds of annealing at 56°C, and 1 minute of extension at 72°C; a final extension at 72°C for 10 minutes was then performed. The PCR products were recovered, concentrated, and stored at -80°C.

[0098] Table 7: 50 μL PCR amplification system

[0099] Ex Taq 25 ddH2O 21 Upstream primer (20 μmol) 1 Downstream primer (20 μmol) 1 DNA template 2

[0100] 1.6.2 Double enzyme digestion, purification, and ligation of vector plasmid and target gene

[0101] According to the restriction endonuclease usage guidelines provided by NEB, the reaction system was prepared as shown in Table 8. The reaction was carried out at 37°C for 1 hour to obtain the enzyme digestion product. Finally, the product was recovered and analyzed, concentrated, and stored in a -80°C freezer.

[0102] Table 8: 50 μL Enzyme Digestion Reaction System

[0103] PCR gel recovery products 1 μg 10× NEBuffer 5 μL EcoRI 1 μL PstI 1 μL ddH2O Up to 50 μL

[0104] Next, following the T4 ligase user manual provided by Takara, the recovered digested products were ligated. The specific ligation system is detailed in Table 9. After thoroughly mixing the ligation system in a 1.5 mL EP tube under high pressure, the tube was placed at a constant temperature of 16°C for 12 hours for ligation.

[0105] Table 9: 10 μL Ligation Reaction System

[0106] plasmid double enzyme digestion products 50 ng Double enzyme digestion product of target fragment 37.5 ng T4 DNA Ligase 10 μL 10× T4 DNA Ligase Buffer 1 μL <![CDATA[ddH2O]]> Up to 10 μL

[0107] After the ligation reaction was completed, the ligation product was amplified using E. coli DH5α and cultured at 37°C and 180 rpm for 1 h. Then, 100 μL of the bacterial culture was evenly spread onto LB agar plates containing 100 μg / mL ampicillin and incubated at 37°C for 12 h. The transformation results were checked, and single colonies were selected and inoculated into LB broth containing the same concentration of ampicillin, and cultured for another 4 h under the same conditions. Then, PCR was performed using the universal primers in Table 4 according to the method described in section 1.5(1). The pBAD-TraC plasmid was successfully obtained. The recombinant expression plasmid was electroporated into the bacterial strain, such as... Figure 2 As shown, the amplified fragment size of the TraC-pBAD recombinant plasmid was 2391 bp, and the amplified fragment size of the wild-type WT 241 was also 2391 bp. The complemented and overexpressing strains were successfully constructed and named 241△TraC R and 241TraC+P, respectively.

[0108] It should be noted that, Figure 2 In Figure 'a', the strains were identified by PCR using primers TraC-JD-F / R, with M used as the DNA molecular quality standard. Strains numbered 2, 3, and 6 are samples from which the TraC recombinant plasmid was successfully reintroduced. Figure 2 Figure b shows the PCR identification of the strains using primers PBAD-JD-F / R, with M used as the DNA molecular weight standard. In this identification, strains numbered 1 to 6 are wild-type strains WT 241 carrying amplified bands of pBAD-TraC.

[0109] Example 2

[0110] 2.1 Determination of the growth curve of the strain

[0111] Following the method described in the reference (Mil-Homens et al., 2018), growth curves of wild-type strain WT 241, deletion strains 241△TmrB, 241△YqjZ, 241△TraC, 241△Yokd, 241△DAM, as well as the complement strain 241△TraC R and the overexpression strain 241TraC+P were measured. In the experiment, single colonies were first selected from agar plates and inoculated into LB broth, and cultured at 37°C and 180 rpm for 12 h. The cultured bacterial solution was then diluted into fresh LB broth, and the OD... 600 The nm value was adjusted to 0.1. Subsequently, the cells were continuously cultured for 23 h at the same temperature and rotation speed, with OD measured every 1 h. 600 nm values ​​were recorded, and the experiment was repeated three times to ensure the accuracy of the results.

[0112] Wild-type strain WT241 and deletion strains 241△TmrB, 241△YqjZ, 241△TraC, 241△Yokd, and 241ΔDAM were cultured continuously for 23 h. The absorbance at 600 nm was measured every h, and growth curves were plotted based on these data. The results are as follows: Figure 3 As shown, after deleting the genes TmrB, YqjZ, TraC, Yokd, and DAM respectively, the growth trend of the gene-deleted strains was consistent with that of the wild-type strains, indicating that these five genes do not affect the growth characteristics of the bacteria.

[0113] Furthermore, observe Figure 4 The growth trends of wild-type strains WT 241 and 241△TraC, as well as the complemented strain 241△TraC R and the overexpressed strain 241TraC+P, were consistent with those of wild-type strains, indicating that TraC does not affect the growth characteristics of Salmonella choleraesuis.

[0114] 2.2 Serum resistance phenotype determination

[0115] Single colonies of wild-type strain WT241, deletion strains 241△TmrB, 241△YqjZ, 241△TraC, 241△Yokd, 241△DAM, as well as complement and overexpression strains (including 241△TraC R and 241TraC+P), were selected and inoculated into 10 mL of LB broth. After incubation at 37°C and 200 rpm for 12 h, the bacterial culture was diluted 1:100 to 10 mL of fresh LB broth and cultured until the logarithmic growth phase. Following centrifugation, the supernatant was discarded, and the cells were resuspended in PBS. The washing was repeated three times, and the OD value of the bacterial culture was adjusted with PBS to a uniform level (OD). 600 (nm=0.42). To investigate the strain's resistance to serum, 250 μL of bacterial culture and 750 μL of serum were added to sterile 2 mL EP tubes. After thorough mixing by shaking, the tubes were incubated at 37°C for 1 to 3 hours. After incubation, the strains before and after culture were serially diluted, and colony counts were performed to determine their ratios.

[0116] refer to Figure 5-6 After TmrB, YqjZ, TraC, Yokd, and DAM were deleted, respectively, the bacterial serum resistance was significantly reduced compared with the wild-type strain (P<0.05), decreasing by 1.33 times, 2.72 times, 1.14 times, and 1.13 times, respectively.

[0117] Therefore, it can be seen that the serum resistance of the TraC gene deletion strain is the most significant compared with other gene deletion strains, which further illustrates its good research prospects. Therefore, this application further compared the TraC gene deletion strain, the TraC complemented strain (241△TraC R) and the TraC overexpression strain (241TraC+P).

[0118] Furthermore, compared with WT 241, the serum resistance ratio of 241△TraC was significantly weakened (P<0.05), decreasing by 2.51 times, while the R of 241△TraC was increased, indicating that TraC can promote serum resistance to Salmonella choleraesuis.

[0119] 2.3 Real-time quantitative PCR detection of TraC expression level

[0120] Single colonies were picked from the wild-type strain WT 241 after 12 h of culture, and then inoculated into fresh LB medium and cultured at 37°C and 180 rpm for 4 h. Total RNA was then successfully extracted from these bacteria following the instructions of the RNA extraction kit provided by Omega. The procedure was performed according to the reverse transcription reagent guidelines of Nanjing Novizan Biotechnology Co., Ltd. Specific reaction conditions are shown in Table 10, with the reaction held at 42°C for 2 min.

[0121] Table 10: Genomic DNA Removal Reaction System

[0122] template RNA 1 μg 4× gDNA wiper Mix 4 μL <![CDATA[ddH2O]]> Up to 16 μL

[0123] Next, reverse transcription was performed. The required reaction system is shown in Table 11. After thoroughly mixing the reaction system, it was placed in a constant temperature environment of 37°C for 15 min to ensure the complete progress of reverse transcription. Subsequently, the reaction temperature was rapidly increased to 85°C and held for 5 s to terminate the reaction. After the reverse transcription was completed, the product was properly stored in a -80°C freezer for use in subsequent experiments.

[0124] Table 11: Reverse Transcription Reaction System

[0125] 5× HiScript III qRT SuperMix 4 μL Step 1 reaction solution 16 μL

[0126] The 16S rRNA gene was selected as an internal reference, and the transcription level of the bacterial gene TraC was detected using real-time quantitative PCR. The specific reaction system is shown in Table 10. The experimental conditions were as follows: preheating at 95℃ for 30 seconds; followed by 40 cycles, each cycle consisting of 10 seconds at 95℃ and 30 seconds at 60℃; then extension at 60℃ for 1 min; finally, melting curve analysis was performed at 95℃ for 15 seconds. These reaction conditions allow for a comprehensive and accurate assessment of the transcription level of the TraC gene under serum conditions.

[0127] Results Analysis

[0128] When bacteria invade the host's bloodstream, they dynamically adjust gene expression to develop various immune escape mechanisms. To investigate the changes in TraC transcription levels in *Salmonella choleraesuis* under serum conditions, this application quantitatively analyzed the expression of the wild-type TraC gene using real-time quantitative PCR. The results are as follows: Figure 7 As shown, the transcriptional level of TraC in Salmonella cholerae increased under serum conditions, demonstrating that TraC helps Salmonella cholerae resist the adverse environment of serum.

[0129] 2.4 Macrophage phagocytosis experiment

[0130] Bacterial internalization assays based on CFU counts were performed on RAW264.7 mouse mononuclear macrophages cultured in DMEM medium supplemented with 10% fetal bovine serum (Sigma) and penicillin-streptomycin solution (Thermo, Cat. NO15140122). RAW264.7 cells were seeded at a density of 102 6 Cells were placed in a six-well plate at 10 cells / well. Adhering cells were used in 10... 7 Infection was performed using bacteria per well, with a multiplicity of infection (MOI) of 10. Normal mouse serum or heat-treated mouse serum was administered post-infection. Three different serum concentrations (12.5%, 25%, and 50%) were used to determine infection and analyze dose-dependent phagocytosis. For heat-inactivated serum, the serum was incubated at 56°C for 30 min to denature heat-labile complement proteins while preserving serum antibodies. Infected RAW264.7 cells were incubated at 37°C with 5% CO2 for 2 h. After incubation, uninternalized bacteria were collected from DMEM medium, and RAW264.7 cells were washed 10 times with PBS. RAW264.7 cells were lysed using 0.02% sodium dodecyl sulfate (SDS), and the number of viable bacteria in residual medium and internalized by macrophages was calculated by serial dilution and colony counting.

[0131] refer to Figure 8-9 Compared with WT241, 241ΔTraC was significantly internalized by macrophages to a greater extent than the wild-type strain when incubated for 1 h at serum concentrations of 12.5%, 25%, and 50%. Furthermore, the difference in the degree of internalization between WT241 and 241ΔTraC increased with increasing serum concentration, indicating that TraC can promote the internalization of Salmonella choleraesuis that evades macrophages.

[0132] 2.5 Macrophage Intracellular Survival Assay

[0133] In this application, wild-type strain WT 241, deletion strain 241△TraC, complement strain 241△TraC R, and overexpression strain 241TraC+P were used to infect RAW264.7 macrophages. Two hours later, gentamicin was used to kill Salmonella cholerae that had not been phagocytosed by macrophages. Intracellular viable bacteria were counted from infected macrophages at 3 h, 6 h, 12 h, and 24 h after sterilization.

[0134] The results are as follows Figure 10 As shown, compared with WT241, 241ΔTraC significantly reduced the intracellular bacterial load in macrophages (P<0.05), decreasing it by 1.2-fold at 3 h of infection. The intracellular proliferation capacity of 241ΔTraC R recovered to the level of the wild-type strain. This indicates that TraC promotes the survival of Salmonella choleraesuis in macrophages.

[0135] 2.6 Cell adhesion and invasion assays

[0136] Cell adhesion assay: Single bacteria were inoculated into LB medium and incubated at 37°C and 180 rpm for 12 h. The cultured bacterial solution was diluted 1:100 into fresh LB medium and cultured at 37°C and 220 rpm until the OD600nm value reached 0.6-0.8. Subsequently, the culture was centrifuged at 4°C and 6000 rpm for 10 min to remove the supernatant. The bacteria were then washed three times with PBS, with the supernatant removed by centrifugation after each wash. The washed bacteria were then resuspended in DMEM solution. The resuspended bacterial solution was added to semi-confluent HeLa cells at an infection dose of 1:100 and cultured together for 2 h. After culture, the cells were washed three times with PBS to remove unattached bacteria. The cells were then lysed and evenly spread onto LB agar plates. The spread agar plates were incubated at 37°C overnight, and colonies were counted.

[0137] Cell invasion assay method: Same as cell adhesion assay, except that after co-culturing bacteria with cells, gentamicin-based PBS solution is used to remove bacteria adhering to the extracellular environment. After washing three times with PBS, cells are lysed. After lysis, the cells are diluted 10-fold with PBS solution, and bacterial counts are performed, with three replicates per assay.

[0138] Results Analysis

[0139] The results are as follows Figure 11As shown, compared to the wild-type strain WT 241, the adhesion and invasion abilities of the 241ΔTraC deletion strain on HeLa cells were significantly reduced (P<0.05). Specifically, its adhesion ability decreased by 2.31-fold, while its invasion ability decreased by 3.74-fold. In contrast, the cell adhesion and invasion abilities of the overexpressing strain 241TraC+P were stronger than those of the wild-type strain WT241. This indicates that the TraC gene enhances the adhesion and invasion abilities of Salmonella choleraesuis to cells.

[0140] 2.6 Animal pathogenicity experiments

[0141] Wild-type Salmonella choleraesuis strain WT 241, deletion strain 241ΔTraC, complement strain 241ΔTraC R, and overexpression strain 241TraC+P were resuscitated using selective medium XLT-4. Single colonies were then picked and inoculated into LB medium and cultured at 37°C and 180 rpm for 5 h. After incubation, the bacterial suspension was centrifuged at 8000 × g for 5 min to collect the cells, and the supernatant was discarded. The bacterial pellet was then resuspended in autoclaved PBS, repeated three times to ensure adequate dispersion. For the final resuspension, the bacterial concentration was adjusted to 5 × 10⁻⁶ cells / mL using PBS. 6 CFU / mL.

[0142] The mice were infected with the same dose to the blank group (PBS), wild-type strain infection group (WT241), deletion strain infection group (241△TraC), complement strain infection group (241△TraC R), and overexpression strain infection group (241TraC+P). The changes in mouse body weight were observed for 7 consecutive days. On the seventh day, the mice were sacrificed and the changes in bacterial load in the spleen and liver were detected.

[0143] During the experiment, the mice were fasted for 12 hours before challenge, and then each mouse was injected intraperitoneally with 100 μL of bacterial suspension, while the control group mice were injected intraperitoneally with the same dose of sterile PBS. At 6 hours after infection, blood was collected via tail vein for colony dilution and counting. 24 hours after challenge, five mice from each group were sacrificed, and their livers and spleens were ground and fragmented in a mortar using sterile PBS. The fragmented solution was then serially diluted with sterile PBS and plated onto selective culture plates, and incubated at 37°C for 16–18 hours. Colony counts were used to determine the bacterial load in different organs of the mice.

[0144] In addition, pathological sections of the liver and spleen of two mice from each group were prepared, and the weight change curves of three mice in each group were calculated daily.

[0145] Results Analysis

[0146] like Figure 12As shown, the weight of mice in the blank group (PBS) increased steadily; the weight of mice in the wild-type, overexpression, complement, and TraC deletion groups decreased significantly compared with those in the TraC deletion group, while the weight loss of mice in the TraC deletion group was relatively mild.

[0147] Tissue section pathology results as follows Figure 13 As shown, the spleen and liver of mice in the blank control group showed no significant changes. Infection with the wild-type 241 strain and the TraC overexpression strain resulted in liver congestion, inflammatory foci, and sinusoidal dilation. The spleen showed hemorrhage and sparse lymphocytes; the severity of lesions was reduced in the deletion group.

[0148] Further reference Figure 14 The results showed that the absence of TraC reduced the bacterial load in the blood, liver, and spleen by more than 90%, 25%, and 50%, respectively. This indicates that TraC enhances pathogenicity in mice infected with Salmonella cholerae.

[0149] 2.7 Mechanism by which the TraC gene affects complement activation

[0150] To further determine the complement activation pathway and complement molecules primarily affected by the relevant genes, a serum resistance assay, consistent with the one described above, was performed using EDTA, serum heated at 50°C for 30 min, and serum pre-incubated with antibodies C1q and C3. Additionally, a Western blotting assay was performed using the method described later. To ensure the reliability of the results, the experiments were repeated three times.

[0151] After resuscitating *Salmonella choleraesuis* on XLT-4 agar plates, single colonies were inoculated into LB medium and cultured at 37°C and 180 rpm for 5 h. The bacterial culture was then centrifuged at 8000 × g for 5 min, resulting in a bacterial pellet. The pellet was then resuspended in sterile PBS, and the bacterial concentration was adjusted to 1 × 10⁹ CFU / mL. Next, a culture containing 10... 9A colony-forming unit (CFU) of *Salmonella choleraesuis* was incubated with NHS for 3 h. Afterward, 40 μL of 5× SDS loading buffer was added to the incubation mixture and thoroughly mixed. The mixture was then heated in a boiling water bath at 1300 W for 10 min, followed immediately by centrifugation at 12,000 rpm for 5 min at 4 °C. After centrifugation, the mixture was ready for Western blotting. A 10% polyacrylamide gel was prepared according to the manufacturer's instructions, and the electrophoresis tank was placed in the electrophoresis apparatus. An appropriate amount of 1× SDS-PAGE gel electrophoresis buffer was added to the electrophoresis tank, ensuring the electrophoresis buffer covered the inner glass plates. Then, an appropriate protein molecular weight marker (180 bp) was selected, and sample loading and electrophoresis were performed. 10 μg of protein was added to each sample well, taking care to avoid overflow to ensure experimental accuracy. The electrophoresis process was performed according to the recommended method in the electrophoresis apparatus manual. When the dye reaches the bottom of the gel (stacking gel voltage: 80 V, 40 min; separating gel voltage: 120 V, 60 min; the specific voltage needs to be determined according to the gel concentration and protein size), turn off the power and stop electrophoresis. At this time, the gel should be immediately transferred to the next step to avoid unnecessary delays. After removing the electrophoresis tank, remove the gel block. After removing the stacking gel, carefully cover the separating gel onto the filter paper, ensuring alignment. Confirm that the cut membrane and filter paper are consistent with the gel size, and carefully remove air bubbles between the membrane and the gel, which can be assisted by using a small roller. Note that the PVDF membrane should be soaked in methanol beforehand and direct contact with hands should be avoided. Next, place the "sandwich" structure in the transfer clamp into the transfer tank, ensuring that the white (clamp) is connected to the positive electrode (tank-red). Set the voltage to 120 V and perform the transfer operation for 2 hours. After the transfer is complete, wash the PVDF membrane once with ultrapure water, and then place it in a pre-prepared 5% skim milk for 1 hour to block it. After blocking, the PVDF membrane was rinsed once with ultrapure water, followed by the addition of diluted mouse complement protein C3 primary antibody, and the reaction was continued on a shaker for 1 h. After the initial antibody incubation, the antibody solution was recovered, and the PVDF membrane was washed three times with TBST (1×), each time for 10 min. After the last wash, pre-diluted secondary antibody was added, and the reaction was continued on a shaker for 1 h. After the secondary antibody incubation, the membrane was washed three times with TBST (1×), each time for 10 min. After the last wash, the colorimetric step could be performed. This study used a high-sensitivity ECL (enhanced chemiluminescence) kit developed by NewSemi Biotechnology Co., Ltd. to detect HRP (horseradish peroxidase) labeled target protein bands, with a detection sensitivity reaching the femtogram (fg) level.First, prepare a dilution buffer by mixing NcmECL UltraLuminol / Enhancer Reagent (A) and NcmECL Ultra Stabilized Peroxide Reagent (B) at a 1:1 volume ratio. Then, remove the membrane from the TBST buffer tray, remove excess buffer, and lay it flat on a cardboard plate with the protein side up. Spread the dilution buffer evenly, ensuring complete coverage. Typically, 1 mL of liquid is sufficient to cover approximately 10 cm² of the membrane. Incubate for 1–5 min to ensure sufficient reaction on the membrane surface. Next, acquire the signal using autoradiography film or an imaging device. For unknown signal intensities, adjust the exposure time to obtain optimal observation results. Finally, quantitatively analyze the grayscale of the Western blot bands using ImageJ and Graphpad software to obtain accurate experimental results.

[0152] Results Analysis

[0153] The results are as follows Figure 15 As shown, after blocking the three complement activation pathways, the serum resistance phenotype of wild-type WT241 was increased in all three pathways, while the serum resistance of the deletion strain 241ΔTraC was significantly increased upon blocking the classical pathway, the MBL pathway, and the classical pathway alone, returning to the level of wild-type WT241 in normal serum (P > 0.05). Serum resistance of WT241 was increased in C3-blocked serum, while the serum resistance of the deletion strain 241ΔTraC was significantly increased and returned to the level of wild-type WT241 in normal serum (P > 0.05); serum resistance of WT241 was significantly decreased in factor I-blocked serum, decreasing 2.75-fold (P < 0.001), which was not significantly different from that of 241ΔTraC in untreated serum. Figure 16-17 ).

[0154] Western blot results showed that, compared with WT241, the serum C3 content was significantly increased after incubation with serum by 241ΔTraC, while the recombinant protein C3 showed no significant change. This indicates that *Salmonella choleraesuis* TraC mainly inhibits complement via the classical pathway, degrading complement C3 by altering the activity of complement factor I. Figure 18-19 ).

[0155] Complement C3 deposits on the surface of target cells, triggering subsequent phagocytic opsonization and direct lysis of target cells. Therefore, this application investigated whether TraC affected complement C3 deposition on the surface of *Salmonella choleraesuis*. Wild-type strain WT241 and the deletion strain 241 were incubated with serum at different concentrations of TraC, and the changes in the degree of complement C3 deposition on the strain surface were detected by Western blotting. The results are as follows: Figure 20As shown, compared to WT241, 241△TraC exhibited significantly increased C3 binding after incubation with different concentrations of serum. Western blot results for different incubation times also revealed that the ability of C3 to bind to WT241 was significantly lower than that of 241△TraC with increasing incubation time. This indicates that the TraC gene significantly increases the strain's ability to evade complement C3 deposition on its surface.

Claims

1. Application of the TraC gene in the preparation of drugs that inhibit bloodborne infection of Salmonella choleraesuis.

2. The application according to claim 1, characterized in that, The drug inhibits Salmonella choleraesuis by suppressing or silencing the expression of the TraC gene.

3. The application according to claim 1, characterized in that, The drug inhibits Salmonella choleraesuis by suppressing or silencing the expression of the TraC gene, thereby inhibiting Salmonella choleraesuis through the following pathways; (1) Reduce serum resistance to Salmonella choleraesuis; (2) Block or reduce the evasion of Salmonella choleraesuis from macrophage internalization and intracellular survival; (3) Reduce the invasive and adhesive ability of Salmonella choleraesuis; (4) Reduce the blood infection capacity of Salmonella choleraesuis.

4. A drug for inhibiting Salmonella choleraesuis, characterized in that, It contains an inhibitor that suppresses TraC gene expression, and a pharmaceutically acceptable vector.

5. A method for constructing a *Salmonella choleraesuis* strain with the TraC gene deleted, characterized in that, Includes the following steps: Step 1: Design primers for amplifying homologous targeting fragments, and use pKD4 plasmid as a template to amplify homologous targeting fragments; Step 2: Competent cells were prepared using Salmonella cholerae, and then the pKD46 plasmid carrying the λRed recombinase gene was electroporated into the competent cells to obtain a Salmonella cholerae strain containing the pKD46 plasmid. Step 3: Culture the Salmonella choleraesuis strain containing the pKD46 plasmid from Step 2, add L-arabinose to induce λRed recombinase expression, and then prepare electrotransfer competent cells again; Step 4: Electroporate the homologous targeting fragment into the competent cells obtained in Step 3, and after verifying that the target gene replacement has been successfully achieved, eliminate pKD46 using temperature-sensitive properties to obtain a preliminary recombinant strain with pKD46 eliminated. Step 5: Electroporate the pCP20 plasmid into the preliminary recombinant strain, screen with ampicillin, express Flp recombinase to remove the kanamycin resistance gene between the FRT sites on the chromosome, and then use the temperature-sensitive property to eliminate the pCP20 plasmid to obtain the TraC gene deletion strain of Salmonella cholerae. The primers for amplifying the homologous targeting fragment were designed based on the TraC of Salmonella choleraesuis and included an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.

1. The nucleotide sequence of the downstream primer is shown in SEQ ID NO.2.